ID: 1061450901

View in Genome Browser
Species Human (GRCh38)
Location 9:130666535-130666557
Sequence CCGGCCCTTCCTTCCCCGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 399
Summary {0: 1, 1: 0, 2: 7, 3: 43, 4: 348}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061450901_1061450907 -6 Left 1061450901 9:130666535-130666557 CCCGGCGGGGAAGGAAGGGCCGG 0: 1
1: 0
2: 7
3: 43
4: 348
Right 1061450907 9:130666552-130666574 GGCCGGGCCTCGGCTGCCTCGGG 0: 1
1: 1
2: 1
3: 30
4: 313
1061450901_1061450910 4 Left 1061450901 9:130666535-130666557 CCCGGCGGGGAAGGAAGGGCCGG 0: 1
1: 0
2: 7
3: 43
4: 348
Right 1061450910 9:130666562-130666584 CGGCTGCCTCGGGCTCTGACCGG 0: 1
1: 0
2: 0
3: 13
4: 137
1061450901_1061450906 -7 Left 1061450901 9:130666535-130666557 CCCGGCGGGGAAGGAAGGGCCGG 0: 1
1: 0
2: 7
3: 43
4: 348
Right 1061450906 9:130666551-130666573 GGGCCGGGCCTCGGCTGCCTCGG 0: 1
1: 0
2: 3
3: 33
4: 287
1061450901_1061450912 13 Left 1061450901 9:130666535-130666557 CCCGGCGGGGAAGGAAGGGCCGG 0: 1
1: 0
2: 7
3: 43
4: 348
Right 1061450912 9:130666571-130666593 CGGGCTCTGACCGGTTTTCCTGG 0: 1
1: 0
2: 2
3: 4
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061450901 Original CRISPR CCGGCCCTTCCTTCCCCGCC GGG (reversed) Intronic
900092064 1:924955-924977 CCGCCCCTCCCTTCGCTGCCGGG + Intronic
900242166 1:1622255-1622277 GTGGCCCTCCCCTCCCCGCCAGG + Intronic
900269049 1:1778023-1778045 ACGGCCCCACCTTCCCCGCCCGG + Intronic
900283996 1:1890698-1890720 CCGCGTCTTCCTGCCCCGCCCGG - Intronic
900331121 1:2135127-2135149 CCAGCCCTGCCTTCCCTGCCTGG + Intronic
900502219 1:3011897-3011919 CAGGACCTTCCCTCCCCGTCCGG + Intergenic
900990320 1:6095637-6095659 CCTGCCCGTCCCTCCCCACCAGG - Intronic
901930898 1:12595676-12595698 CTCGGCCTTCCTTCGCCGCCCGG - Intronic
902227791 1:15007630-15007652 CCTCCCCTTCCTTCCCTTCCTGG + Intronic
902363027 1:15952485-15952507 CCAGCCATTCCTCCCCTGCCAGG + Intronic
902395515 1:16130419-16130441 CCTGACCTTCGTGCCCCGCCAGG - Exonic
902735946 1:18400831-18400853 AGGGCCCTCCCTTCCCTGCCAGG + Intergenic
902786924 1:18738739-18738761 CCAGCCCTTCCCTCCCAGCTTGG - Intronic
902875685 1:19339427-19339449 TCGTCCCTTCCCTCCCCGACAGG - Exonic
903069129 1:20717906-20717928 CCGCCGCTTCCTCCCGCGCCCGG + Exonic
903552306 1:24166445-24166467 CCAGCCCTTCCTTCCCTGCCTGG + Intronic
904004431 1:27356466-27356488 ACTCCCGTTCCTTCCCCGCCAGG + Exonic
904699749 1:32351418-32351440 CCGCCCCTTCCTTCCGCTCCCGG + Intergenic
906118017 1:43368176-43368198 CCACCCCTTCCCTCGCCGCCCGG + Intergenic
906723055 1:48023262-48023284 CCTGCCCCTTCTGCCCCGCCTGG + Intergenic
906821971 1:48939519-48939541 CCTGCCTTTCCTCCCCCTCCTGG - Intronic
907189035 1:52633417-52633439 CGGTCCCTCGCTTCCCCGCCGGG + Exonic
910758290 1:90713053-90713075 GCCCCTCTTCCTTCCCCGCCAGG + Intronic
914713235 1:150234194-150234216 CCGCCCCCGCCTCCCCCGCCAGG - Intronic
915549834 1:156625498-156625520 CCAGACCTGCCTTCCCAGCCGGG + Exonic
919833220 1:201556517-201556539 GAGGCCCTTCCTGCCCCTCCAGG - Intergenic
920917899 1:210272850-210272872 CCGTCCCTTCCATCCCACCCGGG - Intergenic
922696783 1:227734969-227734991 CCGGCCTTTCCTCCCCGCCCGGG + Intronic
922739354 1:228006854-228006876 CTGCCCCTGCCTGCCCCGCCCGG + Intergenic
923049436 1:230380508-230380530 CCAGCACCTCCTTCCCCTCCCGG + Intronic
923658949 1:235942116-235942138 CCAGCCCTCTCTTTCCCGCCTGG + Intergenic
923914340 1:238485584-238485606 ACCGCCCTCCCTTCCCTGCCGGG - Intergenic
1062973562 10:1666290-1666312 CCTGCCCTGCCTGCCCCGCCAGG + Intronic
1063112007 10:3046037-3046059 CCGGCCCTGCCTCCCGCTCCAGG - Intergenic
1063193527 10:3719160-3719182 CAGGCCCCTCCTTCCACCCCAGG - Intergenic
