ID: 1061451915

View in Genome Browser
Species Human (GRCh38)
Location 9:130672002-130672024
Sequence CGGAACCTCCACTGACCGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061451915_1061451918 -4 Left 1061451915 9:130672002-130672024 CCAGGCGGTCAGTGGAGGTTCCG No data
Right 1061451918 9:130672021-130672043 TCCGCAGCAGGGCGTGCATCTGG No data
1061451915_1061451924 23 Left 1061451915 9:130672002-130672024 CCAGGCGGTCAGTGGAGGTTCCG No data
Right 1061451924 9:130672048-130672070 ATCCACTGATGTGGCCCCTGGGG No data
1061451915_1061451920 0 Left 1061451915 9:130672002-130672024 CCAGGCGGTCAGTGGAGGTTCCG No data
Right 1061451920 9:130672025-130672047 CAGCAGGGCGTGCATCTGGCTGG No data
1061451915_1061451923 22 Left 1061451915 9:130672002-130672024 CCAGGCGGTCAGTGGAGGTTCCG No data
Right 1061451923 9:130672047-130672069 GATCCACTGATGTGGCCCCTGGG No data
1061451915_1061451921 14 Left 1061451915 9:130672002-130672024 CCAGGCGGTCAGTGGAGGTTCCG No data
Right 1061451921 9:130672039-130672061 TCTGGCTGGATCCACTGATGTGG No data
1061451915_1061451922 21 Left 1061451915 9:130672002-130672024 CCAGGCGGTCAGTGGAGGTTCCG No data
Right 1061451922 9:130672046-130672068 GGATCCACTGATGTGGCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061451915 Original CRISPR CGGAACCTCCACTGACCGCC TGG (reversed) Intronic