ID: 1061450908

View in Genome Browser
Species Human (GRCh38)
Location 9:130666554-130666576
Sequence AGCCCGAGGCAGCCGAGGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 361
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 327}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061450908_1061450912 -6 Left 1061450908 9:130666554-130666576 CCGGGCCTCGGCTGCCTCGGGCT 0: 1
1: 0
2: 1
3: 32
4: 327
Right 1061450912 9:130666571-130666593 CGGGCTCTGACCGGTTTTCCTGG 0: 1
1: 0
2: 2
3: 4
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061450908 Original CRISPR AGCCCGAGGCAGCCGAGGCC CGG (reversed) Intronic
900317027 1:2062018-2062040 CGCCAGAGGCAGACGAGGGCAGG + Intronic
900421234 1:2556849-2556871 AGCCCCAGGCAGCAGGGGACGGG - Intronic
900627533 1:3615804-3615826 GGCCTGAAGCAGTCGAGGCCAGG - Intergenic
901662849 1:10809552-10809574 AGTCAGTGGCAGCCCAGGCCAGG - Intergenic
901930289 1:12592753-12592775 AGCCCCAGGCTCCCGAGGCTGGG + Intronic
902225078 1:14991669-14991691 AGCCCAAGGCTGGAGAGGCCAGG + Intronic
902435106 1:16393401-16393423 AGGCCGAGTACGCCGAGGCCCGG + Exonic
902870884 1:19312766-19312788 TGGCCGAGGACGCCGAGGCCTGG + Exonic
903071542 1:20729253-20729275 AGACCGAGGGAGCTGAGTCCTGG - Intronic
903124089 1:21236031-21236053 AGCCCAAGGCAGGCAGGGCCTGG - Intronic
903293052 1:22326697-22326719 ACCCACAGGCAGCTGAGGCCTGG + Intergenic
903862095 1:26370720-26370742 AGCCACAGGCAGCTGTGGCCTGG - Intronic
904054780 1:27662877-27662899 AGCTGGAGGCTGCCGAGGCAGGG - Intergenic
906282967 1:44566512-44566534 AGCCCGAGGCAGCCTTGACGGGG - Intronic
906567668 1:46812438-46812460 AGCCCCAGGCTGCCAGGGCCTGG + Intronic
906919401 1:50048123-50048145 GGCCCGAGGCTGCGGAGGCTGGG - Intronic
908817822 1:68051881-68051903 TGCCCCAGCCAGCTGAGGCCAGG + Intergenic
912519460 1:110235235-110235257 AGCCTGGGCCAGCCGAGGCAAGG + Intronic
912792743 1:112668711-112668733 AGGCCGAGGCAGGTGAGGTCAGG - Intronic
914902185 1:151716696-151716718 AGCCGGCAGCAGCCCAGGCCCGG - Exonic
916725458 1:167518501-167518523 AGGCTGAGGCAGCGGTGGCCGGG + Exonic
917291681 1:173477518-173477540 AGTCCGGCGCAACCGAGGCCAGG - Intronic
919463243 1:197902939-197902961 AGCCCGGGGCGGCCGCGGCGGGG - Intronic
919735601 1:200948291-200948313 AGCCCAAGGCAGCCGAGAACAGG - Intergenic
919878014 1:201884725-201884747 AGTCCCAGGCAGCCAAGGCCTGG - Intergenic
920331362 1:205211030-205211052 AGCCAGGGGCAACCGAGGGCCGG - Intronic
920654832 1:207867664-207867686 GGGCCGAGGCAGCCAGGGCCTGG - Intergenic
921189772 1:212699396-212699418 AGCCCGAGGGCGCCGACGCCTGG - Intronic
922744920 1:228038266-228038288 AGCCCGCCGGAGCCGACGCCCGG - Intronic
922763434 1:228146028-228146050 ACCACGAGGAACCCGAGGCCCGG + Exonic
924600325 1:245483009-245483031 AGGCCCAGGCAGCAGATGCCAGG + Intronic
1063173475 10:3530520-3530542 AGCCGGAGAGAGCAGAGGCCAGG + Intergenic
1063451775 10:6154830-6154852 TGGCCGAGGCGGTCGAGGCCTGG + Intronic
1064179175 10:13100148-13100170 AGCCCTAGGCACCCCAGTCCCGG + Intronic
1066299529 10:34084618-34084640 AGCCTGAAGCATCTGAGGCCAGG + Intergenic
1066758076 10:38730362-38730384 AGCTCGAGGCGGACGCGGCCCGG + Intergenic
1069737204 10:70664658-70664680 AACCCCAGGCAGCCAATGCCAGG + Intergenic
1069782884 10:70967893-70967915 AGCCCCAGGAAGCCGTGGCCAGG - Intergenic