1064004608 10:11690075-11690097 CCAGCCTTTCCTCACCCGCCTGG + Intergenic
1064038429 10:11935985-11936007 TCCTCCTTTCCTTCCCCGCCTGG + Intronic
1064183707 10:13141810-13141832 CCAGGCCCTCCTTCCCCGCCGGG - Intergenic
1065024251 10:21526162-21526184 CCGGCCCTCCCCGCCCCGCGCGG - Intergenic
1065342888 10:24723389-24723411 GCGGCCCCTCCGCCCCCGCCGGG + Intronic
1066495796 10:35940741-35940763 CTGGCTCTTCCTTCCCTGGCGGG + Intergenic
1067087898 10:43252489-43252511 CCTGCCCTTCCTTCCCAGGCAGG - Intronic
1067461319 10:46460606-46460628 CCTGCCCTTCCTTGCCTCCCAGG - Intergenic
1067546293 10:47194800-47194822 CCAGCCCTGGCTTCCCGGCCTGG + Intergenic
1067569286 10:47359915-47359937 CCTGCCTTTCTTTCCCCTCCAGG + Intergenic
1067625876 10:47923995-47924017 CCTGCCCTTCCTTGCCTCCCAGG + Intergenic
1068721506 10:60251339-60251361 TGGGCCCTTCCTTCCCATCCTGG + Intronic
1069588847 10:69629942-69629964 CCCGCCCTTCCTCCCAGGCCAGG + Intergenic
1069790186 10:71014490-71014512 CCAGCCCTTCCTTCTCCACCAGG + Intergenic
1070167685 10:73911064-73911086 CCGCCCCTCCCTCTCCCGCCCGG - Exonic
1070314199 10:75295137-75295159 CGGGCCCTTCCTGTCACGCCGGG + Intergenic
1070591619 10:77805910-77805932 CCTGCCCTTCCTGCCCTTCCTGG + Intronic
1070765238 10:79052619-79052641 CTGCCCCTGCCCTCCCCGCCAGG - Intergenic
1071336882 10:84607595-84607617 CCGACCCTTCCTTCCCCAGCTGG - Intergenic
1073253134 10:102133826-102133848 CCTTACCTTCCTTCCCGGCCCGG - Intronic
1073288938 10:102403893-102403915 CCGGCCCTTCTTGCCCAGCTGGG + Exonic
1074671532 10:115797441-115797463 CCAGCCCTTCCTTCTGCCCCAGG - Intronic
1074857781 10:117486064-117486086 CAGGCCCTTCCCTGCCTGCCTGG - Intergenic
1074976685 10:118587014-118587036 CTGGCCCATCCTTCCACTCCAGG + Intergenic
1075401314 10:122163435-122163457 CCGGCCCCTCCCGCCTCGCCGGG - Intronic
1075797985 10:125134798-125134820 CCAGCCTTTCCCTCCCAGCCTGG + Intronic
1075801813 10:125159300-125159322 CCTCCCCCACCTTCCCCGCCCGG - Intronic
1076236198 10:128865167-128865189 CCAAGCCTTCCTTCCCAGCCCGG - Intergenic
1076526325 10:131114692-131114714 CCGGCCTTCCCTTCCCGGGCAGG - Intronic
1076911499 10:133392332-133392354 CCGGCCCCTCCACCCCAGCCTGG + Intronic
1077187053 11:1240081-1240103 CCGGCCCTTCCTTACCCTCAAGG - Exonic
1077377075 11:2210077-2210099 CAGGCCCTGCCCTTCCCGCCGGG - Intergenic
1077393925 11:2312010-2312032 CTGGCTCTTCCTGCCCTGCCTGG - Intronic
1077393932 11:2312029-2312051 CCTGCCCTGCCTGCCCTGCCTGG - Intronic
1078152343 11:8769756-8769778 CCAGTCCTTCTTTCCCAGCCAGG - Intronic
1078317564 11:10305605-10305627 CCCGCCCTCCGTGCCCCGCCCGG + Exonic
1080895855 11:36448375-36448397 CCCACCCTTCCATCCCTGCCTGG + Intronic
1082997559 11:59265748-59265770 CTAGCCCTTCCTGCCCTGCCTGG + Intergenic
1083323820 11:61863375-61863397 CCGGCCCTGACTTCCCTACCTGG - Exonic
1083372063 11:62190103-62190125 CCAGCCCTCCCTTCCTAGCCAGG - Intergenic
1083904815 11:65662726-65662748 CCGCCCCTTCCTGCGCCGACGGG - Intronic
1083955870 11:65982474-65982496 CCTGCCCTGCCTTCCCCAGCTGG + Intergenic
1084274180 11:68043311-68043333 CCTGCCCTGCCTCCCCCACCAGG - Intronic
1084421865 11:69064304-69064326 CCTCCCCGCCCTTCCCCGCCAGG + Intronic
1084911899 11:72396217-72396239 CCGGCACTGCCTTCCCTGCTTGG - Intronic
1085054068 11:73394009-73394031 CCTGCTCTGCCTTCCCTGCCAGG + Intronic
1088579333 11:111300014-111300036 GAGTCCCTTCCTTCTCCGCCTGG - Intronic
1089053381 11:115565039-115565061 CCTGCCTTTCTTTCCCTGCCAGG - Intergenic
1089273335 11:117316072-117316094 CCGCCCCTCCCAGCCCCGCCGGG - Exonic
1089372189 11:117969339-117969361 CCCCCCCTTCCTTCCCTGCTGGG + Intergenic
1089494060 11:118899634-118899656 CAGTCCCTTCCCTCCCAGCCAGG - Intronic
