ID: 1061451914

View in Genome Browser
Species Human (GRCh38)
Location 9:130672001-130672023
Sequence GGAACCTCCACTGACCGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 94}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061451914_1061451920 1 Left 1061451914 9:130672001-130672023 CCCAGGCGGTCAGTGGAGGTTCC 0: 1
1: 0
2: 0
3: 6
4: 94
Right 1061451920 9:130672025-130672047 CAGCAGGGCGTGCATCTGGCTGG No data
1061451914_1061451923 23 Left 1061451914 9:130672001-130672023 CCCAGGCGGTCAGTGGAGGTTCC 0: 1
1: 0
2: 0
3: 6
4: 94
Right 1061451923 9:130672047-130672069 GATCCACTGATGTGGCCCCTGGG No data
1061451914_1061451924 24 Left 1061451914 9:130672001-130672023 CCCAGGCGGTCAGTGGAGGTTCC 0: 1
1: 0
2: 0
3: 6
4: 94
Right 1061451924 9:130672048-130672070 ATCCACTGATGTGGCCCCTGGGG No data
1061451914_1061451922 22 Left 1061451914 9:130672001-130672023 CCCAGGCGGTCAGTGGAGGTTCC 0: 1
1: 0
2: 0
3: 6
4: 94
Right 1061451922 9:130672046-130672068 GGATCCACTGATGTGGCCCCTGG No data
1061451914_1061451918 -3 Left 1061451914 9:130672001-130672023 CCCAGGCGGTCAGTGGAGGTTCC 0: 1
1: 0
2: 0
3: 6
4: 94
Right 1061451918 9:130672021-130672043 TCCGCAGCAGGGCGTGCATCTGG No data
1061451914_1061451921 15 Left 1061451914 9:130672001-130672023 CCCAGGCGGTCAGTGGAGGTTCC 0: 1
1: 0
2: 0
3: 6
4: 94
Right 1061451921 9:130672039-130672061 TCTGGCTGGATCCACTGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061451914 Original CRISPR GGAACCTCCACTGACCGCCT GGG (reversed) Intronic
900434099 1:2619239-2619261 GGCACCTCCACTGTTTGCCTGGG - Intronic
901208379 1:7510344-7510366 GGACCCTCCAATGCCAGCCTGGG - Intronic
902408630 1:16200048-16200070 GGGACCTCCCCTGACCACCTGGG + Intronic
903658767 1:24964435-24964457 CGTCCCTCCACTGACCGCCCTGG - Intronic
906548259 1:46638213-46638235 GGCACCTCCACAGAGCACCTAGG - Intronic
906655426 1:47544878-47544900 GAAGCCTCCTCTGACCCCCTTGG - Intergenic
906692706 1:47803141-47803163 GGAAGCTTCTCTGACCACCTGGG + Intronic
906892215 1:49729849-49729871 GGACCCTCCCCTGTCTGCCTAGG - Intronic
910717155 1:90244664-90244686 GGAACCTCCACTGAGCACATCGG + Intergenic
912058053 1:105631189-105631211 GGAAGCTCCACTTGCAGCCTTGG - Intergenic
917930962 1:179822523-179822545 CAAACCTCTACTGACAGCCTTGG + Intergenic
1063580490 10:7301930-7301952 AGAACCTCCACTGACCCCAAGGG + Intronic
1068188629 10:53619973-53619995 GGACCCTCCTCTGTCTGCCTAGG + Intergenic
1069705750 10:70458369-70458391 GGGGCCTCCGCTGAGCGCCTGGG - Intergenic
1070420638 10:76233125-76233147 GGGACCCCCACTGTCTGCCTAGG + Intronic
1075960395 10:126563168-126563190 GGCACGTCCACTCACTGCCTTGG + Intronic
1076793901 10:132789651-132789673 GGAGCCTCCTCTGCCCACCTAGG - Intergenic
1078922808 11:15846001-15846023 AAAACCTCCATTGACCACCTGGG - Intergenic
1081155113 11:39680564-39680586 GGAACCGCCCCTGTCTGCCTAGG + Intergenic
