ID: 1061450903

View in Genome Browser
Species Human (GRCh38)
Location 9:130666536-130666558
Sequence CCCGGCCCTTCCTTCCCCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 373
Summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 328}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061450903_1061450907 -7 Left 1061450903 9:130666536-130666558 CCGGCGGGGAAGGAAGGGCCGGG 0: 1
1: 0
2: 3
3: 41
4: 328
Right 1061450907 9:130666552-130666574 GGCCGGGCCTCGGCTGCCTCGGG 0: 1
1: 1
2: 1
3: 30
4: 313
1061450903_1061450906 -8 Left 1061450903 9:130666536-130666558 CCGGCGGGGAAGGAAGGGCCGGG 0: 1
1: 0
2: 3
3: 41
4: 328
Right 1061450906 9:130666551-130666573 GGGCCGGGCCTCGGCTGCCTCGG 0: 1
1: 0
2: 3
3: 33
4: 287
1061450903_1061450910 3 Left 1061450903 9:130666536-130666558 CCGGCGGGGAAGGAAGGGCCGGG 0: 1
1: 0
2: 3
3: 41
4: 328
Right 1061450910 9:130666562-130666584 CGGCTGCCTCGGGCTCTGACCGG 0: 1
1: 0
2: 0
3: 13
4: 137
1061450903_1061450912 12 Left 1061450903 9:130666536-130666558 CCGGCGGGGAAGGAAGGGCCGGG 0: 1
1: 0
2: 3
3: 41
4: 328
Right 1061450912 9:130666571-130666593 CGGGCTCTGACCGGTTTTCCTGG 0: 1
1: 0
2: 2
3: 4
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061450903 Original CRISPR CCCGGCCCTTCCTTCCCCGC CGG (reversed) Intronic
900536987 1:3183578-3183600 CCCCGGCCTCCCTTCCCCGGCGG - Intronic
900786265 1:4652766-4652788 GCCGGCGCCTCCTTCCCCGCCGG + Intergenic
901026515 1:6281286-6281308 CCCCGCCCTCCCTTCTCCACAGG - Exonic
901399960 1:9008987-9009009 CCAGGCCTTGCTTTCCCCGCAGG + Intronic
901510451 1:9715827-9715849 CCCAGCCCTCCCCACCCCGCAGG + Exonic
901511822 1:9721422-9721444 CCAGCGCCTTCCTTCCCTGCAGG + Exonic
901756090 1:11442429-11442451 CCAGGCTCTGCCTTCCACGCTGG + Intergenic
901814097 1:11784335-11784357 CCCAGGCCTCCCTTGCCCGCTGG + Exonic
901919712 1:12527581-12527603 CCAGGCCCTGCCCTCCCCGAGGG - Intergenic
902323575 1:15684326-15684348 CCCGCGGCCTCCTTCCCCGCCGG + Exonic
902405993 1:16183963-16183985 CCCGCCATTTCCTTCCCCACAGG + Intergenic
903327948 1:22582057-22582079 CCCAGCCCTTCCTTTGCCCCAGG - Intronic
903970910 1:27118236-27118258 CCCGGCCCGGCCCTCCCCTCAGG - Intronic
904034622 1:27551990-27552012 CCCGGCCCCTGCTTCCCACCCGG - Exonic
904751059 1:32741751-32741773 CCCGCTCCTTCCCTCCCCGCCGG + Intergenic
905262372 1:36729002-36729024 CCTGGCCCTTCATCCCCCTCAGG - Intergenic
905846917 1:41241665-41241687 CCCGGCCCACCCGGCCCCGCCGG + Intronic
905875150 1:41427517-41427539 CACGCCCCTTCCTGCCCCGGAGG - Intergenic
908501335 1:64745693-64745715 CCCGGTCTTTCCTTCCCCTACGG + Intronic
908561250 1:65309317-65309339 CCCTTTCCTTCCCTCCCCGCGGG + Intronic
910825681 1:91404754-91404776 CCCGTCCCCACCTTCCCCGCGGG + Intronic
912380654 1:109246447-109246469 CCCCACCCCTCCTTCCCAGCAGG + Intergenic
912522570 1:110255904-110255926 CCTGGCCCTTCCTTCCACAAAGG + Intronic
913071712 1:115304794-115304816 CCTGGCCCTTCCACCCCAGCGGG + Intronic
913521099 1:119647069-119647091 CCCCGCCCTGCCTCCCCCACAGG - Intronic
919727006 1:200891132-200891154 CCCGACCCTGTCCTCCCCGCAGG - Intronic
919916754 1:202144050-202144072 CACGGGCCTTCCTGTCCCGCGGG - Intronic
920880080 1:209871930-209871952 CCCTGCCTTTTCTTCCCTGCTGG + Intergenic
920917901 1:210272851-210272873 CCCGTCCCTTCCATCCCACCCGG - Intergenic
921331104 1:214037295-214037317 CCAGACCCTTCCTTCCCCTTAGG + Exonic
922503037 1:226110569-226110591 GCCGGCCCTGCCTTCCCCAGTGG - Intergenic