1089525031 11:119091514-119091536 CAGGCCCTACCTGCCCCACCCGG - Exonic
1089625473 11:119748326-119748348 CCCGCCCTGCCTTCCCATCCTGG + Intergenic
1090385440 11:126355576-126355598 CCCGCCCTTTCTACCCCTCCCGG + Intergenic
1090658359 11:128862493-128862515 CCGCCCCCTCCATCCCCCCCGGG + Intronic
1090715241 11:129424499-129424521 CCATCCCTTCCTTCCCCTCTTGG + Intronic
1091289659 11:134430901-134430923 TCGGCCTTTCCTTCCCAGCAGGG - Intergenic
1091440029 12:505442-505464 ACGGCCCTTCCTTTCCCCTCTGG - Intronic
1091589456 12:1834735-1834757 CCCGCCCTTCCTACCTGGCCGGG - Exonic
1091660137 12:2377108-2377130 CCAGCCCTTCCTTCTCCTCCAGG - Intronic
1091804200 12:3344105-3344127 CCAGCCCTTCCTGCCCCCGCCGG - Intergenic
1091807402 12:3366165-3366187 CCGCCCCTTCCTTGCCGGCCGGG + Intergenic
1092155390 12:6278769-6278791 CCGCCCCTGGCTTCCCCGCCCGG - Intergenic
1092659585 12:10723365-10723387 CCCGCCCTTCCCTCCCGGGCCGG - Intergenic
1094480172 12:30875170-30875192 CCAGCCCTCCCCTCCCTGCCTGG - Intergenic
1094680118 12:32660343-32660365 CCTCCCCTTTCTTCCCCACCTGG + Intergenic
1096156327 12:49343226-49343248 CCCGCCCTTGCTTCCCAGCCAGG - Intergenic
1096389536 12:51217886-51217908 CCGGCCGTCCCCTCTCCGCCCGG - Intergenic
1096403140 12:51323941-51323963 CCCGCCCCTCCTGCCCGGCCGGG + Intronic
1097293775 12:57941937-57941959 CAGGCCCTTCCTCGCCCACCCGG - Intronic
1100632012 12:96399533-96399555 GCGCCCCTTCCTTCCCCTCCCGG + Intronic
1101716698 12:107318672-107318694 CGGGAGCTTCCTTCCCGGCCTGG + Exonic
1102459750 12:113093236-113093258 CCCGCCCTTCTTTCCCGCCCTGG - Intronic
1102465892 12:113130693-113130715 CCAGCCCTGCCTTCCCCCTCTGG - Intronic
1103716939 12:122950381-122950403 CAGGCCCTCCCTTCCCTCCCTGG + Intronic
1103800484 12:123534119-123534141 CCGGCCGCCCCTCCCCCGCCCGG + Intergenic
1103856077 12:123972437-123972459 CCGGCCCCTCCGCCCCTGCCCGG + Intronic
1103919754 12:124393229-124393251 CCTGCCCCTCCTTCCCCACTTGG + Intronic
1105704352 13:22960258-22960280 CCAGGCTCTCCTTCCCCGCCAGG - Intergenic
1105857303 13:24385310-24385332 CCAGGCTGTCCTTCCCCGCCAGG - Intergenic
1107435399 13:40376773-40376795 CTGGCCCTGCCTTCCTGGCCGGG - Intergenic
1110318242 13:74134474-74134496 CCGGCCCTCGCCTCCCCGCCCGG + Intergenic
1111396138 13:87672083-87672105 CCGGCCCTCCCCTCCCCCCTCGG - Intergenic
1112271793 13:97976173-97976195 CTGGCCCCTCCTCCCCGGCCAGG + Intronic
1113740426 13:112709018-112709040 CCGGCACTCCCCTTCCCGCCTGG - Intronic
1113801872 13:113090928-113090950 CCGGCCCCTCCTTCACTGCGCGG + Intronic
1113889571 13:113728814-113728836 CCGGCCCTTCCGCCCTCTCCAGG - Intronic
1113906393 13:113821230-113821252 CCAGCCCTCCCTTCCCCGCTGGG + Intronic
1114475000 14:22988015-22988037 CCCTTCCTTCCCTCCCCGCCAGG - Exonic
1115120141 14:29928093-29928115 GCGGCCCTTCCCTCCCTGCAGGG + Intronic
1116905133 14:50396794-50396816 CCCGCGCCTCCTTGCCCGCCCGG + Intronic
1118808893 14:69259931-69259953 GCGGGCCTTCCTCCCGCGCCCGG - Intronic
1120023389 14:79554894-79554916 CCGGCCCTTCCTCCTCCTTCAGG + Intronic
1122690157 14:103528468-103528490 CAGGCCCTGCCTCCCCCGACGGG - Intergenic
1122972422 14:105157871-105157893 CTGGCCCTTCCTCCCCAGCCAGG + Intronic
1123108271 14:105852978-105853000 CGGGCCCTGCCTTCCCTGCTGGG + Intergenic
1123827844 15:24101416-24101438 CAGACCCTCACTTCCCCGCCAGG + Intergenic
1123857334 15:24426889-24426911 CAGACCCTCGCTTCCCCGCCAGG + Intergenic
1123861960 15:24477417-24477439 CAGACCCTCACTTCCCCGCCAGG + Intergenic
1124453890 15:29822606-29822628 CCGGCTTTTCCTTCCGCGCTTGG - Intronic
1125602522 15:40923412-40923434 CCTGCCCTTGCCTCCCCACCTGG - Intergenic
1126786217 15:52179693-52179715 CCGCCCCCGCCGTCCCCGCCCGG + Intronic
