ID: 1061452802

View in Genome Browser
Species Human (GRCh38)
Location 9:130677739-130677761
Sequence TAAGGGGCCTGCTTCTGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 0, 2: 10, 3: 33, 4: 278}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061452802 Original CRISPR TAAGGGGCCTGCTTCTGGGG TGG (reversed) Intronic
900069925 1:762905-762927 TGAGGGGCCTGCATCTGGTAAGG + Intergenic
900291495 1:1925581-1925603 CCCGGGGCCTGTTTCTGGGGAGG - Intronic
900918651 1:5656832-5656854 TGAGGGGTCTGCATCTGGTGAGG - Intergenic
902976941 1:20095588-20095610 TCAGGGGCCTGCTACTGCAGTGG + Intergenic
904152773 1:28456174-28456196 CAACTGCCCTGCTTCTGGGGAGG + Intronic
904604864 1:31692709-31692731 TATGGGGCCAGCCCCTGGGGAGG - Intronic
905446058 1:38029144-38029166 GAAGGGGCCGGCTCCTGGGCTGG + Intergenic
908353633 1:63310556-63310578 TAAGTGGATTGCTTCTGGTGAGG - Intergenic
908469171 1:64425480-64425502 CAAGGGGCTTGCATCTGGTGAGG + Intergenic
908568458 1:65383483-65383505 GTGAGGGCCTGCTTCTGGGGTGG + Intronic
909455527 1:75844895-75844917 TAAGGGACCTGTATCTGGTGAGG + Intronic
909780880 1:79545625-79545647 TAAGGGACCATCTTCTGGTGAGG + Intergenic
909998934 1:82318022-82318044 TAAGGGGACTGCATCTGCTGAGG - Intergenic
916327998 1:163584761-163584783 TGAGGGGCCTGCATCTGGCAAGG + Intergenic
918328005 1:183428477-183428499 TGAGGGGCCAGCATCTGGAGAGG - Intergenic
921077413 1:211711274-211711296 CAAGGGGCCTGTATCTGGCGAGG + Intergenic
921930119 1:220748227-220748249 TAATGGGGCGGCCTCTGGGGTGG - Intronic
922105295 1:222508363-222508385 TGAGGGGCCTGCATCTGGTAAGG + Intergenic
922265628 1:223980941-223980963 TGAGGGGCCTGCATCTGGTAAGG + Intergenic
922448063 1:225714149-225714171 TGTGGGCCCTGCTACTGGGGAGG - Intergenic
923280184 1:232436320-232436342 TAAGTGGCCTTCTTGTGGGAAGG + Intronic
924347468 1:243085893-243085915 TGAGGGGCCTGCATCTGGTAAGG + Intergenic
924624357 1:245687218-245687240 TGTGGGGCCTGCTTTGGGGGTGG - Exonic
1063813171 10:9738264-9738286 TCAAGGGCCTGCATCTGGTGAGG + Intergenic
1065198483 10:23290017-23290039 TAAACGGCCTGCTTCAGGGCAGG + Intronic
1065799796 10:29341785-29341807 TGAGGGGCCTCCATCTGGTGAGG - Intergenic
1066233273 10:33459254-33459276 TAAGGGGCCAGCATCTGGTGAGG - Intergenic
1066728885 10:38418977-38418999 TGAGGGGCCTGCATCTGGTAAGG - Intergenic
1066757059 10:38721871-38721893 CAAGGGGCCTGCTTCTGGTGAGG + Intergenic
1067697132 10:48543397-48543419 CAGGGCCCCTGCTTCTGGGGTGG + Intronic
1068905336 10:62315826-62315848 TAAGGGCCCTGCTTCCAGAGTGG + Intergenic
1069099270 10:64297944-64297966 TAAGGTGCCAGCTCCTTGGGAGG + Intergenic
1069412091 10:68164207-68164229 CAAGGGGCCTGCATCTGGTGAGG + Intronic