1070324319 10:75378077-75378099 AGCACCAGGCAGGGGAGGCCGGG + Intergenic
1074585975 10:114768156-114768178 AGCCGGAGGGGGCCGGGGCCGGG - Intergenic
1075274422 10:121080523-121080545 AGCCCTGGGCCACCGAGGCCTGG - Intergenic
1076625299 10:131818138-131818160 GGCCAGAGGCACCCGAGGCAGGG - Intergenic
1076685936 10:132198526-132198548 AGCCCCAGGCAGCAGTGGTCTGG - Intronic
1076690853 10:132223280-132223302 AGGAGGTGGCAGCCGAGGCCCGG + Intronic
1076741683 10:132488784-132488806 AGTGCGAGGCAGCCCAGTCCAGG + Intergenic
1076745444 10:132510467-132510489 AGCACAAGGCAGGCCAGGCCTGG + Intergenic
1076997269 11:304218-304240 GGCCCGAGTCCGCCGAGGCCAGG - Intergenic
1077251567 11:1563116-1563138 AGCCCCTGGTAGCAGAGGCCAGG + Intronic
1077281540 11:1748271-1748293 CGTCCGTGGCCGCCGAGGCCCGG - Intronic
1077530877 11:3094200-3094222 AGCCTGGGGGAGACGAGGCCAGG - Intronic
1077917621 11:6621690-6621712 AGTCCGAGGCTGCCCAGGGCAGG + Exonic
1078156873 11:8807144-8807166 CGGCCGAGGCAGCCAAGCCCGGG - Intronic
1078358560 11:10650740-10650762 AGCCTCAGGCAGCCCAGCCCAGG - Intronic
1078425142 11:11243691-11243713 AGCCCGAGGGTACCCAGGCCAGG - Intergenic
1078891348 11:15561126-15561148 GCCCGGAGGCAGCCAAGGCCTGG - Intergenic
1079038130 11:17038398-17038420 AGGCCGAGGCGGGCGAGGTCAGG + Intergenic
1080639862 11:34152358-34152380 GGGCGGAGGCTGCCGAGGCCAGG - Exonic
1081649338 11:44813124-44813146 AGCGCCAGGCCGCTGAGGCCAGG - Intronic
1081710806 11:45214155-45214177 AGCCCGAGCAAGCAGAGGCAAGG - Intronic
1083161990 11:60860027-60860049 AGGCAGAGGCAGCCCTGGCCTGG + Intergenic
1083222905 11:61265061-61265083 AGCCCATGAGAGCCGAGGCCTGG + Intronic
1083575927 11:63791264-63791286 AGGCCGAGGCAGGTGAGGTCAGG + Intergenic
1084000796 11:66294464-66294486 GGCCCGAGGCCGCCTTGGCCCGG + Exonic
1084146204 11:67266603-67266625 AGGCCGAGCGAGCCGCGGCCGGG + Exonic
1084174793 11:67417561-67417583 CCCCCGAGGGGGCCGAGGCCCGG + Exonic
1084432131 11:69116956-69116978 TGCCCTGGGCAGCCCAGGCCTGG - Intergenic
1084562854 11:69914026-69914048 AGCCTGGGGGAGCCCAGGCCTGG - Intergenic
1084579684 11:70015469-70015491 ACCCGGAGGCAGCCCAGCCCTGG + Intergenic
1084662012 11:70551510-70551532 ACACCGGGGCTGCCGAGGCCGGG - Intronic
1086336425 11:85805582-85805604 AGCCAGAGGCAGGAGAGTCCAGG + Intronic
1088135518 11:106552120-106552142 AGCCAGAGGGAGCCAAGGGCAGG + Intergenic
1088822477 11:113468483-113468505 AGACAGAGGCAGGTGAGGCCTGG - Intronic
1090003604 11:122981794-122981816 CGCCCGGGGTAGCCCAGGCCCGG - Intergenic
1093583260 12:20807586-20807608 AGGGGGAGGCAGCTGAGGCCTGG + Intergenic
1093958594 12:25250292-25250314 GGACCGAGGCAGCCGAGTGCTGG + Intronic
1095174045 12:39069734-39069756 AGCCAGAGGCAGCCCAGACTAGG + Intergenic
1097180585 12:57169416-57169438 AGCCAGAGGTAGCCTAGGCATGG + Intronic
1098241069 12:68467811-68467833 AGCCTGAGGCAGCCCAAGTCAGG - Intergenic
1101490203 12:105203135-105203157 AGCCTGAGGCTGCAGGGGCCGGG + Intronic
1102567826 12:113808662-113808684 AGAGCGAGGCAGCCAAGGCCAGG - Intergenic
1102584259 12:113912147-113912169 AGCCCGAGGCAGCAGTGCCTGGG - Intronic
1103251894 12:119507093-119507115 TGCCTGTGGCAGCCGAGGCTGGG + Intronic
1103282653 12:119772727-119772749 AGGCCGAGGCCGCTGGGGCCTGG + Intronic
