ID: 1061450898

View in Genome Browser
Species Human (GRCh38)
Location 9:130666528-130666550
Sequence TTCCTTCCCCGCCGGGACCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 164}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061450898_1061450907 1 Left 1061450898 9:130666528-130666550 CCGGGGTCCCGGCGGGGAAGGAA 0: 1
1: 0
2: 2
3: 19
4: 164
Right 1061450907 9:130666552-130666574 GGCCGGGCCTCGGCTGCCTCGGG 0: 1
1: 1
2: 1
3: 30
4: 313
1061450898_1061450910 11 Left 1061450898 9:130666528-130666550 CCGGGGTCCCGGCGGGGAAGGAA 0: 1
1: 0
2: 2
3: 19
4: 164
Right 1061450910 9:130666562-130666584 CGGCTGCCTCGGGCTCTGACCGG 0: 1
1: 0
2: 0
3: 13
4: 137
1061450898_1061450912 20 Left 1061450898 9:130666528-130666550 CCGGGGTCCCGGCGGGGAAGGAA 0: 1
1: 0
2: 2
3: 19
4: 164
Right 1061450912 9:130666571-130666593 CGGGCTCTGACCGGTTTTCCTGG 0: 1
1: 0
2: 2
3: 4
4: 65
1061450898_1061450906 0 Left 1061450898 9:130666528-130666550 CCGGGGTCCCGGCGGGGAAGGAA 0: 1
1: 0
2: 2
3: 19
4: 164
Right 1061450906 9:130666551-130666573 GGGCCGGGCCTCGGCTGCCTCGG 0: 1
1: 0
2: 3
3: 33
4: 287
1061450898_1061450905 -9 Left 1061450898 9:130666528-130666550 CCGGGGTCCCGGCGGGGAAGGAA 0: 1
1: 0
2: 2
3: 19
4: 164
Right 1061450905 9:130666542-130666564 GGGAAGGAAGGGCCGGGCCTCGG 0: 1
1: 1
2: 7
3: 72
4: 663

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061450898 Original CRISPR TTCCTTCCCCGCCGGGACCC CGG (reversed) Intronic
900988418 1:6086526-6086548 TTCTTTCCCACCCGGGTCCCGGG - Intronic
901082243 1:6590099-6590121 CTCCTTCCCAGCCGAGACACTGG + Intergenic
902323713 1:15684707-15684729 GCCCTTCCCCTCCGCGACCCGGG + Intronic
902529805 1:17083695-17083717 GTCCTTCCCAGCCTGGACCTGGG + Intronic
912474933 1:109929163-109929185 TCCCTTCCATGCCGGAACCCAGG + Exonic
917438624 1:175045715-175045737 GTCCTGCCCCGCCGGGCCCGCGG - Intergenic
918478072 1:184947375-184947397 TTCCTTCTCCTCCCAGACCCTGG - Intronic
922739359 1:228006861-228006883 TGCCTGCCCCGCCCGGGCCCCGG + Intergenic
923437190 1:233978577-233978599 TTTCTTCCCCACAGGGATCCTGG - Intronic
923504173 1:234591331-234591353 TTCCTTCCCTGCCAAGCCCCAGG - Intergenic
923612021 1:235504281-235504303 CTCCCTCTCCGCCGGGACGCGGG - Exonic
1063016361 10:2081604-2081626 TCACTTCCCCGCCTGGCCCCTGG + Intergenic
1069694470 10:70376667-70376689 ATCCTTCTCCCCCAGGACCCAGG + Intronic
1069717651 10:70531264-70531286 TTCCTTCCCCCTCGGGCTCCTGG + Intronic
1070105648 10:73428256-73428278 TGCCTTCGTCGCCGGGACCGTGG + Exonic
1070788214 10:79174576-79174598 TCCCTTCCCTGCCAGCACCCAGG - Intronic
1077337694 11:2012777-2012799 TGCCTTCCCAGCCAGGACCCTGG + Intergenic
1078171796 11:8933716-8933738 TTCCATCCCCGTCTGGCCCCAGG + Intergenic
1078814169 11:14802264-14802286 TGCCTACCCCACCGGGGCCCTGG - Intronic
1078891941 11:15565543-15565565 CTCCTTCCCAGCCTGCACCCTGG - Intergenic
1080456895 11:32427001-32427023 TCCCCTCCGCGCGGGGACCCGGG - Intronic
