ID: 1061451915

View in Genome Browser
Species Human (GRCh38)
Location 9:130672002-130672024
Sequence CGGAACCTCCACTGACCGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 54}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061451915_1061451924 23 Left 1061451915 9:130672002-130672024 CCAGGCGGTCAGTGGAGGTTCCG 0: 1
1: 0
2: 0
3: 3
4: 54
Right 1061451924 9:130672048-130672070 ATCCACTGATGTGGCCCCTGGGG No data
1061451915_1061451922 21 Left 1061451915 9:130672002-130672024 CCAGGCGGTCAGTGGAGGTTCCG 0: 1
1: 0
2: 0
3: 3
4: 54
Right 1061451922 9:130672046-130672068 GGATCCACTGATGTGGCCCCTGG No data
1061451915_1061451920 0 Left 1061451915 9:130672002-130672024 CCAGGCGGTCAGTGGAGGTTCCG 0: 1
1: 0
2: 0
3: 3
4: 54
Right 1061451920 9:130672025-130672047 CAGCAGGGCGTGCATCTGGCTGG No data
1061451915_1061451923 22 Left 1061451915 9:130672002-130672024 CCAGGCGGTCAGTGGAGGTTCCG 0: 1
1: 0
2: 0
3: 3
4: 54
Right 1061451923 9:130672047-130672069 GATCCACTGATGTGGCCCCTGGG No data
1061451915_1061451921 14 Left 1061451915 9:130672002-130672024 CCAGGCGGTCAGTGGAGGTTCCG 0: 1
1: 0
2: 0
3: 3
4: 54
Right 1061451921 9:130672039-130672061 TCTGGCTGGATCCACTGATGTGG No data
1061451915_1061451918 -4 Left 1061451915 9:130672002-130672024 CCAGGCGGTCAGTGGAGGTTCCG 0: 1
1: 0
2: 0
3: 3
4: 54
Right 1061451918 9:130672021-130672043 TCCGCAGCAGGGCGTGCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061451915 Original CRISPR CGGAACCTCCACTGACCGCC TGG (reversed) Intronic
902408629 1:16200047-16200069 AGGGACCTCCCCTGACCACCTGG + Intronic
903214070 1:21833503-21833525 CTGCACCGCCACTAACCGCCAGG - Exonic
904418886 1:30378898-30378920 AGACACCTCCACTGACCACCTGG - Intergenic
910760461 1:90727019-90727041 CGCAACGTCCTCTGGCCGCCGGG - Intergenic
1062798769 10:363934-363956 CGGAGCCTCCACTGTGCACCAGG + Intronic
1063580489 10:7301929-7301951 TAGAACCTCCACTGACCCCAAGG + Intronic
1072468745 10:95692479-95692501 CGGAGCCTCCACCTATCGCCAGG - Intronic
1076551571 10:131281650-131281672 CTGAACCTCCACAGTCCCCCTGG + Intronic
1078922809 11:15846002-15846024 CAAAACCTCCATTGACCACCTGG - Intergenic
1079430882 11:20387594-20387616 CGGAAACTTCGCAGACCGCCGGG - Exonic
1083710153 11:64542995-64543017 CGGGGCCTCCGCTGTCCGCCCGG - Intergenic
1084781039 11:71408226-71408248 GGGAAGCTTCACTGACCTCCTGG + Intergenic
1091748042 12:3005029-3005051 AGGAAGCTCCACAGACAGCCAGG + Intronic
1092527873 12:9320451-9320473 TGCAGCCTCCACTGACCTCCTGG - Intergenic
1092539394 12:9411315-9411337 TGCAGCCTCCACTGACCACCTGG + Intergenic
1096322903 12:50631201-50631223 CGCAACCTCCATGGACCTCCTGG + Intronic
1103976769 12:124707759-124707781 CAGATCCTCCACTGAGCTCCAGG + Intergenic
1104835484 12:131787238-131787260 TGGAACCTCTACTGAGTGCCAGG - Intronic