1103563431 12:121804162-121804184 CCCCCGAGGGAGCCGAGGCCGGG - Exonic
1103813418 12:123633903-123633925 GGACCGAGACAGCCGAGCCCCGG - Intronic
1104105102 12:125651729-125651751 AGCCCAGGCCAGCCGAGACCTGG - Intronic
1104382073 12:128315877-128315899 AGCCGGAGCCATCCGAAGCCAGG + Intronic
1105012711 12:132766400-132766422 CGCCCAAGGCAGCTGAGGGCTGG - Intergenic
1109780752 13:67107258-67107280 AGCCCGTGTCAGCCGAAGCATGG + Intronic
1110379054 13:74828581-74828603 AGCCCAAGCCAGCAGTGGCCTGG + Intergenic
1110630300 13:77698571-77698593 TGCCCGAAGCCCCCGAGGCCAGG - Intronic
1112506862 13:99980903-99980925 AGCCCACCGCAGCCGAGACCTGG + Intergenic
1113593114 13:111514364-111514386 AGCCAGCTGCAGCCGAGACCCGG - Intergenic
1113625491 13:111793193-111793215 AGCCCCTGGCAGCAGAGGCAGGG - Intergenic
1113695903 13:112345215-112345237 AGCCAGAGGCTGCGGAGGGCAGG - Intergenic
1113745476 13:112741508-112741530 AGCCTGGAGCAGCCCAGGCCAGG - Intronic
1113852132 13:113423853-113423875 AGCCTGAGGCAGCAGTGGCAAGG + Intronic
1113946718 13:114048608-114048630 AGCGCCCGGCAGCCGAGTCCAGG + Intronic
1117072498 14:52069268-52069290 AGCTCCAGGCAGCCCTGGCCAGG - Intergenic
1118736184 14:68703285-68703307 ACCATGAGTCAGCCGAGGCCTGG - Intronic
1120973418 14:90228660-90228682 ATCCCGAGGTGGCAGAGGCCAGG + Intergenic
1121020259 14:90575596-90575618 AGCCCCATGCAGCCAAGGGCAGG - Intronic
1121110589 14:91310081-91310103 ACACGGAGGCAGCCGTGGCCCGG - Intronic
1121311493 14:92937761-92937783 GGCCTGAGGCAGCAGAGGCTGGG + Exonic
1122009755 14:98736440-98736462 AGTCCATGGCAGCCCAGGCCAGG + Intergenic
1122364552 14:101186847-101186869 AGCCCCAGACAGCCGTGGCACGG - Intergenic
1122447729 14:101781674-101781696 GGGGCGAGGCAGCGGAGGCCGGG - Intronic
1122929751 14:104927824-104927846 AGCCCCTGGAAGCAGAGGCCAGG + Exonic
1123083594 14:105707315-105707337 TGCGCGTGGCAGCCGAGGACTGG - Intergenic
1123441479 15:20295095-20295117 AGCTCGAGGCGGACGCGGCCCGG + Intergenic
1125607410 15:40948901-40948923 AGGCTGAGGCAGCCGAGCTCCGG - Intergenic
1127325138 15:57887659-57887681 AGCCCAAGCCAGCCTAGACCAGG + Intergenic
1127433395 15:58933636-58933658 CGCCGGCGGCCGCCGAGGCCTGG - Exonic
1128153374 15:65377275-65377297 AGCCCGAGGCAGCCAAGACAGGG - Intronic
1128246118 15:66134009-66134031 AGCCCGAGGCTTCCCAGGCAAGG - Intronic
1128265697 15:66265093-66265115 AGGCCCAGGCAGCCCAGGCCTGG - Intergenic
1128455606 15:67829777-67829799 AGGTCGAGGCAGCCGAACCCCGG + Intronic
1128765956 15:70251214-70251236 AAGCTGAGGGAGCCGAGGCCAGG - Intergenic
1129031704 15:72623386-72623408 AGCACGAGGAAGCAGAGTCCAGG + Intergenic
1129220234 15:74128222-74128244 AGGCAGAGTCCGCCGAGGCCTGG - Exonic
1130343128 15:83016117-83016139 AGGCCAAGGCAGCTGAGGTCAGG + Intergenic
1132163679 15:99565448-99565470 AGCCCCCGGGAGCCCAGGCCGGG - Intronic
1132353176 15:101153176-101153198 AGCCCCTGGCAGCCGGGTCCCGG + Intergenic
1132356618 15:101175535-101175557 AGCCAGACGCGGCCCAGGCCCGG + Intergenic
1132683778 16:1153953-1153975 AGACCGTGGCCGCCAAGGCCGGG - Exonic
1132968457 16:2673133-2673155 CGCCCGACGCAACCCAGGCCCGG + Intergenic
1133203322 16:4217951-4217973 AGCCAGAGGCAGCTCAGGCGAGG + Intronic
1133221409 16:4320632-4320654 AGCCCCAGGCAGACGATGCAGGG - Intronic
1134690839 16:16190238-16190260 AGTCCTGGGCATCCGAGGCCAGG - Exonic