1069887437 10:71632934-71632956 TCAGGGGGCTGCATCTGGTGAGG + Intronic
1070807022 10:79276610-79276632 TAGGGGGCCAGTTTCTGGGCAGG + Intronic
1070939800 10:80334551-80334573 CAAGGGGCCTGCAGCTGGTGAGG + Intergenic
1071163878 10:82782378-82782400 CAAGGGACCTGCATCTGGTGAGG - Intronic
1071486578 10:86106475-86106497 GGAGGGGCCTGCTTCAGGTGTGG + Intronic
1071486587 10:86106506-86106528 GAATGGGCCTGCTTCAGGTGTGG + Intronic
1071486596 10:86106537-86106559 GAATGGGCCTGCTTCAGGTGTGG + Intronic
1073639728 10:105239624-105239646 TAAGGGGCCTCCCTGTGGGCTGG + Intronic
1073983554 10:109182590-109182612 ACAGGCTCCTGCTTCTGGGGAGG + Intergenic
1076155396 10:128201203-128201225 ACAGGGTTCTGCTTCTGGGGAGG - Intergenic
1076768987 10:132652841-132652863 TAAGGGGTCAGCTTTTTGGGAGG + Intronic
1076974048 11:157651-157673 TGAGGGGCCTGCATCTGGTAAGG + Intergenic
1077343806 11:2037377-2037399 GAAGGGGTCTGCAGCTGGGGCGG + Intergenic
1077874617 11:6293667-6293689 CAAGGGGCCAGCTTCTGGTGAGG - Intergenic
1078094110 11:8285987-8286009 TGAGGGTGCTGCTTCTGGGTGGG - Intergenic
1078414258 11:11152410-11152432 TGAGAGGCCTGCATCTGGTGAGG + Intergenic
1078519340 11:12050880-12050902 TTAGGGGCATGCTTCTGGGTGGG + Intergenic
1078572124 11:12468286-12468308 CATGGGGACTGCTTCAGGGGAGG + Intronic
1079890447 11:26045952-26045974 TGAGGGGCCTGCTGCTGTGTGGG + Intergenic
1081751097 11:45511859-45511881 TTAAGGCCCTGCTGCTGGGGAGG - Intergenic
1083300860 11:61738999-61739021 GGAGGAGCCTGGTTCTGGGGAGG + Intronic
1085467366 11:76733378-76733400 TGAGGGGCCGGCATCTGGTGAGG + Intergenic
1087771593 11:102216156-102216178 AAGGTGTCCTGCTTCTGGGGAGG + Intronic
1089630842 11:119783273-119783295 TGAGGGGCCGGCATCTGGTGAGG + Intergenic
1090553127 11:127844654-127844676 GAAAGAGGCTGCTTCTGGGGAGG + Intergenic
1090729058 11:129553985-129554007 TGAGGGGCCAGCATCTGGTGAGG - Intergenic
1091286142 11:134409626-134409648 TGAGGGGCCTCCTGCAGGGGTGG + Intronic
1202826792 11_KI270721v1_random:92566-92588 GAAGGGGTCTGCAGCTGGGGCGG + Intergenic
1091931486 12:4399252-4399274 TGAGGAGCCTGCATCTGGTGAGG + Intergenic
1091971195 12:4788451-4788473 AAAGGGGCCTGGTCTTGGGGTGG + Intronic
1092926428 12:13276390-13276412 TTAGGGCACTGCTTCTGCGGCGG + Intergenic
1093845694 12:23968590-23968612 TGAGGGGCCAGCATCTGGCGAGG - Intergenic
1096073243 12:48787671-48787693 TTAGGAGCCTGACTCTGGGGAGG - Intronic
1096113447 12:49041785-49041807 GAAGGGATCTGCTTCTGGGTAGG - Intronic
1100028685 12:90160846-90160868 ACAGGGTTCTGCTTCTGGGGAGG + Intergenic
1100397472 12:94197520-94197542 CAAGGGGCCTGCATCTGGTGAGG - Intronic