1083969781 11:66067846-66067868 GGCACCTCCACTCAGCGCCTTGG - Intronic
1090293563 11:125567342-125567364 GGACCCGCCACTAACTGCCTAGG + Intergenic
1091032701 11:132205170-132205192 GGAACCCCCACTGCCAGCCAAGG + Intronic
1091748043 12:3005030-3005052 GGAAGCTCCACAGACAGCCAGGG + Intronic
1096322904 12:50631202-50631224 GCAACCTCCATGGACCTCCTGGG + Intronic
1096480581 12:51938098-51938120 GGAACCTACAGAGGCCGCCTGGG - Intergenic
1098239928 12:68456626-68456648 GCTACCTCCTCTGACCCCCTAGG + Intergenic
1101032167 12:100671450-100671472 GTCACCTCCACTGATCTCCTGGG - Intergenic
1103933890 12:124465196-124465218 GGAACCTCCTCTCCCTGCCTTGG - Intronic
1106083907 13:26523505-26523527 GGAGCCACCACTCACAGCCTGGG - Intergenic
1110484278 13:76019834-76019856 GGACACTCCTCTGACCGCCTCGG + Intergenic
1113775797 13:112944030-112944052 GGACCCTCCCCTCACGGCCTAGG - Intronic
1116851650 14:49914741-49914763 GCAACCTCCACCTACCTCCTGGG - Intergenic
1119257202 14:73208802-73208824 GGAACTTCCCCTTTCCGCCTAGG + Intronic
1129543025 15:76366748-76366770 AGAATCTCCACTCACCACCTTGG - Intronic
1131087568 15:89589425-89589447 CCACCCTCCACTGGCCGCCTGGG - Intronic
1131154669 15:90067556-90067578 GCAGCCGCCACTGGCCGCCTCGG - Exonic
1131543564 15:93297000-93297022 GGAAACTCCACTGAACTGCTAGG - Intergenic
1132681808 16:1145578-1145600 GGCCCCTCCACTGGCCACCTGGG + Intergenic
1135546596 16:23371184-23371206 GGGACCTCCAGGGACCGCCAAGG - Intronic
1151283268 17:73092279-73092301 GGTACCCCCACACACCGCCTAGG + Intronic
1152121820 17:78423550-78423572 GCAAACTCCACTGACCCCCCCGG + Intronic
1152641639 17:81451863-81451885 GGGACCTCCACTCACAGGCTTGG - Exonic
1155438162 18:25834246-25834268 GGAACCACCCCTGAACGCCCTGG + Intergenic
1156816389 18:41316696-41316718 GGAACCTCCCCTATCTGCCTAGG - Intergenic
1160797634 19:953214-953236 GCAGACTCCACTGACCCCCTCGG + Intronic
1162744659 19:12791741-12791763 GGACCCTCCCCAGACCGCCTGGG + Exonic
1163594326 19:18211997-18212019 GGCACCTCCACAGACAGGCTTGG + Intronic
1164739631 19:30566724-30566746 GGAACCTCCACTGTCCGGAAAGG - Intronic
926606199 2:14900998-14901020 GGGACTTGCACTGACAGCCTTGG + Intergenic
928232409 2:29510047-29510069 GCCACCTCCACTGGCCACCTTGG - Intronic
929567895 2:43000944-43000966 GGGACCTCCACTGTCAACCTTGG - Intergenic
931773107 2:65516381-65516403 GCAACCTCCACCGACCTCCCAGG - Intergenic
932693983 2:73938278-73938300 GGAGTCTCCTCTGACCTCCTGGG + Intronic
935408679 2:102736568-102736590 GGAAGCTCCAAGAACCGCCTGGG + Intronic
936066655 2:109337553-109337575 GGAAGCTCCACAGACCTCTTGGG - Intronic
936484450 2:112914336-112914358 GGAATCTCCACTGTCTGTCTCGG - Intronic
1175184503 20:57170896-57170918 GGATCCTCCATTGCTCGCCTTGG - Exonic
1176207056 20:63894961-63894983 GGAGCCTCCACAGGGCGCCTCGG + Intergenic
1179354665 21:40648444-40648466 GGACCCACCACTGTCTGCCTAGG - Intronic
1180050084 21:45327094-45327116 GAAGCCTCCCCTGACTGCCTGGG + Intergenic