1127396762 15:58549490-58549512 CCAGCCCTGCCATCCTCGCCTGG - Intronic
1127449823 15:59105458-59105480 CCGGCCCGCCTTTCCCCGTCTGG + Intronic
1128581225 15:68811493-68811515 CCACCCCTTCCCTCCCGGCCAGG - Intronic
1128706847 15:69842890-69842912 CTGCCTCTTCCTTCCCCTCCAGG + Intergenic
1128915861 15:71561786-71561808 CCAGCCCTTCCTTCTCCACCTGG - Intronic
1129450302 15:75647763-75647785 CTGGCCGTCCCTGCCCCGCCGGG + Intronic
1132552983 16:560840-560862 CGGCCCCTGCCCTCCCCGCCTGG - Intronic
1132659680 16:1055776-1055798 CTGCCCATTCCTTCCCGGCCTGG - Intergenic
1132783408 16:1641381-1641403 ACGGCACTTCCTTCCCTCCCCGG - Intronic
1133138000 16:3725571-3725593 CCGGCCTGTGCTTCCCCTCCTGG + Exonic
1133239044 16:4403871-4403893 CCGTCCCCTCCTTCTCAGCCAGG + Intronic
1133276112 16:4639365-4639387 CCCGCCCCACCTTCCCGGCCTGG - Intronic
1135877734 16:26218878-26218900 CCTGCCCTCCCTCCCCCGCTTGG - Intergenic
1136583998 16:31171881-31171903 GGGGCCCTTCCTTCCCTGCCTGG + Intergenic
1137787433 16:51150723-51150745 CCGGCCCGGCCTCCGCCGCCCGG - Intronic
1138439709 16:57026662-57026684 CCGCCCCTTCCTTAGCCACCTGG + Exonic
1139846514 16:69925097-69925119 CCGGGCCTTCCTACCATGCCAGG + Intronic
1140873763 16:79131136-79131158 CCGGGCCTTCCTTCCCAAGCAGG + Intronic
1141694793 16:85614183-85614205 CCGGCCCTTCCTGCTCCGCCTGG + Intronic
1141906199 16:87028592-87028614 CAGGCCCTTCAATCCCAGCCGGG - Intergenic
1142136828 16:88455398-88455420 GCGGCCCTGCCTTCCTCGTCCGG - Intronic
1142177226 16:88650834-88650856 CCGGCCCGGCCTGGCCCGCCTGG + Intronic
1142413016 16:89925804-89925826 ACGGGCCTTCCTGCCCAGCCAGG - Intronic
1143137410 17:4719619-4719641 CCATCCCTTCCTTCTCTGCCTGG - Intronic
1143750237 17:9022103-9022125 CGCGCCCCTTCTTCCCCGCCCGG - Intronic
1143773990 17:9185967-9185989 CAGGCCCTTCCCTCCCTGGCTGG + Intronic
1143780315 17:9225712-9225734 CCGGCCCGCCCTGGCCCGCCCGG - Intronic
1144581395 17:16461445-16461467 CCGGCCCTCCCCTTCCCGCCAGG + Intronic
1144700149 17:17332282-17332304 CCTGCCCTTCCTGCTCCGCGTGG - Intronic
1144730844 17:17525402-17525424 CCAGAACTTCCTTCCCTGCCTGG + Intronic
1145260718 17:21352779-21352801 CCGCCTCTCCCCTCCCCGCCAGG - Intergenic
1145367826 17:22279118-22279140 CCGACCCTCCCTCGCCCGCCAGG - Intergenic
1145747783 17:27332918-27332940 GCTGCCCTTCCGACCCCGCCTGG + Intergenic
1146341168 17:32020942-32020964 GCGCCCCTTCCCACCCCGCCAGG - Intronic
1147343819 17:39773189-39773211 CAGGCCCTTCCTTCCCCAGGAGG - Intronic
1147603918 17:41763321-41763343 CCGTCCCTTCCTTGCCCTCCAGG - Exonic
1147793807 17:43028768-43028790 CCTGCCCTAACTTCCCAGCCAGG - Exonic
1148035425 17:44656430-44656452 CCCGCCCCTCCCTCCCCGCTCGG + Intronic
1148818359 17:50346428-50346450 CCGGCACTCCCTTCCCCAGCAGG + Intronic
1150150857 17:62808084-62808106 TCTGCCCTTCCTCCCCTGCCGGG + Exonic
1150654550 17:67031376-67031398 CAGGGCCTTCCCTCCCTGCCTGG + Exonic
1150770267 17:68035456-68035478 CCGGCCGCTCCCTCACCGCCCGG + Intergenic
1150770274 17:68035475-68035497 CCGGCCGCTCCCTCACCGCCCGG + Intergenic
1150770281 17:68035494-68035516 CCGGCCGCTCCCTCACCGCCCGG + Intergenic
1150770288 17:68035513-68035535 CCGGCCGCTCCCTCACCGCCCGG + Intronic
1151333515 17:73425381-73425403 CCAGACCCTTCTTCCCCGCCCGG + Intronic
1151558464 17:74859007-74859029 CCTGCCCTGGCTTCCCCTCCTGG + Intronic
1151768703 17:76145810-76145832 CAGTCCTTTCCTGCCCCGCCTGG - Intronic
1152038821 17:77890305-77890327 CAAGTCCTGCCTTCCCCGCCGGG - Intergenic
1152092129 17:78252853-78252875 CCGGCGCTCCCTTCCCTGCCTGG + Intergenic
1152097094 17:78278642-78278664 CCGGCTCTTCTTTCCCTTCCAGG - Intergenic
1152293617 17:79454375-79454397 CCAGCCCCTCCTGCCCCTCCTGG + Intronic
1152353672 17:79796873-79796895 CGGGCCCTCCCCTCCCGGCCCGG - Intronic