922575039 1:226655656-226655678 CCCAGCCCAGCCTTCTCCGCAGG + Intronic
922606579 1:226893358-226893380 CCCTGCCCTTCCAGCCCTGCAGG - Intronic
922818795 1:228470362-228470384 CCCGGCTCTCCCTTCCCTGGTGG - Intergenic
922832395 1:228610422-228610444 CCCGGCCCGGCCGTGCCCGCCGG + Intergenic
922832955 1:228612663-228612685 CCCGGCCCGGCCGTGCCCGCCGG + Intergenic
922833516 1:228614904-228614926 CCCGGCCCGGCCGTGCCCGCCGG + Intergenic
922834076 1:228617145-228617167 CCCGGCCCGGCCGTGCCCGCCGG + Intergenic
922834633 1:228619386-228619408 CCCGGCCCGGCCGTGCCCGCCGG + Intergenic
922835185 1:228621601-228621623 CCCGGCCCGGCCGTGCCCGCCGG + Intergenic
922835744 1:228623821-228623843 CCCGGCCCGGCCGTGCCCGCCGG + Intergenic
922836302 1:228626063-228626085 CCCGGCCCGGCCGTGCCCGCCGG + Intergenic
922836860 1:228628302-228628324 CCCGGCCCGGCCGTGCCCGCCGG + Intergenic
922837419 1:228630544-228630566 CCCGGCCCGGCCGTGCCCGCCGG + Intergenic
922837980 1:228632785-228632807 CCCGGCCCGGCCGTGCCCGCCGG + Intergenic
922838538 1:228635025-228635047 CCCGGCCCGGCCGTGCCCGCCGG + Intergenic
922839096 1:228637250-228637272 CCCGGCCCGGCCGTGCCCGCCGG + Intergenic
922839656 1:228639491-228639513 CCCGGCCCGGCCGTGCCCGCCGG + Intergenic
922840217 1:228641722-228641744 CCCGGCCCGGCCGTGCCCGCCGG + Intergenic
922840777 1:228643963-228643985 CCCGGCCCGGCCGTGCCCGCCGG + Intergenic
922841340 1:228646194-228646216 CCCGGCCCGGCCGTGCCCGCCGG + Intergenic
923914341 1:238485585-238485607 CACCGCCCTCCCTTCCCTGCCGG - Intergenic
924383186 1:243481920-243481942 CCAGCCCCTTCCTTCCCCAGAGG - Intronic
1064183709 10:13141811-13141833 CCCAGGCCCTCCTTCCCCGCCGG - Intergenic
1065342887 10:24723388-24723410 CGCGGCCCCTCCGCCCCCGCCGG + Intronic
1066495795 10:35940740-35940762 CCTGGCTCTTCCTTCCCTGGCGG + Intergenic
1069705441 10:70456527-70456549 TCCGACCTTTCCTTCCCCACTGG + Intergenic
1069859610 10:71462162-71462184 CCCGGGCCTGCCTTCCCCCATGG - Intronic
1070314198 10:75295136-75295158 CCGGGCCCTTCCTGTCACGCCGG + Intergenic
1070788785 10:79177489-79177511 CCCGGCCCTTCTCACCTCGCAGG - Intronic
1071041107 10:81309344-81309366 ACCGGCCCTGCCGGCCCCGCCGG - Intergenic
1071618212 10:87095080-87095102 CCCTCCCCTCCCTTCCCCACTGG - Intronic
1072453780 10:95559664-95559686 CCCTTCCCTTCTTTCCCCTCAGG + Intronic
1073288936 10:102403892-102403914 CCCGGCCCTTCTTGCCCAGCTGG + Exonic
1073535713 10:104275040-104275062 CAAGTCCCTTCCTGCCCCGCCGG - Intronic
1075401316 10:122163436-122163458 CCCGGCCCCTCCCGCCTCGCCGG - Intronic
1075624409 10:123951193-123951215 CCCCGCCCACCCTTCCCAGCTGG + Intergenic
1076574315 10:131453736-131453758 CCCGGCGCTTCCCTCCACCCGGG - Intergenic
1076868592 10:133181622-133181644 CCTGGCCCTGCCTCCCCCGCAGG - Intronic
1077060937 11:617619-617641 CCCGGCCCTGCCTCCCCAGGCGG - Exonic
1077063472 11:627424-627446 TCCGGCCCCTCCGCCCCCGCAGG - Intergenic
1079034896 11:17013428-17013450 CCCACCCCCTCCCTCCCCGCAGG + Intronic
1079284566 11:19117241-19117263 CCCGGCCCCTCCATCTCCCCAGG - Exonic
1080258727 11:30322993-30323015 CCCGCCCCTTCCGTCCCCGGAGG + Intergenic
1081599670 11:44484344-44484366 CCCTGCTCTTTCTTCCCCTCAGG - Intergenic
1082035442 11:47642113-47642135 CCCGGCCCTGCCCTGCCCGGCGG - Intronic
1082757157 11:57088874-57088896 CCCTTCCCTTCCTTCTCCTCCGG - Intergenic
1083425015 11:62578973-62578995 CTCGGCCCTGGCTTCCCCACTGG - Exonic
1083540179 11:63506872-63506894 CCTGACCCTTCCTTCCAGGCTGG - Intronic
1083782245 11:64924650-64924672 CCCGGCCCGCACCTCCCCGCGGG - Exonic