1100398295 12:94204035-94204057 CGAGGGGCCTGCATCTGGCGAGG - Intronic
1101064749 12:101008298-101008320 GAAAGGGGCTGCTTCTTGGGAGG - Intronic
1102022866 12:109696091-109696113 CTAGGGGCCTTCCTCTGGGGTGG - Intergenic
1104734136 12:131126343-131126365 TGAGGGGCCTGCATCTGGTAAGG - Intronic
1106894105 13:34279646-34279668 TCAGGCTTCTGCTTCTGGGGAGG + Intergenic
1108910855 13:55550056-55550078 ATAGGGTTCTGCTTCTGGGGAGG - Intergenic
1110782013 13:79477676-79477698 GAATGGCCCTGCTTCTGGGAAGG + Intergenic
1113537072 13:111076414-111076436 TTATGGCCCTGCTGCTGGGGAGG + Intergenic
1114391448 14:22312872-22312894 CCAGGGGCCTGCATCTGGGGAGG + Intergenic
1115456310 14:33607882-33607904 TAAGGGGCTTCCTTCTTTGGTGG - Intronic
1118323248 14:64765435-64765457 TAAGGGGCCTGCTCCAGGTAAGG + Intronic
1118388612 14:65277850-65277872 TAAGGGGCCCGCCTCTGGGGAGG - Intergenic
1118700198 14:68425557-68425579 CAAGGGGCCAGCATCTGGTGAGG - Intronic
1119229522 14:72969334-72969356 TAAGGGGCATGTTTCAAGGGCGG - Intergenic
1119426706 14:74540071-74540093 TGAGGGCCCTGGTTTTGGGGTGG - Intronic
1119737476 14:76992678-76992700 TAAGGGACCTAGTGCTGGGGAGG + Intergenic
1122576567 14:102746729-102746751 CAGGGAGCCTGCTTCTGGGCTGG + Intergenic
1124104561 15:26725331-26725353 GGAGGGGACAGCTTCTGGGGAGG - Intronic
1124104972 15:26729331-26729353 GGAGGGGACAGCTTCTGGGGAGG - Intronic
1124445125 15:29723465-29723487 ACAGGCTCCTGCTTCTGGGGAGG - Intronic
1127079930 15:55367600-55367622 TAGGGGGCCTGTTTGTAGGGTGG + Intronic
1127268549 15:57380408-57380430 TAAGGGGCCTGAGTCAGGTGGGG + Intronic
1127826050 15:62703896-62703918 GCAGAGGCCTGCTTCTGGGGTGG + Intronic
1128252072 15:66170781-66170803 TGAGGGCCGTGCTTGTGGGGAGG - Intronic
1128322258 15:66702104-66702126 CAAGGGGCCGGCTCCCGGGGCGG - Intergenic
1129102312 15:73277411-73277433 TCTGAGGCCTCCTTCTGGGGTGG + Intronic
1129232279 15:74203401-74203423 GCAGGGTCCTGCTCCTGGGGAGG - Intronic
1129775865 15:78236040-78236062 TAAGGTGCCAGCATCTGGTGAGG + Intronic
1129968413 15:79756993-79757015 TAAGGGGCATGTTTCTAGGGTGG - Intergenic
1132035320 15:98478866-98478888 CAAGGGTCCTGATTCCGGGGAGG - Intronic
1132472967 16:117006-117028 TATGGGGTTTCCTTCTGGGGTGG + Intronic
1133601611 16:7345311-7345333 TGAGGGGCCTGCTCTCGGGGAGG + Intronic
1133606140 16:7389988-7390010 TACAGGCTCTGCTTCTGGGGAGG + Intronic
1136623817 16:31449130-31449152 CAAGGGCCCTGCATCTGGTGAGG + Intergenic
1136627299 16:31469635-31469657 CAAGGGCCCTGCATCTGGTGAGG - Intergenic
1136720463 16:32315859-32315881 CAAAGGGCCTGCTTCTGGTGAGG - Intergenic
1136725520 16:32354252-32354274 CAAGGGGCCTGCTTCTGGTGAGG - Intergenic