1083268977 11:61561218-61561240 TGCCTTACCCGCCGGGACCTAGG - Intronic
1083487594 11:62993319-62993341 TTCTTTGCCCGCAGGGACCTAGG + Exonic
1083768538 11:64853798-64853820 TGCCTTCCCCTCCCGGGCCCAGG - Exonic
1084213405 11:67634160-67634182 TTCCGTCCCCACCGTGGCCCCGG + Intronic
1084423543 11:69072221-69072243 TTCGTGCCCCCCGGGGACCCTGG + Intronic
1085507195 11:77067226-77067248 TTCCTTTCCCCCCGGGCCCGCGG - Intronic
1088259322 11:107929032-107929054 TTCCTTTCCCGCCTGAACCGGGG + Intronic
1202820678 11_KI270721v1_random:67959-67981 TGCCTTCCCAGCCAGGACCCTGG + Intergenic
1091841151 12:3621819-3621841 TGGCTTCCCTGCAGGGACCCTGG + Intronic
1096337035 12:50764336-50764358 GTCCTTCCCCGCCCGGGCCACGG - Intronic
1097717227 12:62979791-62979813 TTCCTTCCCAGCCTGCACCTAGG - Intergenic
1099300498 12:80888577-80888599 CTCCTTCCCCGTCAGGAACCAGG - Intronic
1101444048 12:104724580-104724602 TTCTTTGCCTCCCGGGACCCTGG - Intronic
1101601297 12:106212507-106212529 TGCCTACCCCACCAGGACCCTGG - Intergenic
1101964543 12:109273517-109273539 TTCCTTCTCCACCGGCCCCCAGG - Intergenic
1102099995 12:110270763-110270785 TCCCTTCCCTGCCGGGTGCCAGG - Intergenic
1103410804 12:120710389-120710411 CCCCTTCCCCGCCGGGCCCCGGG + Intergenic
1104435526 12:128753297-128753319 TTCATTCCCACCCAGGACCCTGG + Intergenic
1105512246 13:21060990-21061012 CCCCTGCCCCGCCGGGATCCCGG + Intronic
1107467709 13:40665409-40665431 TGCCGTCCCCGACCGGACCCGGG + Intronic
1107551527 13:41480421-41480443 TGCCTACCCCACCAGGACCCTGG - Intergenic
1111975900 13:94967618-94967640 TTCCCTGCCAGCCGGGACCCCGG + Intergenic
1113861707 13:113491106-113491128 TCCCTTCCCAGGCGGGACCAGGG - Exonic
1117802899 14:59463965-59463987 TTCCTGCCCAGCCAGGGCCCGGG - Exonic
1118607628 14:67515186-67515208 CTCCTCCCGCGCCGGGACTCGGG + Exonic
1118908419 14:70040876-70040898 CACCTTCCCCACCTGGACCCTGG + Intergenic
1121493220 14:94374838-94374860 TCCCTCCCCAGCAGGGACCCAGG - Intergenic
1122119904 14:99546727-99546749 TTCTTTCCCCGCCGGCACCGTGG - Intronic
1122540965 14:102497455-102497477 CTCCGTCCCCGCAGGGACCCTGG + Intronic
1122705316 14:103617167-103617189 CCCCCTCCCTGCCGGGACCCTGG + Intronic
1123108218 14:105852773-105852795 GTCCTACCCTGCCAGGACCCAGG + Intergenic
1123480776 15:20629115-20629137 TTCCTACACCACCAGGACCCTGG + Intergenic
1123637234 15:22371252-22371274 TTCCTACACCACCAGGACCCTGG - Intergenic
1128199545 15:65792604-65792626 TTCCTTCCTCCCCGGCACTCTGG + Intronic
1129244099 15:74269330-74269352 TTCCTTCCCTGCCAGGCCCACGG - Intronic
1130093600 15:80840389-80840411 CTCCTTCCTGGCAGGGACCCCGG + Intronic
1131611173 15:93965809-93965831 GTCCTTTCCTGCGGGGACCCTGG - Intergenic
1133294846 16:4746665-4746687 TTCCCTCCCTGCAGGGACCCAGG - Intronic
1134521560 16:14921266-14921288 TCCCCTCCTCGCAGGGACCCCGG + Intronic
1134709231 16:16319917-16319939 TCCCCTCCTCGCAGGGACCCCGG + Intergenic
1134716440 16:16359946-16359968 TCCCCTCCTCGCAGGGACCCCGG + Intergenic