1110243420 13:73293988-73294010 GTCAACCTCCACTGACCTCCCGG - Intergenic
1114576931 14:23723970-23723992 GAGAACCTCCACTGACCTTCAGG - Intergenic
1132681807 16:1145577-1145599 CGGCCCCTCCACTGGCCACCTGG + Intergenic
1139673622 16:68508594-68508616 CAGAGCCTCCACTCACAGCCTGG - Intergenic
1143147036 17:4783125-4783147 CTGAGGCTCCACTGACCGCCGGG + Exonic
1145786793 17:27598860-27598882 CCCAACCCCCACTGCCCGCCCGG + Intronic
1147190834 17:38737054-38737076 CGCAACCTCTGCTGACCCCCCGG - Intronic
1147314452 17:39612859-39612881 CCTGACCTCCACTCACCGCCAGG + Intergenic
1148466383 17:47867587-47867609 CGGAGCCTCCACTGACTGTGTGG - Intergenic
1159586584 18:70288805-70288827 CGGAACCCCCACTTAGTGCCCGG + Intergenic
1160549916 18:79687797-79687819 CAGAACCTCCACAGACCCCAGGG - Intronic
1162744658 19:12791740-12791762 GGGACCCTCCCCAGACCGCCTGG + Exonic
927432702 2:23040572-23040594 CCCAACCCCCACTGACAGCCAGG + Intergenic
935408678 2:102736567-102736589 CGGAAGCTCCAAGAACCGCCTGG + Intronic
938901898 2:135805447-135805469 AGGAACCACCACTAACTGCCAGG + Intronic
1175681133 20:60989779-60989801 CGGGACCCCCACTGAGTGCCAGG - Intergenic
1184689996 22:46113217-46113239 CGTACCCTCCACTGAGCACCAGG + Intronic
949970227 3:9397605-9397627 CGGAAACGCCACTGACCGCACGG - Intronic
954425997 3:50443467-50443489 AGGCACCTCCACTCACTGCCTGG - Intronic
954849764 3:53590325-53590347 GGGAGCCTCCTCTGACTGCCTGG + Intronic
955224261 3:57048331-57048353 CTGAACCTTCACTGACTGCTTGG + Intronic
960946939 3:122973424-122973446 GGCACCCTCCACTGCCCGCCAGG - Intronic
965640834 3:170826972-170826994 CTGAACCTGCACTGAATGCCAGG + Intronic
966422129 3:179744321-179744343 CAGAACCACCACTAAGCGCCTGG - Intronic
967301945 3:188022729-188022751 CAGAACCTTCACTGACAGACAGG - Intergenic
998149477 5:139748632-139748654 GGGCGCCTCCACTGCCCGCCAGG + Intergenic
1013814321 6:114079848-114079870 CGCAACCTCCACCTACCTCCTGG + Intronic
1015843276 6:137494748-137494770 AGGAACCTCCACCAACCGCCTGG - Intergenic
1017156415 6:151325983-151326005 CGGTCCCGCCACTGACCTCCCGG - Intronic
1017671819 6:156777143-156777165 CGGAACCTGCACTTTCCCCCCGG - Intergenic
1026896846 7:74014232-74014254 GTGAACCTCCACCGCCCGCCAGG - Intergenic
1029175364 7:98660867-98660889 CTCAGCCTCCACTGACCCCCAGG + Intergenic
1038516495 8:28191869-28191891 TGGCACCTCCACTGTCCGGCTGG + Intergenic
1045501239 8:102745866-102745888 CTGAACGTCCACTAACTGCCAGG + Intergenic
1047751167 8:127881814-127881836 TGCAACCTCCACTGACTTCCTGG + Intergenic
1049276619 8:141723297-141723319 CGTGACCTCCACGGACAGCCAGG + Intergenic
1061365857 9:130172274-130172296 CGGAGCCGCCACTCAGCGCCCGG - Intergenic
1061451915 9:130672002-130672024 CGGAACCTCCACTGACCGCCTGG - Intronic
1062045622 9:134423187-134423209 AGGAAACTCCACTAACAGCCTGG - Intronic
1188186397 X:27120722-27120744 CAGAACCTCGACTGAACTCCTGG + Intergenic