1152706120 17:81844549-81844571 CCGGCCCTCCATCCCCAGCCTGG + Intronic
1152737326 17:82003955-82003977 TCGGCCCGGCCTGCCCCGCCAGG - Intronic
1152777680 17:82212919-82212941 CCGGCCCCTCCCGCCCCGCCGGG + Intergenic
1152891832 17:82886403-82886425 CTGCCCATTCCTTCCCCGCCGGG - Intronic
1152900121 17:82936378-82936400 GCGGCCCTTCCTTCCGTGCCCGG + Intronic
1152925353 17:83085161-83085183 CCGGGCCTGCCGTCCCCGTCTGG - Exonic
1153911180 18:9708047-9708069 CCGCCCCTCCCGGCCCCGCCTGG - Intergenic
1154133126 18:11752644-11752666 CCGGCCCTGCCCGCCCAGCCTGG - Intronic
1154202278 18:12308048-12308070 CGGGCCCGTCCTTTTCCGCCCGG + Exonic
1155199376 18:23503731-23503753 CCCGCGCTTCCTCCCCCGCGCGG + Intronic
1158729905 18:60011153-60011175 CCTGCCCCGCCTGCCCCGCCTGG - Intergenic
1159003284 18:62991871-62991893 CCGGCTCTTGCTTCCGCTCCGGG - Intergenic
1160703819 19:519884-519906 CCGGGCCCTCCAGCCCCGCCCGG + Intergenic
1160788751 19:913202-913224 CCGTCACTTCCTGCCCGGCCCGG - Exonic
1160880739 19:1318872-1318894 GTGGCCCTTCCCTCCCCGGCAGG - Intergenic
1160913626 19:1486797-1486819 CAGGCCCTGCCATCCCAGCCTGG - Intronic
1161654779 19:5507510-5507532 ACGGCCCTGTCTTCCCCTCCGGG + Intergenic
1161679048 19:5669873-5669895 CCTGCCCTTCCTTCTCCTGCTGG - Intergenic
1161747080 19:6067417-6067439 CCGGCTCTTCCCTCCCTACCCGG + Intronic
1161808753 19:6459637-6459659 CCGGGCCTCCCCTCCCCCCCGGG - Exonic
1162016155 19:7847645-7847667 CCAGCCCATCCTCCCCCTCCTGG - Intronic
1162394552 19:10409261-10409283 CGGGCCCTGCCTCCCTCGCCTGG + Intronic
1162561544 19:11420684-11420706 CCGGCCCCTTCCTCCCCTCCGGG + Exonic
1162834642 19:13308282-13308304 GGGGCCCTGCCTCCCCCGCCTGG - Intronic
1162971231 19:14182640-14182662 CCGGCCCTCCCTCCCAAGCCCGG - Intronic
1163622626 19:18369852-18369874 CCGGCATATCCTTCTCCGCCTGG - Exonic
1163710154 19:18841735-18841757 CCGCCCCTGCCTTCCCAGCCCGG - Intronic
1163829640 19:19541494-19541516 CCAGCCCTTCCTTCCCTCCTGGG + Intronic
1164145948 19:22512689-22512711 CCTGCCCCTCCTTCCACACCTGG - Intronic
1165172855 19:33906101-33906123 CCGGCCCGCCCCGCCCCGCCCGG - Intergenic
1166694778 19:44846352-44846374 CCGGCCCAGCTCTCCCCGCCCGG - Intronic
1166726977 19:45034392-45034414 ACAGCCCTTCCTCCCCAGCCTGG - Intronic
1166944769 19:46390154-46390176 CTGCCCCTTCCATCCCGGCCTGG + Intronic
1167368097 19:49065101-49065123 CCGGCCCCTCCTCTGCCGCCCGG - Intergenic
1167649297 19:50720647-50720669 CCGTGCCATCCTTCCCCTCCAGG + Intergenic
1167674803 19:50877538-50877560 CCGGCCCCTCCTCCCAGGCCTGG - Intronic
926309745 2:11666899-11666921 CCAGCTCTCCCTTCCCAGCCTGG - Intronic
926334879 2:11855556-11855578 CTGGCCCATCCTTCCCCGCCGGG - Intergenic
926735942 2:16073462-16073484 CCTGGCCTTCCTTCTCCTCCGGG - Intergenic
927674049 2:25091487-25091509 GAGGCCCTGCCTTCCCCACCCGG - Intronic
927698491 2:25252628-25252650 CAGCCCCTTCCCTCCCCTCCCGG - Intronic
927794109 2:26033726-26033748 CCAGCACCTCCTTCCCCTCCCGG - Intergenic
927965533 2:27265248-27265270 GCGCCTCTGCCTTCCCCGCCTGG - Intronic
930058832 2:47272282-47272304 CCCACCCTTCCTTCCCTTCCAGG - Intergenic
933646079 2:84813731-84813753 CCTTCCCTCCCTTCCCAGCCAGG + Intronic
933876024 2:86623032-86623054 CCGTCACCTGCTTCCCCGCCGGG - Exonic
934763918 2:96869999-96870021 ACCGCCCCTCCGTCCCCGCCCGG + Intronic
935046620 2:99489477-99489499 GCGGCCCTTCCCTCCGCGCCCGG - Intronic
942565958 2:177264792-177264814 CGGGCCCTTCCTTCCCCCGCCGG + Exonic
944743489 2:202634678-202634700 CGCGCCTTTCCTTTCCCGCCGGG - Intergenic
944933650 2:204545595-204545617 CCGGCCCTGCCAACGCCGCCAGG + Intergenic
946172318 2:217902719-217902741 CCTCCCCTCCCCTCCCCGCCCGG - Intronic