1134950374 16:18348728-18348750 TCCCCTCCTCGCAGGGACCCCGG - Intergenic
1134958310 16:18392213-18392235 TCCCCTCCTCGCAGGGACCCCGG - Intergenic
1137057406 16:35752275-35752297 TTGCATCCCCGCTGCGACCCGGG + Intergenic
1137768731 16:50997537-50997559 TGGCTTCCCCACGGGGACCCAGG - Intergenic
1138345388 16:56317151-56317173 AACCTTCCCTGCCTGGACCCAGG - Intronic
1138531551 16:57637232-57637254 TTCAGTCCCCGCCCCGACCCTGG + Intronic
1139145070 16:64313763-64313785 TTCCTTCCCCTCCCAGTCCCTGG + Intergenic
1139914709 16:70420941-70420963 TTCCTTTCCAACAGGGACCCTGG + Intronic
1140022439 16:71251284-71251306 TTCCTGCCCCGCAAGGTCCCTGG - Intergenic
1140442738 16:74999644-74999666 TTCCCGCCCCACCGGGGCCCGGG + Exonic
1142211931 16:88812461-88812483 GCTCTTCCCCGCCCGGACCCGGG + Intergenic
1142566315 17:842442-842464 GGCCTTCCCCGCCGGGATCACGG - Intronic
1143564933 17:7715589-7715611 TTTGCTCCCCTCCGGGACCCAGG + Intergenic
1145961343 17:28888127-28888149 ATCCTTCCCAACCAGGACCCAGG - Intronic
1146008353 17:29176588-29176610 TTCCTCCAGCCCCGGGACCCCGG + Intronic
1146054396 17:29573942-29573964 TCCCTTCCCCACCTGGAGCCAGG - Exonic
1147192840 17:38747627-38747649 GCCCTTCCCCGCCGGGGTCCGGG - Intronic
1147416633 17:40295959-40295981 TTCCTTCCCAGTAGGGACACTGG + Intronic
1148491880 17:48028558-48028580 TTCCTTCACCTCCCTGACCCAGG - Intronic
1149646739 17:58246572-58246594 TTCCTTTCCCGCCCGGCCCTGGG - Intronic
1151993773 17:77595907-77595929 TTCCTTCCCAGCCTTGAGCCGGG - Intergenic
1152931568 17:83112855-83112877 CTCGTGCCCCGCCAGGACCCAGG - Intergenic
1155175720 18:23299542-23299564 TTCCTTCCCCACGCTGACCCAGG + Intronic
1156253858 18:35377051-35377073 GTCCTTCCCCGGCGGACCCCGGG - Intronic
1161080039 19:2306031-2306053 TTCCTTCCCAGCCTGTACACGGG + Intronic
1161123877 19:2545154-2545176 TTCCGTCCCCCAGGGGACCCTGG + Intronic
1161719465 19:5895056-5895078 TTGCTTCCCAGCAGGAACCCAGG + Intronic
1163184581 19:15628822-15628844 TTCCTTTCTCGGCGGGGCCCAGG + Exonic
1163358401 19:16829711-16829733 CCCCTTCCCCTCAGGGACCCCGG + Intronic
1164616070 19:29667468-29667490 CTCCTTCCCTGCAGGGACCTGGG - Intronic
1165443079 19:35842035-35842057 TTCCTTCTCTGCAGGGACTCAGG + Intronic
1165744548 19:38222842-38222864 CTCCTCCCACTCCGGGACCCAGG + Intronic
1165744831 19:38224329-38224351 TCCCGTCCCCGCGGGGTCCCGGG - Intronic
1166840283 19:45692951-45692973 TTCCCTCCCCGCTGTTACCCAGG + Intronic
1167154415 19:47729580-47729602 TTCCTGCCCCGCCTCCACCCTGG - Intronic
1167792960 19:51692234-51692256 TTCCCTCCCAGCCGGCACCCAGG + Intergenic
1168155417 19:54471498-54471520 TTCCCTCCCGACCGGGACCCAGG + Intronic
1168401288 19:56087468-56087490 TTCCTTCCCCTCCTGGATTCCGG - Exonic
927210456 2:20635995-20636017 GTCCTTCCCCGCCGTGGCCGCGG - Intronic
927472507 2:23386170-23386192 CTCCTGCCCGGCCGGGGCCCTGG - Intronic
927777487 2:25913599-25913621 TTGCTTTCCTGCCGGGGCCCTGG + Intergenic
