ID: 1061447294

View in Genome Browser
Species Human (GRCh38)
Location 9:130647409-130647431
Sequence CTTTGGAAGGCCAAGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 274879
Summary {0: 52, 1: 2206, 2: 28156, 3: 83347, 4: 161118}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061447288_1061447294 -8 Left 1061447288 9:130647394-130647416 CCTGTAATCCCAGCACTTTGGAA 0: 9594
1: 299194
2: 262940
3: 149017
4: 131705
Right 1061447294 9:130647409-130647431 CTTTGGAAGGCCAAGGTGGATGG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118
1061447283_1061447294 23 Left 1061447283 9:130647363-130647385 CCCACAACTAGGCCAGGTGCGGC No data
Right 1061447294 9:130647409-130647431 CTTTGGAAGGCCAAGGTGGATGG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118
1061447284_1061447294 22 Left 1061447284 9:130647364-130647386 CCACAACTAGGCCAGGTGCGGCG No data
Right 1061447294 9:130647409-130647431 CTTTGGAAGGCCAAGGTGGATGG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118
1061447286_1061447294 11 Left 1061447286 9:130647375-130647397 CCAGGTGCGGCGGCTCGCACCTG No data
Right 1061447294 9:130647409-130647431 CTTTGGAAGGCCAAGGTGGATGG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061447294 Original CRISPR CTTTGGAAGGCCAAGGTGGA TGG Intergenic
Too many off-targets to display for this crispr