1135240817 16:20806171-20806193 AGCCCGAGGCGGACGAACCCTGG - Intronic
1135819209 16:25665959-25665981 AACCAGAGGCAGCTGAGTCCTGG - Intergenic
1135992101 16:27224476-27224498 AGCCTGAGGCAGCAGTGGCAGGG + Intergenic
1136478261 16:30526465-30526487 GGCTCGGGGCAACCGAGGCCGGG - Exonic
1136724765 16:32348824-32348846 AGCTCGAGGCGGACGCGGCCCGG - Intergenic
1136843091 16:33554864-33554886 AGCTCGAGGCGGACGCGGCCCGG - Intergenic
1137266235 16:46871255-46871277 AGCCCCAGACAGATGAGGCCAGG - Intergenic
1137615981 16:49847326-49847348 AGGCCGAGGGAGCTGAGTCCTGG + Intronic
1139325771 16:66151600-66151622 TGGCCCAGGCAGCCAAGGCCGGG + Intergenic
1140414702 16:74766069-74766091 AGGCCGAGGCAGGTGAGGTCAGG + Intronic
1141111653 16:81275345-81275367 AGACCGGGGAAGCCCAGGCCCGG + Intronic
1141647178 16:85373784-85373806 TCCCCGAGGCAGCCCAGGGCAGG + Intergenic
1142025582 16:87811299-87811321 AGCAAGAGGCAGCAGAGACCAGG - Intergenic
1142025699 16:87812337-87812359 AGCAAGAGGCAGCAGAGACCAGG + Intergenic
1142247240 16:88975764-88975786 AGCCTCAGGCAGCCGCCGCCAGG + Intronic
1142309668 16:89305141-89305163 AGCCCGGAGCAGCCCAGGCAGGG - Intronic
1142379211 16:89722042-89722064 AGCCCGCGGCCGGGGAGGCCGGG - Intronic
1142393193 16:89816187-89816209 GGCCCGAGGCAGGGGAGCCCGGG + Intronic
1203001665 16_KI270728v1_random:168931-168953 AGCTCGAGGCGGACGCGGCCCGG + Intergenic
1203133269 16_KI270728v1_random:1705337-1705359 AGCTCGAGGCGGACGCGGCCCGG + Intergenic
1203153256 16_KI270728v1_random:1855162-1855184 AGCTCGAGGCGGACGCGGCCCGG - Intergenic
1142483478 17:232469-232491 TGCCAGGGTCAGCCGAGGCCTGG - Intronic
1143514669 17:7413810-7413832 AGCCCCAGGGACCCTAGGCCTGG + Intronic
1143618214 17:8065961-8065983 AGGCCGAGGCAGGCCAGGCAGGG + Intergenic
1144165995 17:12611067-12611089 AGCCCCAGGCTGGTGAGGCCTGG + Intergenic
1144205003 17:12973877-12973899 AGCCCTGGGCAGCCCAGTCCTGG - Intronic
1144760868 17:17706556-17706578 AGCCAGAGGGAGCCGGGGACTGG + Intronic
1146901378 17:36591802-36591824 AGTCGGAGGCCGCCGCGGCCCGG - Exonic
1150093677 17:62353262-62353284 AGGCTGAGGCAGCTGAGCCCAGG + Intergenic
1151912930 17:77096002-77096024 AGCAGGAGACAGCCAAGGCCAGG - Intronic
1152569743 17:81116439-81116461 TGCCCGAGGCAGGAGGGGCCTGG - Exonic
1152588191 17:81198417-81198439 AGCCCCAGGAAGGTGAGGCCAGG + Intronic
1152650113 17:81488676-81488698 TGCCCGGGTCAGCTGAGGCCCGG - Intergenic
1154000666 18:10479588-10479610 AGCCTGAGGCAGCTCTGGCCAGG + Intronic
1157405853 18:47422308-47422330 AGCCTGAGGCAGTAGAGGACTGG - Intergenic
1158153169 18:54394738-54394760 AGGCCGAGGCAGGTGAGGTCAGG - Intergenic
1159045613 18:63366801-63366823 AGCCCGAGGCTGCGGAGGGCGGG + Intronic
1159472929 18:68880140-68880162 CGCCCAAGGCAGCTAAGGCCCGG + Intronic
1159775787 18:72601736-72601758 AGGCCCAGGCAGGAGAGGCCTGG - Intronic
1160240568 18:77119661-77119683 AGCCCCAGGGAGCCGAGAGCAGG + Intronic
1160500627 18:79399846-79399868 AGCCCGAGGCCGCCAACGCTAGG - Intronic
1160592123 18:79950938-79950960 AGCCCGTGACAGCCTCGGCCAGG - Exonic
1160707279 19:535517-535539 GGCCCGTGGCAGCCCAGGTCAGG - Intronic
1160761542 19:787883-787905 AGCCCGGGGCAGCTGCGGCCTGG + Intergenic
1160765217 19:804579-804601 CCGCCGAGGCAGCCAAGGCCAGG - Exonic