1084171045 11:67401297-67401319 CTCGGCCCCTCCTTGCCCACAGG + Intronic
1084183219 11:67456725-67456747 CCGAGCCCTTCCTGCCTCGCTGG + Intronic
1084423450 11:69071846-69071868 CCCGACCCTTCCCTCCCCTGGGG - Intronic
1084546754 11:69818612-69818634 CCCGGCGCCGCCTCCCCCGCGGG + Intronic
1085017769 11:73186337-73186359 GCTGGCCCTTCCTTCCCCTAGGG - Intergenic
1085025485 11:73234134-73234156 CCCACCCCTCCCTTCCCTGCAGG + Exonic
1086497903 11:87422758-87422780 CCCAGCTCCTCCTTCCCCGCAGG + Intergenic
1089069589 11:115689162-115689184 CCCGGCCCTTCCCTCGCTGATGG + Intergenic
1089273337 11:117316073-117316095 CCCGCCCCTCCCAGCCCCGCCGG - Exonic
1089372187 11:117969338-117969360 CCCCCCCCTTCCTTCCCTGCTGG + Intergenic
1089564709 11:119364408-119364430 TCCGGTCCTGCCTCCCCCGCGGG - Intronic
1091289660 11:134430902-134430924 CTCGGCCTTTCCTTCCCAGCAGG - Intergenic
1091460908 12:642967-642989 CCCGGCCCTCCCTCCCCAGCTGG + Intronic
1091589458 12:1834736-1834758 CCCCGCCCTTCCTACCTGGCCGG - Exonic
1091807400 12:3366164-3366186 CCCGCCCCTTCCTTGCCGGCCGG + Intergenic
1096121876 12:49093864-49093886 CCCAGCCCTTCCTGCCTGGCTGG + Intronic
1097990298 12:65825760-65825782 CCCGGCACCTCCTTCCTCCCGGG - Intronic
1098255520 12:68611396-68611418 CGCCGCCCTCCTTTCCCCGCCGG + Intronic
1099366748 12:81774464-81774486 CCCTGCCCACCCTTCCCCGCAGG - Intergenic
1100862177 12:98817900-98817922 CCTGGCTTTTCCTTCCCAGCAGG - Intronic
1101865175 12:108515278-108515300 CCCGGGTCCTCCTTCTCCGCCGG - Exonic
1102068201 12:109996240-109996262 CCCGGCCTCTAGTTCCCCGCAGG - Intronic
1102505429 12:113381513-113381535 CCCACCCCTCCCGTCCCCGCAGG - Intronic
1102953726 12:117046396-117046418 CCCAGCCCTTCCTGTCCCCCAGG - Intronic
1103084142 12:118048944-118048966 CCAGGCCCTTCCTTCTACCCGGG + Intronic
1103623173 12:122200992-122201014 CACAGCCCTTGCTTGCCCGCGGG - Intronic
1103856086 12:123972455-123972477 CCCGGCCCCTCCGCCCCCGCCGG + Intronic
1104933887 12:132354439-132354461 CCTGGCCATTCCTTCACTGCTGG - Intergenic
1105473921 13:20715023-20715045 CCTGCCCCTTCCTTCCCCTGTGG + Intronic
1107851813 13:44577999-44578021 CCCGGCCCTTGCCTCCTCGGGGG + Intergenic
1108394377 13:49978625-49978647 CCCTGCCCTTCCCTTCCCGTTGG - Intergenic
1111323598 13:86663172-86663194 CCTGGCCCCTCCTTCAACGCTGG + Intergenic
1112308143 13:98293799-98293821 CCTGGCCCTTTCTTCCCAGTGGG - Intronic
1112621909 13:101061909-101061931 CCCGCCCCGCCCTGCCCCGCAGG - Intronic
1113404034 13:110021655-110021677 CAGGGCTCTTCCTTGCCCGCAGG - Intergenic
1113575652 13:111393560-111393582 CCCAGCCATTCCTTCTCCCCAGG - Intergenic
1113906391 13:113821229-113821251 GCCAGCCCTCCCTTCCCCGCTGG + Intronic
1115120140 14:29928092-29928114 CGCGGCCCTTCCCTCCCTGCAGG + Intronic
1118285350 14:64465637-64465659 CCCCGACCCTCCTCCCCCGCAGG - Intronic
1119703373 14:76769758-76769780 CCCAGCCATTCCTTCCCTCCTGG - Intronic
1122690158 14:103528469-103528491 CCAGGCCCTGCCTCCCCCGACGG - Intergenic
1122839100 14:104446125-104446147 CCCTTCCCTTCCTACCCCTCTGG + Intergenic
1122857626 14:104567437-104567459 TCCGGCCCTTCCTACCCCAGGGG - Intronic
1122862604 14:104589259-104589281 CCAGACCCTTCCCTCCCCGTGGG - Exonic
1122959379 14:105087539-105087561 CCTGGCCCTTCCCGCCCGGCGGG + Intergenic
1122984192 14:105204797-105204819 CCCTGCCCTGCCCTCCCCTCTGG + Intergenic
1123061459 14:105596610-105596632 CCCTGCCCTTCCTTCCCCTCTGG + Intergenic
1123085912 14:105717521-105717543 CCCTGCCCTTCCTTCCCCTCTGG + Intergenic
