ID: 1061450912

View in Genome Browser
Species Human (GRCh38)
Location 9:130666571-130666593
Sequence CGGGCTCTGACCGGTTTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 65}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061450898_1061450912 20 Left 1061450898 9:130666528-130666550 CCGGGGTCCCGGCGGGGAAGGAA 0: 1
1: 0
2: 2
3: 19
4: 164
Right 1061450912 9:130666571-130666593 CGGGCTCTGACCGGTTTTCCTGG 0: 1
1: 0
2: 2
3: 4
4: 65
1061450903_1061450912 12 Left 1061450903 9:130666536-130666558 CCGGCGGGGAAGGAAGGGCCGGG 0: 1
1: 0
2: 3
3: 41
4: 328
Right 1061450912 9:130666571-130666593 CGGGCTCTGACCGGTTTTCCTGG 0: 1
1: 0
2: 2
3: 4
4: 65
1061450908_1061450912 -6 Left 1061450908 9:130666554-130666576 CCGGGCCTCGGCTGCCTCGGGCT 0: 1
1: 0
2: 1
3: 32
4: 327
Right 1061450912 9:130666571-130666593 CGGGCTCTGACCGGTTTTCCTGG 0: 1
1: 0
2: 2
3: 4
4: 65
1061450901_1061450912 13 Left 1061450901 9:130666535-130666557 CCCGGCGGGGAAGGAAGGGCCGG 0: 1
1: 0
2: 7
3: 43
4: 348
Right 1061450912 9:130666571-130666593 CGGGCTCTGACCGGTTTTCCTGG 0: 1
1: 0
2: 2
3: 4
4: 65
1061450895_1061450912 26 Left 1061450895 9:130666522-130666544 CCGAAGCCGGGGTCCCGGCGGGG 0: 1
1: 0
2: 1
3: 10
4: 142
Right 1061450912 9:130666571-130666593 CGGGCTCTGACCGGTTTTCCTGG 0: 1
1: 0
2: 2
3: 4
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061450912 Original CRISPR CGGGCTCTGACCGGTTTTCC TGG Intronic
900266835 1:1761633-1761655 CGGGCTGTGACCCGGTCTCCAGG + Intronic
901677925 1:10897680-10897702 AGGGCTCTGGCCTGTTTTTCCGG + Intergenic
902394780 1:16126664-16126686 CGTGGTCTGAGCGCTTTTCCAGG - Intronic
919697380 1:200591715-200591737 CTGGCCCTGACCGGTTATCAGGG - Intronic
920573273 1:207034323-207034345 CGGGCTATGACCTCTTTCCCTGG + Intronic
923035097 1:230280155-230280177 CGGGCTCTGGCCCCTTCTCCCGG - Exonic
923236740 1:232040857-232040879 CAGGCTGTGAGTGGTTTTCCTGG - Intronic
1077051603 11:569103-569125 CTGGCTCTGCCTGGTTTGCCTGG + Intergenic
1079249954 11:18780136-18780158 CAGGCTCTGTCAGGTGTTCCTGG + Intronic
1082759165 11:57109793-57109815 CTGGCTGTGCCAGGTTTTCCTGG + Intergenic
1088623878 11:111714500-111714522 CGTGCTCTAACCTGTCTTCCTGG - Intronic
1089127371 11:116186202-116186224 GTGGCTCCGACCGGTTGTCCTGG + Intergenic
1093652011 12:21657214-21657236 CCGGCTCTGACGGTCTTTCCAGG - Intronic
1094136260 12:27130089-27130111 TGGCCTCTGCCAGGTTTTCCTGG - Intergenic
1094185879 12:27642158-27642180 TGGCCTCTGCCAGGTTTTCCTGG - Intronic
1105931340 13:25055685-25055707 CTGGCACTGAGCTGTTTTCCTGG + Intergenic
1114538906 14:23440472-23440494 CGGACTCTGCCCTGTTTCCCAGG + Intergenic
1117769422 14:59118099-59118121 CTGGCTCTGGCAGGTTTTACAGG + Intergenic
1118050346 14:62019797-62019819 CGGGCACTGACCGCTTTTCCTGG + Intronic
1123019084 14:105389222-105389244 CGGGCTGTGACCAGACTTCCAGG + Intronic
1134289036 16:12888646-12888668 AGGCCTTTGACCTGTTTTCCAGG + Intergenic
1138405330 16:56788301-56788323 CGGGCTCTGGCCTGATTTTCTGG + Intronic
1141782606 16:86173839-86173861 AGGGCTCTGCCTGGTGTTCCTGG + Intergenic
1147865539 17:43549611-43549633 TGAGCTCTGACCTGTTTCCCAGG + Intronic
1148132541 17:45270743-45270765 CTGGCTCTGGCCTGTTTTACTGG - Intronic
1152009162 17:77700326-77700348 AGGGCACTGACAGGTCTTCCTGG + Intergenic