1160788831 19:913409-913431 AAACCGAGGCAGGCGGGGCCGGG + Intergenic
1160788847 19:913458-913480 AAACCGAGGCAGGCGGGGCCGGG + Intergenic
1161219779 19:3113229-3113251 CGCCCGGGCCAGCCGAGGCCTGG + Intronic
1161588300 19:5117368-5117390 AGCTGGGGGCAGCTGAGGCCAGG + Intronic
1162299394 19:9835590-9835612 AGCCTGAGGAAGCTGAGGCAGGG + Intronic
1162320103 19:9966565-9966587 AGCTCGTGGCACACGAGGCCCGG + Exonic
1162344386 19:10111068-10111090 AGTCCCAGGGAGCCCAGGCCAGG + Exonic
1163398117 19:17075853-17075875 GGCGCGCGGCGGCCGAGGCCAGG + Exonic
1163664752 19:18598089-18598111 CGCCCCAGGAAGCCGAGGCCTGG - Intronic
1164028880 19:21381953-21381975 AGGCTGAGGCAGCCGAGCTCTGG - Intergenic
1164483238 19:28632584-28632606 CGCAGGAAGCAGCCGAGGCCGGG - Intergenic
1166345380 19:42162191-42162213 AGCCCCAGGTAGCAGAGGGCAGG - Intronic
1166747206 19:45147002-45147024 AGCCCCAGACAGCGCAGGCCGGG + Exonic
1166777847 19:45323353-45323375 AGCTGGAGGAAGCAGAGGCCGGG + Intergenic
1166864740 19:45829043-45829065 AGCCCGAGGCACCTGCGGCCAGG + Exonic
1166869773 19:45864262-45864284 AGCCCGGGGCGGGCGAGGGCGGG + Exonic
1167369594 19:49072649-49072671 CGGCCGAGGCGGCCGAGGCGGGG - Exonic
1167604940 19:50476616-50476638 AGCCCGGGGCAGCGGCTGCCGGG + Exonic
1168332618 19:55579034-55579056 AGTCGGAGGAGGCCGAGGCCGGG - Exonic
1168639251 19:58019903-58019925 AGGCCGAGGCATCCTGGGCCAGG - Intergenic
924980010 2:210877-210899 AGCAGGAGGGAGCGGAGGCCTGG - Intergenic
925404512 2:3597198-3597220 ACCCCGGAGCAGCCCAGGCCGGG - Intronic
926561189 2:14419215-14419237 AGGCCGAGGCACCTGAGGTCAGG + Intergenic
927206342 2:20613417-20613439 AGCCATAGGCAGCTGAGTCCTGG - Intronic
927460676 2:23295744-23295766 AGTCCCAGGCAGCCTGGGCCAGG - Intergenic
928823592 2:35392018-35392040 AGGCCGAGGCAGCAGGGGGCTGG + Intergenic
929151260 2:38751075-38751097 AGCCGGAGGCAGCGGAGGCGGGG - Intronic
932316915 2:70790643-70790665 GGGCCGAGGCCGCTGAGGCCGGG + Exonic
934321393 2:91974802-91974824 AGCTCGAGGCCGACGCGGCCAGG + Intergenic
936234653 2:110732645-110732667 AGCGCGATGCAGCCGGCGCCGGG + Exonic
937323445 2:120974537-120974559 AGCTCGAGGCAGCCTAGGTCTGG - Intronic
938067842 2:128291674-128291696 AGCCCCAGGCTGGAGAGGCCAGG - Intronic
939613023 2:144332552-144332574 AGGCCGAGGCGGCCGCGGGCCGG - Intronic
941917857 2:170823786-170823808 AGCCCTGGGCAGCCGAGGACAGG + Intronic
942227446 2:173829730-173829752 AACCCGAGGCAGCCTAGCTCTGG - Intergenic
942246432 2:174012961-174012983 AGCCGGAGGCACCCGGGGCCAGG - Intergenic
942302108 2:174572158-174572180 GGCCCCAGGCAGCCCAGCCCCGG - Exonic
944723754 2:202449079-202449101 AGGCCAAGGCAGGCGAGGTCGGG + Intronic
946394168 2:219434986-219435008 AGCCCGGGGCACGCGAGGCGAGG + Exonic
948207029 2:236167862-236167884 AGCCCGCCGCAGCCCAGCCCCGG - Exonic
948536872 2:238653085-238653107 AGCCCGTGGCAGCGTGGGCCGGG - Intergenic
948536883 2:238653136-238653158 AGCCCGTGGCAGCGTGGGCCGGG - Intergenic
948536894 2:238653187-238653209 AGCCCGTGGCAGCGTGGGCCGGG - Intergenic
948604194 2:239124306-239124328 TGCCCGCAGCAGCCCAGGCCTGG + Intronic
948994662 2:241572330-241572352 AGCCAGTGGGAGCGGAGGCCAGG - Exonic
949035960 2:241815842-241815864 AGCCCTTAGCAGCCGAGCCCAGG - Intronic
1168965469 20:1895463-1895485 GGCCCGAGGCGGCCGGGGGCCGG - Exonic