1123108270 14:105852977-105852999 TCGGGCCCTGCCTTCCCTGCTGG + Intergenic
1124121825 15:26894440-26894462 CCGGGCCCCTCCTTCCCCCCGGG + Intronic
1124235107 15:27983604-27983626 CCCAGCACTGCCTTCCCCACAGG - Intronic
1128987413 15:72231292-72231314 CCCGCCCCCTGCGTCCCCGCGGG + Exonic
1129540353 15:76342875-76342897 CCCGGCGCTTCCTTCCCCAGCGG + Intergenic
1132154463 15:99485911-99485933 CCCAGCACTTCCTTCCTCTCTGG - Intergenic
1132597852 16:761448-761470 CCCGGCCCTTCCTGCTCTGAGGG - Intronic
1132840109 16:1974741-1974763 CCCTCACCTTGCTTCCCCGCAGG + Exonic
1133078073 16:3295280-3295302 CCCGGCCTTTCCCTGCCCTCTGG + Intronic
1137585971 16:49664266-49664288 CTCGGCCCATCCTTCTCCGCCGG - Intronic
1137661403 16:50210060-50210082 CCCTGCCCCTCCTTCCCCTAAGG + Intronic
1137686917 16:50392708-50392730 CCCTGTCCATCCCTCCCCGCAGG - Intergenic
1138346336 16:56322543-56322565 CAAAGCCCTTCCTTCCCCTCAGG + Intronic
1138528605 16:57622813-57622835 CCCAGGCATGCCTTCCCCGCTGG + Intronic
1138553454 16:57759344-57759366 CCCGGCCCTTTCTACCCCCGGGG + Intronic
1139923867 16:70475128-70475150 CCAGCCCCTTCCTTCCCTTCAGG - Intronic
1140279364 16:73541022-73541044 CCTGGCCCTGCCTACCCAGCAGG + Intergenic
1142349744 16:89574720-89574742 CCCGGCCCTGCCAGCCCCGTGGG + Intergenic
1142549836 17:732127-732149 CTCCCTCCTTCCTTCCCCGCGGG + Intergenic
1142887257 17:2920472-2920494 TCAGGCCCTGCCTCCCCCGCTGG + Intronic
1143404974 17:6671333-6671355 CCCTGCCCTTCCTTCCACCAGGG + Intergenic
1144945443 17:18967331-18967353 TCCTGCCCTTCCTTCCACGGTGG - Intronic
1145816365 17:27797794-27797816 CCGGGCCCATCCTTCCTCCCAGG - Intronic
1146255939 17:31391654-31391676 CCCTCCCCTCCCTTCCCCTCCGG + Exonic
1146282981 17:31557512-31557534 CCCTGCCCTTTCATCCCCCCAGG + Intergenic
1147210522 17:38870312-38870334 CCCGGCCCTTCTCTCCTCCCTGG - Intronic
1147742268 17:42676110-42676132 CCTGCCTCTCCCTTCCCCGCTGG - Intronic
1147989502 17:44324413-44324435 CCCGGCCCTCCCCGCCCGGCCGG + Intronic
1148048660 17:44758908-44758930 CCCGGCCCCCCCAGCCCCGCAGG - Intergenic
1148148132 17:45378938-45378960 CCCGGCCCTGCCCTGCCTGCTGG + Intergenic
1148214804 17:45828707-45828729 CCCGGCCCCTCCTTGCTCACAGG + Intronic
1149491101 17:57085609-57085631 CCCCTCTCGTCCTTCCCCGCCGG + Intronic
1149867286 17:60157864-60157886 CCCGCCCCCTCCTGCCTCGCTGG - Intronic
1149993201 17:61394122-61394144 CCCGGCCCTTCCCCTCCAGCAGG + Intergenic
1151475939 17:74344396-74344418 CCCCGCCCCTCCTGCCCCTCAGG - Intronic
1151479609 17:74362285-74362307 CCAGGCCCTTCCTTTGCAGCCGG - Intergenic
1151579941 17:74972191-74972213 CCCTGCCCCTCATTGCCCGCGGG - Intronic
1152038822 17:77890306-77890328 CCAAGTCCTGCCTTCCCCGCCGG - Intergenic
1152777678 17:82212918-82212940 TCCGGCCCCTCCCGCCCCGCCGG + Intergenic
1152891833 17:82886404-82886426 ACTGCCCATTCCTTCCCCGCCGG - Intronic
1153033987 18:741465-741487 CCTGGCCCTCCCTTCCCCTCTGG + Intronic
1157110617 18:44816829-44816851 CACCTCCCTTCCTTCCCCGTGGG + Intronic
1157464248 18:47930628-47930650 CTCACCCCCTCCTTCCCCGCGGG - Intronic
1159003286 18:62991872-62991894 CCCGGCTCTTGCTTCCGCTCCGG - Intergenic
1160577201 18:79863547-79863569 CCCGGCCCCTGGATCCCCGCGGG + Intergenic
1160899174 19:1418552-1418574 CCCGGCCCGCCCCGCCCCGCCGG - Intronic
1160918879 19:1510594-1510616 CCCTGCCCCTCCTCCCCCGCCGG - Intronic
1161412358 19:4123712-4123734 CTCGCCCCGTCCTTCCCCGAGGG + Intronic
