ID: 1061451920

View in Genome Browser
Species Human (GRCh38)
Location 9:130672025-130672047
Sequence CAGCAGGGCGTGCATCTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061451914_1061451920 1 Left 1061451914 9:130672001-130672023 CCCAGGCGGTCAGTGGAGGTTCC 0: 1
1: 0
2: 0
3: 6
4: 94
Right 1061451920 9:130672025-130672047 CAGCAGGGCGTGCATCTGGCTGG No data
1061451915_1061451920 0 Left 1061451915 9:130672002-130672024 CCAGGCGGTCAGTGGAGGTTCCG 0: 1
1: 0
2: 0
3: 3
4: 54
Right 1061451920 9:130672025-130672047 CAGCAGGGCGTGCATCTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061451920 Original CRISPR CAGCAGGGCGTGCATCTGGC TGG Intronic
No off target data available for this crispr