928089089 2:28363292-28363314 TTCCATCTCCTCCAGGACCCAGG + Intergenic
929027549 2:37619397-37619419 CTCCTTCCCCACCAGCACCCAGG + Intergenic
930189191 2:48440774-48440796 TTCCTCCCACCCCGGGAACCCGG + Intronic
932780326 2:74555083-74555105 CTCCTTCCCCGTCGGGACCCGGG + Intronic
946191511 2:218010268-218010290 TTCCTACCCCGCCCCAACCCCGG - Intergenic
948037664 2:234872386-234872408 TTCCTTCCCTGCCGTGCCCCAGG - Intergenic
948835239 2:240623178-240623200 TTCCTGCCCTGTCGGGGCCCTGG - Intronic
949040176 2:241844308-241844330 TTCCGTCCCCGGCTGGCCCCGGG - Intergenic
1169487402 20:6044646-6044668 TTCCTTCCCTCCTTGGACCCTGG - Exonic
1170792652 20:19520756-19520778 TTTCTTCCTCCCCTGGACCCAGG + Intronic
1172774127 20:37397437-37397459 TTCCCTCCCCGCAGGGTTCCTGG + Intronic
1179496630 21:41775909-41775931 TTCCTCCCCCGCCGTTCCCCAGG - Intergenic
1181649486 22:24250951-24250973 TCCCTTCCCCGCCCGCCCCCGGG + Intergenic
1181707885 22:24659795-24659817 TCCCTTCCCCGCCCGCCCCCGGG - Intergenic
1181954627 22:26579416-26579438 TCCCTTCCCCACCGGGCCCCAGG - Intronic
1183175054 22:36217412-36217434 TTCCTCCCCAGCAGGGACTCTGG - Intergenic
1183278941 22:36922095-36922117 TTCCTGCCCAGCTGGGAGCCAGG - Exonic
1183284569 22:36953815-36953837 TTCCTGCCCAGCTGGGAGCCAGG + Intergenic
1183547971 22:38465515-38465537 TTCCTTCCCCTCCAGCACCACGG + Intergenic
1183585316 22:38749975-38749997 GTCCTGCCCTACCGGGACCCAGG + Intronic
1183961528 22:41414263-41414285 TTCCTTCCTGGCCTGGACTCTGG + Intergenic
1185374139 22:50474549-50474571 TTCAGTCCCCGCCCGGCCCCCGG + Intronic
953027573 3:39153716-39153738 CTCCTCCCCCGCCTGGAGCCTGG + Intronic
953623931 3:44555155-44555177 TTCCGCCCCCTCCGGGATCCCGG - Intergenic
956911919 3:73827089-73827111 TTCCTTCCCGGCAGGTACTCTGG + Intergenic
960985899 3:123280532-123280554 TTCCTGCCCTGCAGGGACCCGGG + Intergenic
968470673 4:781108-781130 TGCCTTCCTCGCCGTGAGCCGGG - Intergenic
968693378 4:2008359-2008381 TCTCCTCCCCGCCGGGCCCCGGG - Intronic
969393997 4:6909336-6909358 TCCCTTCCGCGGCGGGGCCCGGG + Intronic
969529491 4:7722924-7722946 TTCCTCCCTCGCCGGCACCAGGG - Intronic
969691578 4:8706907-8706929 CTCCAGCCCCGCCGGGGCCCGGG + Intergenic
969714371 4:8861226-8861248 TGCCTGCCCCGCTGGGGCCCTGG - Intronic
970194199 4:13540027-13540049 TTCCTTGCTCGCCGGGAACTCGG + Intergenic
972765911 4:42152176-42152198 TCCCCTCCCCGCCGGGCGCCGGG + Exonic
978189370 4:105895286-105895308 TGCCTGCCCCGCTGGGCCCCCGG + Intronic
978443973 4:108763117-108763139 CTCCTCCCCCGCCGGGGCCGCGG + Intergenic
981172007 4:141636432-141636454 TTCCGTCCCTGCCGGGGCCTGGG - Intergenic
988774934 5:34469116-34469138 TTCCTACACCACCAGGACCCTGG + Intergenic
996349579 5:122523611-122523633 ATCCTTGCCCTCTGGGACCCTGG + Intergenic
996403083 5:123084211-123084233 TTCATCCTCCGCCAGGACCCTGG - Intergenic
1002521742 5:179796188-179796210 CTTCTTCCCCGCCGCAACCCTGG - Intronic
1003427474 6:6007281-6007303 TCCCTTCCCCGCCAGGAGCTGGG + Intronic