947137961 2:226993985-226994007 CCCACCCTCCCTTCCCAGCCAGG + Intronic
947375509 2:229491081-229491103 CCTGTCCTTCCTTCCTGGCCAGG + Intronic
947592957 2:231395653-231395675 CCGGCCCCTCCTCCCGCGGCCGG + Exonic
1171036139 20:21714276-21714298 CCAGCCCTTCCTCTCCCGCTAGG - Intronic
1171994809 20:31723263-31723285 CGGGTCCTCCATTCCCCGCCCGG + Intronic
1172015494 20:31870434-31870456 CAGGCCCCCCGTTCCCCGCCAGG - Exonic
1172118392 20:32584394-32584416 CCGGCCCTTCCCGGCTCGCCTGG - Intronic
1172386236 20:34536004-34536026 CCTGCCCATCCTTCCAGGCCTGG - Intronic
1172884440 20:38221943-38221965 CCGGCCCTGCCTTTCCCGGTAGG - Intronic
1173252966 20:41374313-41374335 CCTCCCCTTCCTTCCCCCCATGG - Intergenic
1173553213 20:43947851-43947873 CAGCACCTTCCTTCCCAGCCAGG - Intronic
1173576963 20:44118476-44118498 CCTGCCCATCCTTCCCTGGCTGG + Intronic
1175729314 20:61342698-61342720 GCAGCCCATCCTTCCCAGCCAGG - Intronic
1175753601 20:61515550-61515572 CCCTCCCTTCCTTCCCTCCCAGG + Intronic
1175870686 20:62208179-62208201 AAGGCCATACCTTCCCCGCCTGG + Intergenic
1175889514 20:62310081-62310103 CCCTCCCTTCCTACCCCGCCAGG - Exonic
1175927056 20:62476079-62476101 CCCGCCCCTTCTTCCCCGCAGGG + Intergenic
1175995065 20:62808351-62808373 CCGGCGCTTCCATCCTTGCCTGG + Intronic
1176185501 20:63776142-63776164 CCGGCCTTTCCTGCCCACCCAGG + Intronic
1179148185 21:38787536-38787558 CCGGCCCAGCCCTCCCCTCCTGG + Intergenic
1179674288 21:42971548-42971570 CCTGCCCTGCCTTCCTCCCCCGG - Intergenic
1180914843 22:19479002-19479024 CCGCCCCGCCCTGCCCCGCCGGG + Intronic
1180957057 22:19745891-19745913 CAGGCCCTTCCTGCCCAGCCGGG + Intergenic
1181029652 22:20143641-20143663 CAGGGCCTGCCCTCCCCGCCCGG + Exonic
1181478129 22:23180931-23180953 CCGGCCTTACCTGCGCCGCCGGG - Exonic
1181513612 22:23399677-23399699 CAGGGCCTGCCCTCCCCGCCCGG - Intergenic
1181954630 22:26579423-26579445 AGGGCCCTCCCTTCCCCACCGGG - Intronic
1182351250 22:29701192-29701214 CTGGCTCTTCCTTCCCCACAAGG + Intergenic
1182446455 22:30392569-30392591 CCGGCCCTCCCCTCCCCTCTGGG + Intronic
1183414006 22:37672447-37672469 CCCTGCCTTCCCTCCCCGCCAGG + Intergenic
1183593260 22:38794019-38794041 CCGGGCCGGCCCTCCCCGCCTGG + Intronic
1184018029 22:41800524-41800546 CCGCCCCTGCCTGCCCCTCCAGG - Intergenic
1184018068 22:41800740-41800762 CCTGCCCTTCCTGCACCGACTGG + Exonic
1184119649 22:42441473-42441495 GAGGCCCTTCCTTCCTCGCAGGG + Intergenic
1184222632 22:43110686-43110708 CCCGCCCCTCCCGCCCCGCCCGG - Intergenic
1185257859 22:49846238-49846260 CCGGCCCCTTCCTCCCTGCCTGG + Intergenic
1185278078 22:49958326-49958348 CCAGCCCTTCCCTCTCCCCCGGG - Intergenic
1185374137 22:50474542-50474564 CCTGGCCTTCAGTCCCCGCCCGG + Intronic
949936608 3:9120945-9120967 CCAGCCATTCCCTCCCCACCTGG - Intronic
950105866 3:10388032-10388054 GAGGCCCCTCCTTCCCCTCCGGG - Intronic
950217616 3:11170499-11170521 CCGGGTCTGCCTTCCCCACCAGG - Intronic
950565043 3:13764347-13764369 CCCGCCCTTCCTTGCACTCCAGG + Intergenic
951613978 3:24521894-24521916 CCCGCCCTTCCTCCGCCGCCGGG - Intergenic
953415246 3:42712019-42712041 GAGACCCTTCCTTCCCGGCCTGG + Intronic
954028695 3:47803059-47803081 CCGGCCCGGCGTTCCCCACCCGG - Exonic
954376062 3:50194715-50194737 TCAGCCCTTCCTTCCCCGTGCGG - Intronic
960988052 3:123293095-123293117 CCGAACCTTCCTGCCCTGCCAGG - Intronic
961437774 3:126931334-126931356 CAGGCCTTTCCTTCCCCTCCTGG + Intronic
961469312 3:127101336-127101358 CCAGCCCTGCCTTCTCAGCCTGG - Intergenic
961569192 3:127786022-127786044 CGGGGCCTTCCTTCTGCGCCTGG - Intronic
961614779 3:128170135-128170157 CCCGCCCCGCCTCCCCCGCCTGG + Intronic
966640044 3:182179541-182179563 CCAGCCCTTCCTTCCCAACAAGG + Intergenic