1169305935 20:4490411-4490433 TGCCAGAGGCAGCTGGGGCCGGG - Intergenic
1170064203 20:12292868-12292890 AGCCAGAGTCAGGCGAGACCAGG + Intergenic
1172320960 20:33994532-33994554 AGCCGGAAGCAGCCGCGGCCGGG - Intronic
1172834352 20:37863535-37863557 AGGCAGAGGGAGCAGAGGCCTGG + Intronic
1172869999 20:38129963-38129985 AGCCCCAGTCAGCCAAGGTCAGG + Exonic
1175579457 20:60087634-60087656 CCCGCGAGGAAGCCGAGGCCCGG + Intergenic
1175579496 20:60087774-60087796 CCCGCGAGGAAGCCGAGGCCCGG + Intergenic
1176068830 20:63215764-63215786 AGCCCGGGGTCGCGGAGGCCGGG - Intronic
1176078838 20:63261540-63261562 AGGCCGAGGCAGGCGAGGCCAGG + Intronic
1176189252 20:63800133-63800155 TGCCCCAGGGTGCCGAGGCCGGG - Intronic
1178618524 21:34154322-34154344 AGCGCGAGGCAGGCGAGTCCCGG - Intergenic
1178703932 21:34857525-34857547 AGCCTGAAGAAGCCGAAGCCAGG - Intronic
1178707326 21:34886790-34886812 AGGCGGAGGCCGGCGAGGCCGGG - Intronic
1179098445 21:38336062-38336084 ACCCCAAGGCTGCTGAGGCCTGG + Intergenic
1179822242 21:43943661-43943683 AGGCCGTGGCGGCTGAGGCCTGG - Intronic
1179891814 21:44339084-44339106 ACCCCGGGGCGGCCGCGGCCAGG + Intronic
1180686399 22:17670599-17670621 AGGCCGAAGCAGCCGAGGTCGGG - Intronic
1181160564 22:20957470-20957492 CGCCCGCGGCAGCCGAGGTAGGG + Intergenic
1181235926 22:21447570-21447592 CCCCTGAGGCAGCCGAGGCAGGG - Exonic
1182211327 22:28679735-28679757 AGCTCGAGGCGGACGCGGCCCGG - Exonic
1182470000 22:30542587-30542609 GGCCCGAGGCGGCCGGGGACCGG - Intronic
1183309132 22:37099887-37099909 AGCCCGAGTCCTCCCAGGCCTGG - Intronic
1183745083 22:39687349-39687371 AGCTGGAGCCAGCCGAGACCAGG - Exonic
1184519109 22:44981988-44982010 AACGGGAGGCAGCCGAGGGCTGG - Intronic
1184924005 22:47624848-47624870 AGTGCGGGCCAGCCGAGGCCGGG - Intergenic
1185065383 22:48629345-48629367 AGCCCCGGGGTGCCGAGGCCAGG - Intronic
1185109679 22:48894036-48894058 AGCCCGGGGCAGGCCAGGGCTGG + Intergenic
1185289125 22:50015235-50015257 AGCCCGCGGCACACGAGGCAGGG + Exonic
1185333517 22:50261805-50261827 AACCCGAGGCGGCCGCCGCCGGG + Exonic
1185383813 22:50522531-50522553 AGCCCGAGGGAGCAGACCCCAGG + Exonic
950024294 3:9810037-9810059 AGCGCGAGGGAGCTGGGGCCCGG + Exonic
952410797 3:33048204-33048226 AGGCCGAGGGAGCCCAGGCTGGG + Intronic
954333557 3:49903529-49903551 AGCCCGCGGCGGGCGAGGACTGG - Exonic
954497967 3:50983112-50983134 GGGCCGAGGCAGCAGAGGTCTGG - Intronic
959592066 3:108091595-108091617 AGCCCGAGGCCGCCACGCCCAGG + Intergenic
961013585 3:123450428-123450450 AGGCCGATGCAGCCGGGGCGGGG + Intergenic
963072049 3:141312452-141312474 AGCCTTAGGCAGCAGATGCCGGG + Intergenic
967043595 3:185716637-185716659 AGCCCAAGACAGCTGAGGGCTGG - Exonic
968170140 3:196503551-196503573 AGCTCGGGGCAGCCGGGCCCCGG + Exonic
968611312 4:1558418-1558440 AGCCCAAGGCAGGCCAGGCACGG + Intergenic
968728754 4:2260111-2260133 GGCCTGAGGCAGCCCAGGGCTGG - Intronic
969413567 4:7044441-7044463 AGCCCCAGGCCTCCCAGGCCAGG - Intronic
969500456 4:7549455-7549477 AGCCAGAGGCCCCTGAGGCCAGG + Intronic
969526711 4:7707569-7707591 AGGGCCAGGCAGCCCAGGCCTGG - Intronic
969695925 4:8734838-8734860 AGCTCCAGGCAGCCCTGGCCTGG - Intergenic
970010817 4:11457056-11457078 ATCCCGAGGCACCCAAGGCATGG - Intergenic
971564179 4:28117286-28117308 ACCGGGAGGCAGCTGAGGCCTGG + Intergenic