1136838842 16:33522135-33522157 CAAAGGGCCTGCATCTGGTGAGG - Intergenic
1136843850 16:33560308-33560330 CAAGGGGCCTGCTTCTGGTGAGG - Intergenic
1141426525 16:83947807-83947829 GAAGGGGCCTGGCACTGGGGAGG - Intronic
1142435597 16:90054999-90055021 GAAGGAGCCTGCTGCAGGGGCGG + Intergenic
1142446210 16:90140012-90140034 TGAGGGGCCTGCATCTGGTAAGG - Intergenic
1203000912 16_KI270728v1_random:163504-163526 CAAGGGGCCTGCTTCTGGTGAGG + Intergenic
1203005969 16_KI270728v1_random:201910-201932 CAAAGGGCCTGCTTCTGGTGAGG + Intergenic
1203132513 16_KI270728v1_random:1699907-1699929 CAAGGGGCCTGCTTCTGGTGAGG + Intergenic
1203149007 16_KI270728v1_random:1822423-1822445 CAAAGGGCCTGCATCTGGTGAGG - Intergenic
1203154015 16_KI270728v1_random:1860606-1860628 CAAGGGGCCTGCTTCTGGTGAGG - Intergenic
1142461295 17:95451-95473 TGAGGGGCCTGCATCTGGTAAGG + Intergenic
1143565770 17:7719660-7719682 TCAGGGGGCTGGTTCAGGGGTGG + Intronic
1144267318 17:13583548-13583570 TAAGGGGCATTTTTCTGGAGGGG - Intronic
1144522318 17:15961681-15961703 TAAGGTGCCAGCATCTGGCGAGG + Intronic
1144676153 17:17163132-17163154 TCAGGAGCCAGCTACTGGGGTGG + Intronic
1145252648 17:21304845-21304867 TTAGGGGCCTGCTCCCGGGTAGG + Intronic
1147266287 17:39236823-39236845 TGAGGGGCCTGCCTGGGGGGCGG - Intergenic
1147437704 17:40427755-40427777 CAAGGGGCCTGCATCTGGTGAGG - Intergenic
1147584397 17:41645429-41645451 TTAGGGGGCTGCATCTGGCGAGG - Intergenic
1147793124 17:43025451-43025473 TGAGGGACCTGCGTCTTGGGAGG + Intronic
1148748777 17:49932585-49932607 GAGGGCGCCTGCTCCTGGGGGGG + Intergenic
1148889319 17:50796422-50796444 TGAGGGGCCGGCATCTGGTGAGG + Intergenic
1148945800 17:51260696-51260718 GAAGGGGCAGGCTTTTGGGGAGG - Exonic
1150562828 17:66309555-66309577 CAAGGGCCATTCTTCTGGGGAGG + Intronic
1151746899 17:76016491-76016513 TAAGGACCCAGCTTCTTGGGAGG + Intronic
1152343491 17:79737974-79737996 GGAGGGGCCTGCTGCTGGGCGGG - Exonic
1152403293 17:80082496-80082518 AAAGGGGCCTGCTTGAGGCGGGG - Intronic
1152648710 17:81482152-81482174 GCAGGGGCCTCCCTCTGGGGTGG + Intergenic
1152718001 17:81909083-81909105 GAAGGGGCCTCCTACTGGAGGGG - Intronic
1153980743 18:10307459-10307481 TAAAGGGACTGCATCTGGTGAGG - Intergenic
1158373996 18:56842238-56842260 CAAGGGGTCTGCATCTGGTGAGG + Intronic
1160650996 19:227818-227840 TGAGGGGCCTGCATCTGGTAAGG + Intergenic
1162291329 19:9783041-9783063 TATGGTCCCTGCTACTGGGGAGG - Intronic
1163122823 19:15228127-15228149 TATAAGGCCTGCTCCTGGGGTGG + Intronic
1163625367 19:18386493-18386515 TATGGGGGCTGCTTGGGGGGTGG - Intronic
1163725758 19:18922248-18922270 AAAGAGGCCTGCTTCAGGGGTGG + Intronic