1160907162 19:1456780-1456802 AGGGCTCCGACCGGGTTTCCAGG + Intronic
1161420691 19:4174700-4174722 CGGGCTCTGAGCCGTTGTGCTGG + Exonic
1161995734 19:7710230-7710252 CGGGATCTGAGGGGGTTTCCTGG + Intergenic
1163020953 19:14480514-14480536 GGGGCTCTGCCCTGGTTTCCGGG + Intronic
1167949169 19:53012635-53012657 TTGGCTCTGGCCGGTTGTCCTGG - Intergenic
931704762 2:64938117-64938139 CGGGCTCTGACCAGAGTGCCAGG + Intergenic
938900745 2:135796824-135796846 CGGGCGCTCATCGGTTTTGCTGG + Intronic
942957408 2:181789281-181789303 AGAGCTCTTACAGGTTTTCCAGG - Intergenic
1173059791 20:39650581-39650603 CTGGCTCTGTCCGCTGTTCCTGG + Intergenic
1179951850 21:44712666-44712688 CGGCCTCAGACCAGTTTGCCAGG - Intergenic
1183261483 22:36798527-36798549 AGGGCTCTGACCTGGTTTCCGGG + Intergenic
953903090 3:46854232-46854254 CGGGCTCTGGCCAGCCTTCCTGG - Intergenic
961488928 3:127237625-127237647 CGGGCTGTGACCAGTTCTGCTGG - Intergenic
965543167 3:169890470-169890492 CGAGCTCTGAGGGCTTTTCCAGG + Intergenic
968941695 4:3642400-3642422 CGTGCTCTGCGCGGGTTTCCGGG + Intergenic
968941714 4:3642526-3642548 CGTGCTCTGCGCGGGTTTCCGGG + Intergenic
974560902 4:63516314-63516336 TGGGCTTTTACCGGTTTTCAAGG + Intergenic
986094859 5:4544512-4544534 CGGGCTCTACCCGGCATTCCAGG - Intergenic
991198342 5:63961167-63961189 CGGGGTCCGAGCGGTCTTCCGGG + Exonic
1007688652 6:43683146-43683168 TGGGCTTTGATCTGTTTTCCAGG - Intronic
1009918828 6:70030900-70030922 GGGGCTATGACAGCTTTTCCAGG - Intronic
1016073364 6:139767785-139767807 CGGGTTCTGTACGCTTTTCCAGG + Intergenic
1019821831 7:3249599-3249621 CTGGCTTTTACCGGTTGTCCTGG - Intergenic
1021313029 7:19116492-19116514 CGGGGTCAGACCGGCCTTCCGGG + Intronic
1028446830 7:90934112-90934134 TGGGCACTGACCGCCTTTCCAGG - Intronic
1031145871 7:117996011-117996033 CGAGATCTGATGGGTTTTCCAGG + Intergenic
1044569429 8:93700662-93700684 CGGGCTGTTACCGGTTTTCCAGG - Exonic
1047297590 8:123584925-123584947 TGGGCTCTGACCAGTTTGCCTGG + Intergenic
1047319960 8:123769435-123769457 CTGGCCCTGACCACTTTTCCAGG - Intronic
1055978509 9:81977162-81977184 AGGGCTCTGAGCGGTTTCCGAGG - Intergenic
1059433953 9:114265464-114265486 AGGGCTCTTACCGGTTCTCCTGG - Exonic
1061450912 9:130666571-130666593 CGGGCTCTGACCGGTTTTCCTGG + Intronic
1061627615 9:131850542-131850564 TGGGCACTGCCCCGTTTTCCTGG - Intergenic
1187722489 X:22165692-22165714 AGGGCTCTGACCAGATTCCCTGG - Intronic
1191643658 X:63454880-63454902 CGGGCTCTTACCACTTTTCTCGG - Intergenic
1192339350 X:70250019-70250041 AGGGCCCTGACAGGTCTTCCTGG + Intergenic
1197778053 X:130132996-130133018 CGGCCTCTGACCTATTTTGCCGG + Intronic
1200053335 X:153446015-153446037 CGGGCACTGACCGGCTTCCTGGG + Exonic
1200685907 Y:6258718-6258740 CGGGATCTGATGGGTTTTTCAGG - Intergenic
1200991439 Y:9349965-9349987 CGGGATCTGATGGGTTTTTCAGG - Intergenic
1200994095 Y:9370241-9370263 CGGGATCTGATGGGTTTTTCAGG - Intronic
1200996759 Y:9390576-9390598 CGGGATCTGATGGGTTTTTCAGG - Intergenic
1200999274 Y:9459128-9459150 CGGGATCTGATGGGTTTTTCAGG - Intergenic
1201001927 Y:9479439-9479461 CGGGATCTGATGGGTTTTTCAGG - Intronic
1201004594 Y:9499725-9499747 CGGGATCTGATGGGTTTTTCAGG - Intergenic
1201007247 Y:9520051-9520073 CGGGATCTGATGGGTTTTTCAGG - Intergenic