972899819 4:43669313-43669335 AGCCCTGTGCAGCAGAGGCCTGG - Intergenic
978361054 4:107931618-107931640 AACCCGAGGCCGCCGGCGCCCGG + Exonic
979674569 4:123397879-123397901 AGGCAGAGGCTGCCGCGGCCGGG - Intronic
979949500 4:126874600-126874622 TGCGGGAGGCAGCTGAGGCCCGG + Intergenic
981093466 4:140756305-140756327 AGCCCGCGGCCGCAGACGCCCGG + Intergenic
983843162 4:172482017-172482039 ACCGGGAGGCAGCTGAGGCCAGG + Intronic
985145210 4:186889240-186889262 AGCCACAGGCAGCGGAGGGCAGG - Intergenic
989178945 5:38556911-38556933 AGAGCGAGGCGGCCGAGCCCAGG + Intronic
989622386 5:43397244-43397266 AGCCCGCGGTAGGCTAGGCCTGG - Intronic
994916151 5:105982612-105982634 GGCCCGAGGCAGCAGGGGCCTGG - Intergenic
997505239 5:134411857-134411879 TGCCCGCCGCAGCCGAGGACCGG + Exonic
998546028 5:143028714-143028736 AGCCAGAGGTAGCTGAGGCAGGG + Intronic
1000342983 5:160291819-160291841 AGCCCCAGGCAGCCAAGTGCTGG + Intronic
1001470282 5:172006935-172006957 AGCCCAAGGCTGCCCAGACCGGG + Intergenic
1001600681 5:172926345-172926367 AGCAAGAGGCAGCAGGGGCCTGG - Intronic
1002047978 5:176552743-176552765 AGCAGGAGGCAGGCGAGGCAGGG + Intronic
1002570499 5:180137025-180137047 AGCCCGAGGGAGGCCAGCCCCGG + Intronic
1002633101 5:180594002-180594024 AGACCGATGCTGCCGAGGCCAGG + Intergenic
1002681613 5:180969615-180969637 CGCCAGAGGCGGCTGAGGCCTGG + Intergenic
1002819374 6:710835-710857 CGTCCGAGGCACCCCAGGCCGGG + Intergenic
1003188124 6:3850200-3850222 AGGCCGACGCGGCCGAGGCCAGG + Exonic
1003326240 6:5093440-5093462 GGCCAGAGTCAGCAGAGGCCAGG - Intergenic
1004562012 6:16760679-16760701 CGCCCCAGGGCGCCGAGGCCGGG + Intronic
1006116620 6:31779236-31779258 AGCCCGACACCGCCGATGCCAGG + Exonic
1006146309 6:31961797-31961819 GGCCGGAGCCAGCCGAGGCTGGG - Intronic
1006164188 6:32054819-32054841 AGCCCCAAGCAGCCGTGGCCTGG - Intronic
1008377856 6:50811482-50811504 AGGCTGAGGCAGGCGAGGTCTGG - Intergenic
1013276418 6:108589336-108589358 AGCCCAGGGCAGCCAAGGCCTGG - Intronic
1015965461 6:138692699-138692721 GGCCCGAGGCGGCGGGGGCCGGG - Intergenic
1018649107 6:165976578-165976600 AGCCAGAGTCAGGCGAGTCCAGG - Intronic
1018845258 6:167551518-167551540 AGGCCGGGGCATCCGGGGCCTGG - Intergenic
1019303523 7:321667-321689 AGCCGGTTGCTGCCGAGGCCTGG - Intergenic
1019313379 7:373608-373630 GGCTCCAGGCATCCGAGGCCCGG - Intergenic
1019320632 7:413985-414007 CGGCCGAGGAAGCCGAGGCGTGG - Intergenic
1020013556 7:4818725-4818747 AGCCTGAGGCAGCCAGGGTCAGG - Intronic
1020224823 7:6272216-6272238 AGCCCGCGGCAGCCCCGGCCTGG + Intronic
1021560592 7:21965343-21965365 AGCCCGAGGAAGCTGAAGGCAGG + Intergenic
1022391827 7:29950299-29950321 AGCCCGAGGCGGCAGGGGGCTGG - Intronic
1023863448 7:44228221-44228243 AGCCCAGGTCAGCAGAGGCCAGG + Intronic
1023863888 7:44229724-44229746 AGCCAGAGCCAGCAGAGGCCAGG + Intronic
1023863910 7:44229818-44229840 GGCCAGAGCCAGCAGAGGCCAGG + Intronic
1026086505 7:67267360-67267382 AGCCTGAAGCAGGCGAAGCCGGG - Intergenic
1029460000 7:100688889-100688911 GGAGGGAGGCAGCCGAGGCCAGG + Exonic
1030375185 7:108745793-108745815 AGCCCGAGGCAACTGGGGGCTGG - Intergenic
1031846831 7:126815195-126815217 AGCCTGAGGCAGATGAGACCAGG - Intronic
1032437139 7:131909543-131909565 CGCGGGAGGCAGCTGAGGCCCGG - Intergenic