1165225590 19:34352567-34352589 TAAGGGCCAGGCATCTGGGGAGG + Intronic
1166017392 19:39992971-39992993 AATGGCACCTGCTTCTGGGGAGG - Intronic
1166921591 19:46232421-46232443 TAAGGAACCTGCTTCTGGGTTGG - Intergenic
1166976276 19:46606944-46606966 TAAAGGCCCAGCTTCTGCGGTGG + Intronic
1168337839 19:55606231-55606253 GAAGGGGCGTTCTGCTGGGGAGG - Intronic
926702269 2:15811473-15811495 TCAGGGACCTGCTTCCTGGGTGG - Intergenic
927697091 2:25246136-25246158 TAGTTGGCCTGCTTCTGGAGAGG - Intronic
927882323 2:26697522-26697544 GAAGCCCCCTGCTTCTGGGGAGG - Intronic
929125733 2:38521326-38521348 AAAGGAGCCTGTTCCTGGGGTGG + Intergenic
929668571 2:43852301-43852323 TCAGGGGCCTCCTTCAGGGCTGG - Intronic
929739215 2:44585440-44585462 GAAGTGGCCTGCTTCTCTGGGGG + Intronic
930553888 2:52870657-52870679 GAAGGCTTCTGCTTCTGGGGAGG - Intergenic
931185900 2:59951144-59951166 TAAGGGGACGGCTTCAGTGGAGG - Intergenic
932571923 2:72942712-72942734 CAAGGGGTCTGCTCCTGTGGCGG - Exonic
934320366 2:91966312-91966334 CAAGGGGCCTGCTTCTGGTGAGG + Intergenic
934912589 2:98272957-98272979 TAAGGGGCCAGCACCTGGTGAGG - Intronic
935706920 2:105865001-105865023 CAAGAGGCCTCCTGCTGGGGAGG - Intronic
936636233 2:114261754-114261776 CAAGGGGCCAGATTCTAGGGTGG - Intergenic
937654101 2:124355469-124355491 TAGGGTGCCTGCTGCTTGGGAGG - Intronic
938114367 2:128593324-128593346 AATGGGGCCTGCTTCTTGGGTGG + Intergenic
938378769 2:130825200-130825222 TGAGGAGCCTGCCTGTGGGGAGG - Intergenic
939095296 2:137827143-137827165 AAAGGGGTCTGGTTCTGGGGAGG + Intergenic
939935499 2:148287656-148287678 CAAGGGGCCTGCATCTGGTGAGG + Intronic
943351785 2:186805459-186805481 TAAGGTCCCTGCCTCTGTGGAGG - Intergenic
945790049 2:214293615-214293637 TTATGAGTCTGCTTCTGGGGAGG + Intronic
948267259 2:236644051-236644073 CAAGGAGCCTGCATCTGGTGAGG - Intergenic
1171936839 20:31282647-31282669 TGAGGCTTCTGCTTCTGGGGAGG - Intergenic
1172661375 20:36571483-36571505 TAATGGGCCAGCTCCTGGTGAGG + Intergenic
1172801796 20:37581197-37581219 GAAGGAGGGTGCTTCTGGGGAGG + Intergenic
1172889434 20:38253496-38253518 CAAGGGGCCTCTTTCTGGAGTGG - Intronic
1173704633 20:45100897-45100919 TAAGGGGCCTCCTTTGGGGAGGG - Intronic
1174543596 20:51308443-51308465 TGAGGCACCTGCTTCTGGTGGGG - Intergenic
1175086608 20:56464755-56464777 CAAGGGGCCTGCATCTGGCAAGG + Intergenic
1175875670 20:62228163-62228185 TGAGGGGCGTGTGTCTGGGGAGG - Intergenic
1177256026 21:18663818-18663840 CAAGGGGCCAGCATCTGGTGAGG + Intergenic
1177310348 21:19384151-19384173 CAAGGTGCCTGCATCTGGTGTGG - Intergenic
1177701986 21:24651119-24651141 TGAGGGGCCTGTGTCTGGTGAGG - Intergenic
