ID: 1061450242

View in Genome Browser
Species Human (GRCh38)
Location 9:130663746-130663768
Sequence CGGGGAGTGCAGGGCCGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061450228_1061450242 26 Left 1061450228 9:130663697-130663719 CCGCGTGGCAACTAGGGCTGCGC No data
Right 1061450242 9:130663746-130663768 CGGGGAGTGCAGGGCCGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061450242 Original CRISPR CGGGGAGTGCAGGGCCGGAG AGG Intergenic
No off target data available for this crispr