1161471220 19:4457564-4457586 CCCGGCCGTCCCCGCCCCGCAGG + Intronic
1161607496 19:5222942-5222964 CCGGGACCGTCCTTCTCCGCTGG - Exonic
1161654778 19:5507509-5507531 CACGGCCCTGTCTTCCCCTCCGG + Intergenic
1162561542 19:11420683-11420705 CCCGGCCCCTTCCTCCCCTCCGG + Exonic
1163245864 19:16093780-16093802 CCTTGCCCTGCCTTCCCCTCTGG + Intronic
1163829638 19:19541493-19541515 ACCAGCCCTTCCTTCCCTCCTGG + Intronic
1164004649 19:21137303-21137325 AGAGGCCCTTCCTTCCCCTCTGG - Intergenic
1164026439 19:21357641-21357663 AGAGGCCCTTCCTTCCCCTCTGG + Intergenic
1165559445 19:36666754-36666776 CCCAGCTCTTCCTTCTCCACCGG + Exonic
1165834124 19:38744005-38744027 CGCGACCCTTACTTCCCTGCTGG - Exonic
1165906784 19:39199151-39199173 CCCGGCCCTTCTTTCACAGCTGG + Exonic
1166317582 19:41997712-41997734 CCCCGCCCTCCCTGCCCCGCCGG - Intergenic
1166321487 19:42021912-42021934 CCAGCCCCTTCCTTCCCAGTAGG + Intronic
1166857947 19:45792548-45792570 CCCGGCCCTGCCTCCGCCTCCGG - Exonic
1166930974 19:46301110-46301132 CCCGTCCCCTCCTTCCTGGCTGG - Intronic
1167690016 19:50979673-50979695 CCCGGCCTTGCCCTCCCCCCAGG - Intronic
925746622 2:7049088-7049110 CCAGGCCCTGCCTTCCCTCCAGG - Intronic
926217371 2:10913792-10913814 CTCGGCGCCTCCTTCCCCGCAGG - Exonic
926334880 2:11855557-11855579 GCTGGCCCATCCTTCCCCGCCGG - Intergenic
927848479 2:26484417-26484439 GCCAGCCCTTCCTTCCCCCAGGG - Intronic
928071607 2:28222901-28222923 CCCTGGCCCTGCTTCCCCGCAGG + Intronic
928085335 2:28342766-28342788 CCCGGCCCCTGCTTTCCCACAGG + Intergenic
929574491 2:43043306-43043328 CCAGGCCCTTCCTGCCCCCCAGG + Intergenic
931681272 2:64751408-64751430 CCCGCCCGCTCCTTCCCCTCTGG - Intergenic
932410647 2:71545434-71545456 CCAGCCCCTCCCTTCCTCGCTGG + Intronic
933876026 2:86623033-86623055 CCCGTCACCTGCTTCCCCGCCGG - Exonic
933886244 2:86720908-86720930 CCCGGCCCTTGCCTCCCCTGAGG + Intronic
933923936 2:87075798-87075820 CCCGGCCCTTGCCTCCCCTGAGG - Intergenic
934650845 2:96090524-96090546 CCTGGCCTTTTCTTCCCAGCCGG - Intergenic
937979861 2:127608633-127608655 CCCAGCCCTGCCTACCCCACAGG - Intronic
938168572 2:129055388-129055410 CCTGGGCCTTCCTTCCTCCCTGG + Intergenic
940830095 2:158457084-158457106 CCCGCCCCTCCCTCCCCCACCGG - Intronic
945448008 2:209960917-209960939 CCCTCCACTTCCTTTCCCGCTGG + Intronic
946249052 2:218402047-218402069 CCTGGTCCTTCCTCCCACGCAGG - Intronic
946461203 2:219870377-219870399 CCAGCCCCTTCCTTCCTTGCTGG - Intergenic
947564438 2:231185215-231185237 CCCTGCCTGTCCTTCCCCGCAGG + Intergenic
948174949 2:235935970-235935992 CCTGGCCCGGCCCTCCCCGCTGG + Intronic
948230443 2:236345283-236345305 CACGTCCCTTCCTTCACAGCAGG + Intronic
948461778 2:238133107-238133129 CCCGGCCCTGCCTGCCCCAATGG - Exonic
948560786 2:238849563-238849585 CCCCGCCCATCCAGCCCCGCAGG + Intronic
949019485 2:241733390-241733412 CCTGGCCCTTCCTACCTGGCTGG - Intergenic
1171173616 20:23035508-23035530 CCCAGCCCTTCCTCGCCCCCGGG - Exonic
1171512495 20:25696694-25696716 CCCGGCCCTTCTTCCTGCGCCGG + Intronic
1171972594 20:31573340-31573362 CTTGGCCCCTCCTTCCCCTCCGG - Intronic
1172649367 20:36492110-36492132 CCGGCCACTTCCTCCCCCGCTGG - Intronic
1173831220 20:46089837-46089859 CCCGGCCGCTCCTTCGCCTCAGG + Exonic
1175311021 20:58011637-58011659 CCCGGCCCTTCTTTCCAAGTGGG - Intergenic
1175785444 20:61708984-61709006 CTCAGCCCTGCCTTCCCCGAAGG + Intronic
1175836722 20:62000802-62000824 CACGGCCCTGCCTTCCACGTGGG - Intronic
1175927054 20:62476078-62476100 GCCCGCCCCTTCTTCCCCGCAGG + Intergenic