1178135819 21:29626151-29626173 TAAGGTGCCAGCATCTGGTGAGG + Intronic
1178462134 21:32811964-32811986 CAAGGGGCCTGCATCTGGCAAGG - Intronic
1180308612 22:11150368-11150390 CAAGGGGTCTGCTTCTGGTGAGG + Intergenic
1180547089 22:16512179-16512201 CAAGGGGTCTGCTTCTGGTGAGG + Intergenic
1180708479 22:17824057-17824079 TTAGGGGCCGGCTCCTGGGGAGG - Intronic
1180840009 22:18954817-18954839 CAGGGGGCCTGGTGCTGGGGTGG - Intergenic
1181061891 22:20285663-20285685 CAGGGGGCCTGGTGCTGGGGTGG + Intergenic
1182212087 22:28685162-28685184 CAAGGGGCCTGCTTCTGGTGAGG - Intergenic
1184256241 22:43288685-43288707 TATGGGGCCCGCTCCTTGGGAGG - Intronic
1185216426 22:49602338-49602360 CAAGGGGCCAGCTTCCGGGCAGG + Intronic
950772321 3:15322456-15322478 TAAGTGGACAGGTTCTGGGGAGG + Intronic
950955345 3:17047084-17047106 GAATGTGACTGCTTCTGGGGAGG + Intronic
954616509 3:51971432-51971454 TAAGGGGCAGGCTTCTGGGCAGG - Intronic
954663753 3:52239486-52239508 GAAGGGGTCTGCTTGTGGGTGGG + Intergenic
955691646 3:61597005-61597027 TAAGGGGCCAGCGTGTGGTGAGG + Intronic
959873386 3:111353611-111353633 TAAGGAGCCGGCATCTGGTGAGG - Intronic
960726327 3:120673976-120673998 TAGGGGGCCTGCCTCCAGGGTGG + Intronic
963208821 3:142665888-142665910 TCAAGGACCTGCTTCTGGGTTGG - Intronic
963223674 3:142838516-142838538 TGAGGCTTCTGCTTCTGGGGAGG - Intronic
965700173 3:171452628-171452650 GAAAGGGTGTGCTTCTGGGGTGG - Intronic
966977808 3:185101547-185101569 ACAGGCGTCTGCTTCTGGGGAGG + Intronic
967044805 3:185726800-185726822 GAAGAGGCTTGTTTCTGGGGAGG + Intronic
968366834 3:198192169-198192191 TGAGGGGCCTGCATCTGGTAAGG - Intergenic
969397267 4:6930334-6930356 CACGGGGCCTGCTGCTGGGTTGG + Intronic
970084149 4:12326462-12326484 CAAGGGGCCAGCATCTGGTGAGG - Intergenic
970155631 4:13139235-13139257 CAAGGGGCCTGCATCTGGTGAGG - Intergenic
970322220 4:14886133-14886155 GGAGGGGGCTGCTTCTGGGATGG - Intergenic
970984499 4:22140555-22140577 TCAGGCTTCTGCTTCTGGGGAGG + Intergenic
971672661 4:29583206-29583228 TCAGGCTTCTGCTTCTGGGGAGG + Intergenic
972710299 4:41588751-41588773 TAAGGGGCCTCTCTCTGTGGCGG - Intronic
973730752 4:53820202-53820224 TATGGGCCCAGCTACTGGGGAGG - Intronic
973908734 4:55557344-55557366 TGAGGGGCCTGCATCAGGTGAGG + Intronic
973970061 4:56204386-56204408 CAAGGGGCCTGCATCTGATGAGG + Intronic
974095777 4:57362230-57362252 CAAGGGGCCTGCATCTGGTGAGG + Intergenic
976203437 4:82601741-82601763 TAGTTGGCCTGCTTTTGGGGTGG + Intergenic
978411661 4:108432776-108432798 AGTGGGGCCTGCTGCTGGGGAGG + Intergenic
978682897 4:111403555-111403577 CAAGGGGCCGGCATCTGGTGAGG + Intergenic
979333087 4:119438729-119438751 TGAGGGGCCTGCATCTGGTAAGG + Intergenic