1004924348 6:20403361-20403383 GGCCTTCCTCGCCGGGCCCCGGG + Intronic
1010522108 6:76850079-76850101 TGCCTACCCCACCAGGACCCTGG - Intergenic
1015438084 6:133213639-133213661 GTCCTTCCCCTCCGGGTCCCTGG - Intergenic
1019041743 6:169111472-169111494 CTTCTTCCCCGGGGGGACCCTGG + Intergenic
1020281517 7:6652542-6652564 TTCCTGCCCGGCCGGGAGCCGGG + Exonic
1021116880 7:16754177-16754199 ATCCGTCCCCGCCGGGGACCGGG + Intronic
1022171316 7:27834685-27834707 TTCCATCCCCTCCGAGGCCCAGG + Intronic
1023823466 7:43993128-43993150 TTCTTTCCCTGCCGGGCCCCAGG - Intergenic
1023939634 7:44761341-44761363 CACCTTCCCCGCAGGGACCTTGG - Intronic
1026014070 7:66659023-66659045 TTCCTTCTCGGCCGGGCACCGGG - Intronic
1026829810 7:73603582-73603604 TTCCTTCCCCACGGGGTCCTGGG - Intronic
1027133965 7:75611533-75611555 TCCCTTCCCCTCCCGGCCCCAGG + Intronic
1028630322 7:92926803-92926825 TGCCTACCCCACCGGGGCCCTGG - Intergenic
1029495274 7:100893089-100893111 TCCCCTCCCTGCAGGGACCCAGG - Intronic
1029597339 7:101544944-101544966 GTCCTTCCCCGGCAGGACCCAGG - Intronic
1029751731 7:102546580-102546602 TTCTTTCCCTGCCGGGCCCCAGG - Intronic
1029769683 7:102645671-102645693 TTCTTTCCCTGCTGGGCCCCAGG - Intronic
1035580591 8:737446-737468 CTGCTTTCCCGCCGGGAGCCCGG + Intronic
1036600404 8:10255490-10255512 CTCCTTACCTGCCGGGACCGAGG - Intronic
1037985446 8:23288197-23288219 CTCCTTCCCACCCGGGAGCCCGG - Intronic
1039572473 8:38598813-38598835 TTCCTTGCCATCTGGGACCCAGG + Intergenic
1039806277 8:41002393-41002415 CTCCTTCCCTGCTGGGGCCCGGG + Intergenic
1042804687 8:72758389-72758411 ATCCTTGCCTGCCTGGACCCTGG - Intronic
1049531536 8:143157977-143157999 TCACTTCCCCTCCGGGACCTGGG + Exonic
1049775109 8:144400524-144400546 TTGCCTCCCCGCAGAGACCCAGG + Intronic
1054731379 9:68705427-68705449 TTCCTTCCCCGCCGGTCCTCCGG - Intronic
1056552076 9:87660227-87660249 GGCCTTCCCCGCAGGGAACCGGG + Intronic
1057485298 9:95478120-95478142 TTCCTTCACCACCACGACCCTGG - Exonic
1058412495 9:104748391-104748413 GTCCAGCCCCACCGGGACCCTGG - Intronic
1060588741 9:124802714-124802736 CCCCTTCCCCGCCAGGGCCCAGG + Intronic
1060955162 9:127633457-127633479 ATCCTTACCCTCGGGGACCCCGG + Intronic
1061450898 9:130666528-130666550 TTCCTTCCCCGCCGGGACCCCGG - Intronic
1062094229 9:134694782-134694804 TTCCTTCCCAGTGGGGTCCCAGG + Intronic
1062447489 9:136601811-136601833 TCCCCTCTCCGCCGGGGCCCTGG + Intergenic
1062696112 9:137877374-137877396 CCCCGTCCCCGCCGGGTCCCCGG - Intergenic
1185459447 X:328136-328158 TTCCCACCCCGCCCTGACCCAGG + Intergenic
1192047367 X:67690062-67690084 TTCCTTCCTCTCCTGGACCATGG + Intronic
1196441493 X:115723389-115723411 GGCCTTCCCCGTCGGGAGCCTGG + Intergenic
1196445024 X:115841378-115841400 GGCCTTCCCCGTCGGGAGCCTGG + Intergenic
1196761717 X:119206685-119206707 TTTCTTCCTCTCCTGGACCCGGG - Intergenic
1200145078 X:153922189-153922211 TTCCTTTCCCGCCGGTACCCAGG + Intronic