1176127705 20:63483335-63483357 CCAGGCCCTTCCAGCCACGCTGG + Intergenic
1179898748 21:44378012-44378034 CCCACCCTTTCCTTCCACGCCGG - Intronic
1180149987 21:45942496-45942518 CCCGGCACTTCCTTCCCCTGGGG + Intergenic
1180914841 22:19479001-19479023 CCCGCCCCGCCCTGCCCCGCCGG + Intronic
1180957056 22:19745890-19745912 CCAGGCCCTTCCTGCCCAGCCGG + Intergenic
1181954631 22:26579424-26579446 CAGGGCCCTCCCTTCCCCACCGG - Intronic
1182446453 22:30392568-30392590 TCCGGCCCTCCCCTCCCCTCTGG + Intronic
1183156724 22:36081410-36081432 CCTGGCCTTTCCTTCTCCTCTGG + Intergenic
1183259620 22:36786024-36786046 CCTGACCCTTCCTTCCCTCCAGG + Intergenic
1183271563 22:36865589-36865611 CCTGGTCCTTCCTCCCCAGCTGG + Intronic
1183509346 22:38225862-38225884 CCCGGCCCTGGCTTCCACACTGG - Intronic
1184119648 22:42441472-42441494 CGAGGCCCTTCCTTCCTCGCAGG + Intergenic
1184273000 22:43395499-43395521 CCAGGCCCTCCCTTCCAGGCTGG - Intergenic
1184500827 22:44870527-44870549 CCCGGCTCCTTCTTCCCCACTGG + Intergenic
1184764295 22:46563670-46563692 GGCGGCCCTTCCTTCTCCTCAGG - Intergenic
1184771386 22:46598789-46598811 CCAGCTCCATCCTTCCCCGCTGG - Intronic
1185278080 22:49958327-49958349 CCCAGCCCTTCCCTCTCCCCCGG - Intergenic
1185321483 22:50201965-50201987 CCTGGCCCTGACTTCCCTGCGGG + Intronic
949516770 3:4814573-4814595 CTTTGCCCTTCCTTCCCCTCGGG - Intronic
951613980 3:24521895-24521917 GCCCGCCCTTCCTCCGCCGCCGG - Intergenic
952389697 3:32869689-32869711 CCCGCCCGTTCCTTTCCTGCTGG + Intronic
953913071 3:46902498-46902520 CCCTGACCTACCTGCCCCGCTGG + Intronic
957074054 3:75587829-75587851 CCCGGCGCTTCCCTGCCAGCTGG + Intergenic
960636232 3:119787421-119787443 CCCTGCCCTGCCTTCCTCACAGG + Intronic
961467215 3:127089241-127089263 CCCAACCCTCCCTTCACCGCGGG - Intergenic
961603990 3:128080000-128080022 CCAGGCCTGTCCTTCCCTGCTGG - Intronic
961745588 3:129061868-129061890 CACGGCCCTGCCTGCCCTGCCGG + Exonic
961827914 3:129608207-129608229 CCCTGCCCTTCCTTCCTGGTTGG - Intergenic
962827437 3:139110268-139110290 CCAGGCCCTTCCTGCGCCGGGGG - Intronic
965531333 3:169773360-169773382 CCCCTCCCTTCCTTCCACGGTGG - Exonic
968606007 4:1536120-1536142 CCCGGCCTCTCCTGCCCCTCGGG + Intergenic
968614116 4:1569665-1569687 CCCCACCCTTCCTCCCCCACAGG - Intergenic
968905279 4:3447972-3447994 CCCGGCAGCACCTTCCCCGCAGG + Exonic
969413182 4:7042885-7042907 CCCGTCTCCGCCTTCCCCGCCGG + Exonic
969714376 4:8861234-8861256 CCGGGCCCTGCCTGCCCCGCTGG - Intronic
969720342 4:8890082-8890104 CTCAGCCCTTCCTTCCCCCGGGG - Intergenic
970824326 4:20253788-20253810 CCCGCCGCCTCCTTCCTCGCCGG - Exonic
972396509 4:38663716-38663738 CGCCGCCCTTCCTTCCCCCCGGG + Intergenic
976104317 4:81600663-81600685 CTCGGGCCCTCCTTCCCCACTGG - Intronic
977809725 4:101346112-101346134 CCCGGCGCTTCCTTCCGCGCGGG - Intronic
979785693 4:124712815-124712837 CTCGGCCTTTCTTTGCCCGCCGG + Intergenic
980930016 4:139176537-139176559 CCCCGCCCTGGCCTCCCCGCGGG + Intronic
982868824 4:160550376-160550398 GCCGGCCCTGCCGGCCCCGCCGG - Intergenic
984760211 4:183357032-183357054 CCCGCCCCGGCCTGCCCCGCCGG + Intergenic
985658257 5:1143065-1143087 CACGGGCCTTCCTTCCCTGAGGG + Intergenic
988578013 5:32444866-32444888 CCAGGCCCCTCTTCCCCCGCGGG - Intergenic
988993055 5:36690171-36690193 CCCGGCCCTGCCCAGCCCGCAGG - Intergenic
993907867 5:93643311-93643333 CTTGGCCCTTCCTTCCCCCAGGG - Intronic
996873542 5:128217164-128217186 CCCAGGCCTTCCTACCCAGCAGG - Intergenic