1181083822 22:20430142-20430164 GGGACCTCCACTTACAGCCAAGG - Intronic
1184752138 22:46492763-46492785 GCAACCTCTACTGTCCTCCTGGG - Intronic
949970226 3:9397604-9397626 GGAAACGCCACTGACCGCACGGG - Intronic
950158586 3:10742438-10742460 GGAACCTACACCAACTGCCTGGG + Intergenic
953337114 3:42102844-42102866 GGACCCTCCCCTGTCTGCCTAGG + Intronic
955224262 3:57048332-57048354 TGAACCTTCACTGACTGCTTGGG + Intronic
956363049 3:68469718-68469740 GGAAGCTCCACTGGCCTACTGGG + Intronic
965354595 3:167657892-167657914 GGAACCTCCTCTCAAAGCCTGGG + Intergenic
968437322 4:600520-600542 GGAACCTCCACTGCCAGCCAAGG - Intergenic
978420671 4:108529313-108529335 AGGATCTCCACTGACCTCCTGGG + Intergenic
978556271 4:109984082-109984104 GGAAAAACCACTGACCTCCTAGG - Intronic
989777445 5:45226006-45226028 GGCAGCTCCACTGGCCGCCCAGG + Intergenic
996819134 5:127606394-127606416 GGAACCTTCAGTGGCTGCCTGGG - Intergenic
997107629 5:131038772-131038794 GCAACCTCCACCTACCTCCTGGG - Intergenic
997780457 5:136652565-136652587 GGACCCACCCCTGACTGCCTAGG + Intergenic
998105040 5:139462975-139462997 GGTTCCACCACAGACCGCCTGGG + Intergenic
998284295 5:140843286-140843308 TGAACCTGCGCTGACCGCCACGG + Exonic
1001084877 5:168693252-168693274 GAAGCCTCCTCTGACCTCCTGGG - Intronic
1001461915 5:171923871-171923893 GGACCCTCCCCTGTCTGCCTAGG - Intronic
1008139111 6:47811297-47811319 CAAACCTCCCCTGACCACCTTGG + Intronic
1013814322 6:114079849-114079871 GCAACCTCCACCTACCTCCTGGG + Intronic
1014844863 6:126262579-126262601 GGAGCCTACACTGAGCCCCTAGG - Intergenic
1019443998 7:1061462-1061484 AGACCCTCCACTGAGCGCCAAGG + Intronic
1022821397 7:33964845-33964867 GGAAACTCCACTGGCAGACTTGG + Intronic
1027388777 7:77684315-77684337 GGAGCCTTCACTGACTGCCCTGG + Intergenic
1031341241 7:120604421-120604443 ACAACCTCCACTGCCCGCCCCGG - Intronic
1032464072 7:132132912-132132934 GGAACCACCACTGAGGACCTGGG - Intronic
1035759080 8:2055973-2055995 GGAAGCTGCACAGACGGCCTGGG - Intronic
1038498465 8:28024012-28024034 GGATGCTCCAGTGACAGCCTTGG + Intronic
1043415760 8:80047156-80047178 GGAGCCTGCACTGTCCTCCTGGG - Intronic
1043483184 8:80673359-80673381 GGAACCTCCACTGACCTGACTGG + Intronic
1044531210 8:93309857-93309879 GGATCCTCCACTGTTGGCCTAGG + Intergenic
1044840388 8:96332152-96332174 GGAACCTCCACTGGCCTCTAAGG + Intronic
1049845663 8:144799619-144799641 AGAGCCTCCCCTGACCGCCAAGG - Intronic
1056642323 9:88382182-88382204 GGCTCCTCCACAGACCACCTGGG + Intergenic
1059445030 9:114332688-114332710 GGCACCTCCACTGTCTGGCTAGG + Intronic
1059605413 9:115829472-115829494 GAGACCTCCACTGACCACTTAGG - Intergenic
1061451914 9:130672001-130672023 GGAACCTCCACTGACCGCCTGGG - Intronic
1061951198 9:133936824-133936846 AGCACCACCACTGACCGCCACGG + Intronic
1197720044 X:129738970-129738992 GGAACTTGCACAGTCCGCCTCGG + Intronic
1202596654 Y:26547840-26547862 GGAACCCCCACTGCCAGCCAAGG + Intergenic