1033521923 7:142169192-142169214 AGGCCGAGGCAGGTGAGGTCAGG + Intronic
1033794497 7:144831582-144831604 AGCCTGAGGCAGGAGAAGCCAGG + Intronic
1034934341 7:155188944-155188966 AGCCCCAGTCAGGCCAGGCCTGG - Intergenic
1034994555 7:155569917-155569939 ACCCAGACCCAGCCGAGGCCAGG + Intergenic
1035717004 8:1763173-1763195 AGCGCGACTCAGCCGCGGCCGGG + Intronic
1035766815 8:2113123-2113145 GGCACGAGGAAGCCGAGGCCGGG + Intronic
1036769381 8:11568083-11568105 AGCCCGAGGCAGGGGAGGTATGG - Intergenic
1037826274 8:22162474-22162496 AGCCCTAGGCAGCCGTGGGAGGG + Intronic
1040590685 8:48789716-48789738 AGCGCGAGGGAGCAGGGGCCCGG - Intergenic
1041041352 8:53849371-53849393 AGGCCGAGGCAGGTGAGGCCAGG - Intergenic
1042144994 8:65718833-65718855 TGCCAGAGGCAGCAGAGGCTGGG + Exonic
1042151445 8:65790219-65790241 AGCCCTGGGGAGCAGAGGCCAGG + Intronic
1042762528 8:72286466-72286488 AGGGAGAGGCAGCTGAGGCCAGG - Intergenic
1044591555 8:93917622-93917644 AGCCCAAGGCAGCGGGGCCCAGG - Intronic
1045051238 8:98327749-98327771 AGCCCCAGGCAGCTTAGGCAGGG + Intergenic
1048238415 8:132716032-132716054 AGCCCGAGGGAGCCGAGAACAGG + Intronic
1048852301 8:138656776-138656798 AGACCCAGGCAGCAGAGGCAAGG + Intronic
1049602042 8:143512506-143512528 AGCACGAGGCAGGAGGGGCCGGG + Intronic
1049748236 8:144272009-144272031 AGACCGAGGCAGGCCAGGTCTGG - Intronic
1053319155 9:37080050-37080072 ACCCCGAGTCACCCGCGGCCTGG + Intergenic
1056475213 9:86946482-86946504 AGAAAGAGGCGGCCGAGGCCGGG + Exonic
1056960356 9:91117572-91117594 AGCACAAGGGAGCCGGGGCCTGG + Intergenic
1060407009 9:123377791-123377813 AGCCCGAGGGAGCAGAGGAGGGG + Exonic
1060480008 9:124012273-124012295 AGCGCCAGGCAGCTGAGGCGGGG + Exonic
1060818898 9:126650524-126650546 AACCCGAGTCAGCAGCGGCCAGG + Intronic
1061244502 9:129394464-129394486 AGGCGGAGGCAGCCGGGCCCTGG + Intergenic
1061450908 9:130666554-130666576 AGCCCGAGGCAGCCGAGGCCCGG - Intronic
1061873749 9:133534034-133534056 AGCCCCTGGCAGGCCAGGCCTGG - Intronic
1061947013 9:133914139-133914161 AGCCCCAGGCAGCCCATGCTGGG - Intronic
1061985806 9:134129567-134129589 AGCCCGAGGCACTGAAGGCCGGG - Intergenic
1062279586 9:135745989-135746011 AGCCTGTGGCTGCAGAGGCCTGG - Intronic
1203771975 EBV:54101-54123 AGGCCGAGGCGGCCGAGGTCCGG - Intergenic
1203772814 EBV:58111-58133 AGGCCGGGGCCGCGGAGGCCGGG + Intergenic
1203772821 EBV:58126-58148 AGGCCGGGGCCGCGGAGGCCGGG + Intergenic
1203772828 EBV:58141-58163 AGGCCGGGGCCGCGGAGGCCGGG + Intergenic
1203772835 EBV:58156-58178 AGGCCGGGGCCGCGGAGGCCGGG + Intergenic
1203772842 EBV:58171-58193 AGGCCGGGGCCGCGGAGGCCGGG + Intergenic
1203772848 EBV:58186-58208 AGGCCGGGGCCGCAGAGGCCGGG + Intergenic
1203772854 EBV:58201-58223 AGGCCGGGGCCGCAGAGGCCGGG + Intergenic
1186611081 X:11139100-11139122 AGCCCGCGGCAGCGGCAGCCTGG - Exonic
1187806392 X:23126026-23126048 AGGCCGAGGCACCTGAGGTCAGG - Intergenic
1190215744 X:48478477-48478499 AGCCCCAGGCAGCTGGAGCCAGG + Exonic
1190881622 X:54495926-54495948 CTCCCGCCGCAGCCGAGGCCGGG + Exonic
1192185937 X:68946877-68946899 AGAAGGAGGCAGCAGAGGCCAGG - Intergenic
1195020305 X:100820182-100820204 AGCCAGATGCAGGCGAGTCCAGG - Intergenic
1199855122 X:151753488-151753510 AGCCCGAGGCAGCCTTAGCTTGG - Intergenic
1201188876 Y:11429927-11429949 AGCTCGAGGCGGACGTGGCCCGG + Intergenic