997294168 5:132759625-132759647 CCAGGCCCTTCCTTCCTTGGTGG - Intronic
997296938 5:132774389-132774411 CTCAGCCCTTTCTTCCCCGAGGG - Intronic
997402246 5:133612126-133612148 CCCAGCGGTCCCTTCCCCGCGGG + Intronic
1000312835 5:160061888-160061910 CCCGGCCTTTCCTCCTCCACAGG - Intronic
1001120082 5:168972879-168972901 CCCAGTCCTTCCGTCCCCCCAGG + Intronic
1001297129 5:170505906-170505928 CCAGTCCCTTCCTTGCCAGCAGG - Intronic
1002259764 5:177984977-177984999 AAGGGCCCTTCCTTCCCAGCAGG - Intergenic
1002563894 5:180099586-180099608 CCCAGCCCTGCCTTCTCCACGGG + Intergenic
1003113000 6:3264546-3264568 CCCTGCCCTGCCTTCCCCCTGGG - Intronic
1003212416 6:4079340-4079362 CCCCGCCCGGCCTCCCCCGCGGG + Exonic
1004220599 6:13743303-13743325 GCCGGCCCTGCCGGCCCCGCCGG + Intergenic
1005952233 6:30640513-30640535 CCCGCCGCTTCCTTCCTCACAGG + Exonic
1006132423 6:31877547-31877569 CCAGGCCCTACCTTACCCTCTGG + Intronic
1006788383 6:36682966-36682988 CCCGGCCCCTCCTTACCCCTAGG + Intronic
1007111219 6:39314365-39314387 CCTGGCCCTTCCCTCCCACCGGG - Exonic
1007410001 6:41656018-41656040 CCTGGCCCTCCCTGCTCCGCAGG + Intergenic
1013803350 6:113971025-113971047 ACCGGCCTGCCCTTCCCCGCGGG - Exonic
1017212828 6:151875970-151875992 CCCCGCCAATCCTTCCCCACAGG - Intronic
1018793831 6:167170902-167170924 CCTGGCTGTTCCTTCCCCGCGGG - Intronic
1018822505 6:167384179-167384201 CCTGGCTGTTCCTTCCCCGCGGG + Intronic
1019298279 7:290352-290374 CCCCGCCCTTCCTTCGTCCCAGG - Intergenic
1019343924 7:520558-520580 CGCGGCCCTGCCTTCGGCGCGGG - Intergenic
1019422830 7:958956-958978 CCCATCCTTTCCTCCCCCGCTGG + Intronic
1019586940 7:1810151-1810173 CAAGGCCCCTCCTTCCCCACGGG + Intergenic
1019661728 7:2227991-2228013 CCAGGCCCTCCCTGCCACGCCGG + Intronic
1019896985 7:3990309-3990331 CCAGGCCCTTCTTCCCCTGCGGG + Intronic
1022427717 7:30284717-30284739 CCCGGCCCCTCCTTCGCAGGGGG + Exonic
1023746730 7:43329143-43329165 CCCAGACCTTCCTTCCCAACTGG - Intronic
1023867875 7:44247384-44247406 CCTGGCCCTGCCTTCCCCTCTGG + Intronic
1023873748 7:44276112-44276134 CCCTGCCCCTCTTTCCCCTCTGG - Intronic
1027221453 7:76216790-76216812 CCCGGTCTTTCCTCCCCCGAGGG - Intronic
1028830775 7:95324575-95324597 CCCGCCCCGCCCCTCCCCGCCGG + Exonic
1029274950 7:99398394-99398416 CCCAGCCCTTCCTTCCTTGTAGG - Intronic
1029281475 7:99438617-99438639 TCGGGCACTTCCTTCCCCTCTGG + Intronic
1032285414 7:130535620-130535642 CCCAGCCCACCCTTCCCTGCCGG - Intronic
1032894053 7:136231360-136231382 CCAGGCCCTTCCTCCCACACTGG - Intergenic
1033659098 7:143391535-143391557 CCCCACCCTTCCTTGCCCACAGG - Exonic
1034223023 7:149460262-149460284 CCCAGCCCTGTCTTCCCCGCCGG + Intronic
1034560616 7:151877291-151877313 CCCTGCCCTTCTTGGCCCGCTGG - Intergenic
1035026975 7:155832613-155832635 CCTGCCCCTTGCCTCCCCGCAGG + Intergenic
1036712145 8:11086899-11086921 CCCGGCCAGTCCTGTCCCGCAGG + Intronic
1037809840 8:22080816-22080838 CCCGGTCCATCCTCCCCCTCTGG - Exonic
1038727649 8:30095564-30095586 CCCGGCCCATCTTCCCCCGCCGG - Intronic
1039757832 8:40542085-40542107 CCCAGTCCTTCCCTCCCCTCCGG - Intronic
1039969485 8:42308989-42309011 TCCGGCCCTTCCTCCCCAACTGG + Exonic
1040734673 8:50491102-50491124 CAGGGCCCTTCCTGCCCCGCTGG + Intronic
1041449812 8:57994701-57994723 CTCGGCCCTTCGTCCCTCGCGGG + Exonic
1042858946 8:73294668-73294690 CCCGGCCCTGCACTCTCCGCGGG - Exonic
1042902903 8:73746567-73746589 CCCTGTCCTCCCTCCCCCGCCGG + Intronic
1046539313 8:115558379-115558401 ACTGGCCATTCCTTCCCCACTGG - Intronic