966711766 3:182980027-182980049 CCGGGGCTTCCCTCTCCGCCCGG - Intronic
967955078 3:194871753-194871775 CAGGCCCTGCCGGCCCCGCCCGG - Intergenic
968092975 3:195909601-195909623 CCGGCCCTCCCCTCCCGCCCCGG + Intronic
968902055 4:3436490-3436512 CCCGCCCTTCCTGCCCCCCGAGG - Intronic
968905658 4:3449515-3449537 GCGGCCCCGCCTTCCCCTCCAGG + Intergenic
968914139 4:3489784-3489806 CCGGCCCTACCTCCACTGCCCGG - Exonic
969299409 4:6288866-6288888 CTGCCCCTTCCTTCCTGGCCTGG + Intronic
969413184 4:7042886-7042908 CCGTCTCCGCCTTCCCCGCCGGG + Exonic
969540857 4:7787992-7788014 GCGGCCCCTCCCTCCCCTCCGGG + Intronic
969554162 4:7894858-7894880 ATGGCCCTTCCTTCCCCTCGTGG - Intronic
969714375 4:8861233-8861255 CGGGCCCTGCCTGCCCCGCTGGG - Intronic
970034954 4:11722792-11722814 CCAGCCTTTCCTTCCATGCCAGG + Intergenic
970425347 4:15940786-15940808 CCTTCCCTTCCTTCTCTGCCTGG + Intergenic
971124352 4:23736447-23736469 ACGGTCCTTCCTTCCAAGCCTGG + Intergenic
971328573 4:25664082-25664104 CCTCCCCTCCCTTCCCAGCCTGG - Intronic
972396462 4:38663555-38663577 CCAGCCCTTCCCGCCGCGCCCGG + Intergenic
974394366 4:61315553-61315575 CCAGCCCCTCCTTCTCCACCAGG - Intronic
977809723 4:101346111-101346133 CCGGCGCTTCCTTCCGCGCGGGG - Intronic
978754289 4:112285957-112285979 CCGCCCCTTCCTTCCTCTCGAGG + Intronic
985073419 4:186190932-186190954 GCGGCCCTTCCCTCCCTTCCCGG + Intergenic
985504790 5:272472-272494 CCTTCCCTTCCTTCCTCTCCTGG - Intronic
985743325 5:1633123-1633145 CCTTCCCTTCCTTCCTCTCCTGG + Intergenic
989351790 5:40495054-40495076 CCTGCCCCTCCATCCCTGCCAGG + Intergenic
990210654 5:53479675-53479697 CCCCCCCTTCCTCTCCCGCCTGG - Intergenic
992629276 5:78665240-78665262 CCTGGCCTTCCTTCCCAGGCTGG - Intronic
993086942 5:83374849-83374871 CTGGCTCTCCCTTCCCCTCCAGG + Intergenic
997350337 5:133226475-133226497 CTGGCCCTTCCTACCCAGCCTGG + Intronic
998157533 5:139795406-139795428 CCGCCCCCTCCTTCACCTCCAGG + Intergenic
998192756 5:140041849-140041871 CCGCCCCCTCCTTCCTCTCCTGG - Intronic
1001688846 5:173616861-173616883 CCCGCCAGGCCTTCCCCGCCAGG + Intergenic
1003427468 6:6007274-6007296 CTCCCCCTCCCTTCCCCGCCAGG + Intronic
1004198536 6:13527148-13527170 TCCTCCCTTCCATCCCCGCCAGG + Intergenic
1004205905 6:13591796-13591818 CCGGCCCTGCTTGCCCAGCCGGG - Exonic
1004220601 6:13743304-13743326 CCGGCCCTGCCGGCCCCGCCGGG + Intergenic
1004374088 6:15076645-15076667 ACTGCCCTTCCTTCCCCACACGG + Intergenic
1007248956 6:40482750-40482772 CAGGCCCTGCCTCCCCCTCCTGG + Intronic
1008027410 6:46653401-46653423 TCGCCCCTTCCATGCCCGCCTGG + Intronic
1010244918 6:73653916-73653938 CCGGCGCTCCCTTCTCTGCCAGG - Exonic
1015211014 6:130698358-130698380 TCAGCCCTTCCTTCCATGCCTGG + Intergenic
1016328241 6:142927060-142927082 CCGGCGCCTCCGTCCCCGGCCGG + Intronic
1018170297 6:161139029-161139051 GCTGCCCATCCGTCCCCGCCAGG + Intronic
1018793830 6:167170901-167170923 CTGGCTGTTCCTTCCCCGCGGGG - Intronic
1018822506 6:167384180-167384202 CTGGCTGTTCCTTCCCCGCGGGG + Intronic
1019389396 7:777328-777350 TCGGCACTTCCTTCCCGGGCTGG - Intronic
1019503979 7:1381369-1381391 CCGCCTCTTCCCTCCCAGCCTGG + Intergenic
1019537562 7:1537232-1537254 CCGGACCTTCCTTTTCCGCCCGG + Intronic
1019635851 7:2075182-2075204 CCGGCCCTTCCTGCACCTCCAGG - Intronic
1019661729 7:2227992-2228014 CAGGCCCTCCCTGCCACGCCGGG + Intronic
1019698076 7:2458948-2458970 CAGGCCCATGCTACCCCGCCTGG - Intergenic
1020213578 7:6172321-6172343 CAGGCCCCTTCTTCTCCGCCAGG + Intronic
1021466708 7:20952495-20952517 CTGGACCTTCCTTCCACTCCTGG - Intergenic
1022536640 7:31102551-31102573 CCGGCCCTTCCTCCCCTGCCTGG + Intronic
1023867876 7:44247385-44247407 CTGGCCCTGCCTTCCCCTCTGGG + Intronic