1047210311 8:122835263-122835285 CCCCGCCCTTACTTCAGCGCCGG - Intronic
1048975961 8:139673193-139673215 CCCGGCCCTCCATTCCCCCCAGG - Intronic
1048981015 8:139703438-139703460 CCCGTCCCTGCGTTTCCCGCGGG - Intergenic
1048986538 8:139737936-139737958 CAGGGCCCTTCCTCTCCCGCGGG + Intronic
1049237155 8:141518167-141518189 CCCGGCCCTCCCCGCCCTGCCGG + Intronic
1049587877 8:143440363-143440385 TCTGCCCCTTCCTTCCCTGCAGG - Exonic
1049693134 8:143971461-143971483 CCCGGCCCTTCCTGTCCCTGGGG - Intronic
1049747624 8:144269731-144269753 CCGGGCCCTGGCTTCCCGGCGGG - Intronic
1051431477 9:16984739-16984761 CCCTGCCCTTCCTTCCTCCCAGG - Intergenic
1052824889 9:33167358-33167380 CCCGCCCCTCCCCTCTCCGCCGG - Intergenic
1053364339 9:37511987-37512009 CCAGGTCCTTCCTTCCTCCCAGG + Exonic
1053456728 9:38238731-38238753 CCCGGCCCTTCCTCCAACACTGG + Intergenic
1054731383 9:68705435-68705457 CTTTCCCCTTCCTTCCCCGCCGG - Intronic
1056754286 9:89372429-89372451 CCCTGCCCGTCCTTCACGGCTGG + Intronic
1057277228 9:93682327-93682349 CCCGGCCCTGCCCTGCCCCCCGG - Intergenic
1057607103 9:96506854-96506876 GCCAGCCCTTCCTTCCTCACAGG + Intronic
1057703948 9:97384708-97384730 CCTGGCCATTCCTTCCTGGCTGG - Intergenic
1058413833 9:104764333-104764355 CCCGCCCCTCCCCTCCCCTCCGG - Intronic
1059825794 9:118027510-118027532 CCCGCCCCTTCCTTCTGCCCTGG + Intergenic
1060944523 9:127562040-127562062 CCCCCCTCCTCCTTCCCCGCGGG - Intronic
1061022794 9:128027084-128027106 CCCTGCCCTTCCCTCCTCCCAGG + Intergenic
1061040701 9:128139213-128139235 GCCAGCCCTTCTTTCCCCCCGGG - Intergenic
1061208087 9:129175946-129175968 CCCGGCCCCTCCCTCCCCCGGGG + Exonic
1061236999 9:129349129-129349151 CCAGGCTCTTTCTTCCCTGCAGG - Intergenic
1061275734 9:129568732-129568754 CCCAGCCCGGCCTCCCCCGCGGG - Intergenic
1061277319 9:129576923-129576945 CCCTGCCCTTCCTGCCGCCCTGG + Intergenic
1061449472 9:130660618-130660640 CCCCGCCCTGCCCGCCCCGCCGG - Intergenic
1061450903 9:130666536-130666558 CCCGGCCCTTCCTTCCCCGCCGG - Intronic
1061582611 9:131546680-131546702 CCCGGACCCCCCTTCCCAGCTGG + Intergenic
1061724607 9:132575262-132575284 CCCGGCCCTTCCCTCTCTCCTGG + Intergenic
1061793848 9:133072081-133072103 CCCGGCCCAACCATCTCCGCAGG + Intronic
1061894983 9:133642495-133642517 CCCAGCCCTGCCTTCCTCCCGGG + Intronic
1062332420 9:136050647-136050669 CCCACCCCCTCCTCCCCCGCCGG + Intronic
1062431489 9:136528608-136528630 CAGGGCCGTTCCTTCCCCTCTGG - Intronic
1062460352 9:136660257-136660279 CCCGCCCCTCCTGTCCCCGCTGG + Intronic
1062613790 9:137387073-137387095 CCCGGCCCTTGCTTCCTGCCTGG + Intronic
1062624847 9:137438126-137438148 CCCGGCCCGGCCTCCCCTGCCGG + Intronic
1185457724 X:319131-319153 CCCGGTCCCGCCTCCCCCGCCGG - Intergenic
1185736537 X:2500606-2500628 CCCGCGCTTTCCGTCCCCGCCGG - Intronic
1186054262 X:5632227-5632249 CACGGCCCTTCCTTCCCAGTAGG - Intergenic
1187431499 X:19229170-19229192 CCCGGCCCTACCCTCACCGGCGG + Intergenic
1188212783 X:27444011-27444033 CCCTCCCCTTCCCTCCCCCCGGG - Intergenic
1189002789 X:36963739-36963761 CCCGGCCCCACCTCCGCCGCGGG + Intergenic
1189373738 X:40450057-40450079 TCCGGACCTTTCTTCCCCTCTGG + Intergenic
1189746833 X:44177176-44177198 CCTGGCCCTGCCTTCCACCCTGG - Intronic
1189915491 X:45851612-45851634 CCCTGCCCGCCCATCCCCGCCGG + Intergenic
1198268011 X:135028581-135028603 CCCCTCCCATCCTTCCCCCCGGG - Intergenic
1200081184 X:153577246-153577268 GCCAGCCCTTCCTTCCAGGCTGG - Intronic