1028830777 7:95324576-95324598 CCGCCCCGCCCCTCCCCGCCGGG + Exonic
1029367731 7:100127364-100127386 CCAGCCCGTCCCTCCCTGCCAGG + Exonic
1029712431 7:102307105-102307127 CCTGCCCTCCCTTCCCCCACTGG + Intronic
1032068637 7:128790990-128791012 CCTTCCCTCCCTCCCCCGCCCGG - Intronic
1032388084 7:131538294-131538316 CCTGCCACTCCTTCCCTGCCAGG - Intronic
1034182192 7:149147607-149147629 CCGGCCCTGCCTTCCCCGCACGG - Exonic
1034223025 7:149460263-149460285 CCAGCCCTGTCTTCCCCGCCGGG + Intronic
1034982829 7:155489655-155489677 CCGCCCCGTCCTGCCCCTCCAGG + Intronic
1035179418 7:157078345-157078367 CCTGCCCTCCCTTCCTCGCGTGG + Intergenic
1035205801 7:157293102-157293124 CCGGCCCTGCCTTCCTTCCCAGG + Intergenic
1035449430 7:158966398-158966420 CCTGCCCTACCTACCCTGCCAGG - Intergenic
1038480371 8:27897607-27897629 GCCGCCCTTCCCTCCCCACCAGG - Intronic
1038808057 8:30812640-30812662 CCCGCCCGCCCTTCCCCGCCCGG + Exonic
1038828611 8:31033327-31033349 CCTCCCCTTCCCTCCCCTCCTGG - Exonic
1040734674 8:50491103-50491125 AGGGCCCTTCCTGCCCCGCTGGG + Intronic
1045660681 8:104434404-104434426 CCAACCCTCCCTTCCCCGCATGG + Intronic
1046067203 8:109211305-109211327 ACGGCTCTCCCCTCCCCGCCAGG + Intergenic
1047208131 8:122819757-122819779 CAGGCCCTTCCTTTGCCTCCAGG + Intronic
1047311548 8:123696654-123696676 CCTGCCCTTCCCTCCCACCCAGG - Intronic
1047775530 8:128067398-128067420 CCAGTCCTTCCTTCCACGGCTGG + Intergenic
1047965401 8:130042613-130042635 CTGGCCCTTTCTTCTCCCCCAGG + Intergenic
1049237157 8:141518168-141518190 CCGGCCCTCCCCGCCCTGCCGGG + Intronic
1051160730 9:14204595-14204617 CCGGCGCTTTCTTCTCCGCCCGG - Intronic
1051173038 9:14338839-14338861 CCTGCCCCTCCTTCCCCCCTTGG + Intronic
1053398952 9:37800891-37800913 CCGGCCGATCCGTCCCCTCCAGG - Exonic
1055874172 9:80922827-80922849 CAGGCCCTTCCTTCAACACCTGG + Intergenic
1057390801 9:94639997-94640019 CTGGCCCTTCTGTCCCCGCTAGG + Intronic
1057804473 9:98210628-98210650 CCAGCCCTTCCTGGGCCGCCAGG + Intronic
1057895279 9:98904175-98904197 CCGGCACTTCCTGCCCTCCCTGG - Intergenic
1059170457 9:112119780-112119802 CTGCCCCCTCCTTCCCCGCCAGG - Intronic
1060218199 9:121751014-121751036 CCGGTCCTTCCTTCCCCACCTGG + Intronic
1060770204 9:126326904-126326926 CCGGCCCCTCCCGCGCCGCCCGG + Exonic
1060814280 9:126626583-126626605 CCGGCCCTTCCTTCCAGGTCAGG + Intronic
1061056571 9:128225828-128225850 CCGGCCCTCCCTTGCCACCCGGG - Intronic
1061057961 9:128234133-128234155 CCGCGCCTTCCTTCCACTCCTGG + Intronic
1061450901 9:130666535-130666557 CCGGCCCTTCCTTCCCCGCCGGG - Intronic
1061727624 9:132590114-132590136 TGGCCCCTTCCTGCCCCGCCTGG - Exonic
1061884479 9:133584718-133584740 CCAGCCCATCCTTCACAGCCCGG - Intronic
1062218746 9:135403212-135403234 CCGGCCCCTCCTTCCCCTCCCGG + Intergenic
1062277447 9:135737561-135737583 CCGGCTCTTCTGTCCCGGCCTGG - Intronic
1062321927 9:135994358-135994380 CCTGCCCTCCCTTCCAAGCCAGG - Intergenic
1062332422 9:136050648-136050670 CCACCCCCTCCTCCCCCGCCGGG + Intronic
1062338562 9:136083333-136083355 CCCTCCCTTCCTTCCCAGGCTGG + Intronic
1062435734 9:136545894-136545916 CCCGCCCTCTCTTCCCCGGCTGG + Intergenic
1062595141 9:137295958-137295980 CCGTCCCCGCCGTCCCCGCCTGG + Intergenic
1189915493 X:45851613-45851635 CCTGCCCGCCCATCCCCGCCGGG + Intergenic
1190286161 X:48962654-48962676 CCGGCCCTGCCACCGCCGCCAGG + Exonic
1192821615 X:74652444-74652466 CCTGCCCCTCCTCCCCCGACTGG + Intergenic
1198321480 X:135521843-135521865 CTGGCCCCTCCTTCCTCCCCCGG + Intronic
1200081182 X:153577245-153577267 CCAGCCCTTCCTTCCAGGCTGGG - Intronic
1200107551 X:153723665-153723687 CGGGCGCTCCCTTCCCCGCCAGG + Exonic
1200226166 X:154419072-154419094 CCTGCCCTCCCTCCCCAGCCAGG - Intronic