979354166 4:119683197-119683219 TAATGGGCGAGCTTGTGGGGTGG + Intergenic
980083063 4:128364543-128364565 TAAGGGGCCAGGGTTTGGGGAGG + Intergenic
983378344 4:166958310-166958332 AGTGGGGTCTGCTTCTGGGGAGG - Intronic
985297865 4:188454963-188454985 TTAGGGGCCAGCATCTGGTGAGG + Intergenic
986057687 5:4154689-4154711 AAAGCGGCCTGCTTCTGGACTGG + Intergenic
986439919 5:7771580-7771602 TAAGGGGCATGCTTGAGTGGAGG - Intronic
987271940 5:16318904-16318926 CAAGGGGCCTCCATCTGGCGAGG - Intergenic
989194789 5:38706297-38706319 AAAGGGGCCTGGTTCTGTTGTGG - Intergenic
989348654 5:40458644-40458666 TCAGGGGCCCACTTCTGGTGAGG - Intergenic
991590801 5:68249749-68249771 AAAGGGGCCTGCTTGTGGTGGGG + Intronic
992401029 5:76411663-76411685 TGAGGGGCCTGCAACTGGTGAGG - Intronic
992450956 5:76875320-76875342 TTGGTGGCCTGCTTCTGGAGTGG + Exonic
992628654 5:78658974-78658996 TAAGGGGCTGGATTCTGGTGGGG + Intronic
995834531 5:116387107-116387129 GGAGGGGGCTGCTTCTGCGGCGG + Intronic
998417809 5:141958310-141958332 TAAGTGGCCTGCCGCTGAGGAGG + Exonic
998445151 5:142192691-142192713 AACAGGGCCTGCCTCTGGGGTGG - Intergenic
999272725 5:150306944-150306966 AGAGGGGCCTGCCACTGGGGAGG - Intronic
1000208907 5:159092309-159092331 TAAGAGGCTTGCTTTTGGGAAGG - Intronic
1000292605 5:159884510-159884532 CAAGGGGCCTGAATCTGGTGAGG - Intergenic
1001487786 5:172132013-172132035 TGAGGGCCCTGCATCTGGCGAGG - Intronic
1002618149 5:180468130-180468152 CAAGGGGCCAGCATCTGGTGAGG - Intergenic
1002726057 5:181297371-181297393 TGAGGGGCCTGCATCTGGTAAGG - Intergenic
1002845180 6:939136-939158 TCAGGCGCCTGAGTCTGGGGTGG - Intergenic
1003190149 6:3867359-3867381 AATGGGGTTTGCTTCTGGGGTGG - Intergenic
1003270476 6:4603375-4603397 TGAGGTGCCTGGTTCTGGGAGGG + Intergenic
1003502719 6:6715577-6715599 CATGGGGCCTGGTCCTGGGGGGG - Intergenic
1005009382 6:21321606-21321628 TTTGTGGCCTGCTTCAGGGGAGG - Intergenic
1006091427 6:31631311-31631333 TTAGGGGGCTCCTTCTTGGGTGG - Exonic
1006320084 6:33314991-33315013 GAAGGGGCAGGCTACTGGGGTGG - Exonic
1006440197 6:34049199-34049221 TAAGGAGACTGCTTTTGTGGAGG + Intronic
1006694566 6:35920621-35920643 TGCGGGGCCTGCCTCGGGGGCGG + Intronic
1007375063 6:41450971-41450993 AAAGAGGCTTGCTGCTGGGGTGG + Intergenic
1007492121 6:42231255-42231277 CAAGGGGCCTGCATCTGGCAAGG - Intronic
1008144767 6:47878141-47878163 CAAGGTGCCTGCTTCTTGGGGGG - Exonic
1009529563 6:64794551-64794573 TCAGGCTTCTGCTTCTGGGGAGG - Intronic
1010224452 6:73476002-73476024 TAGATGACCTGCTTCTGGGGTGG + Intronic
1012429003 6:99144604-99144626 GAAGGACCCTGCCTCTGGGGAGG + Intergenic
1012834683 6:104250879-104250901 TGAGGGGCCTGCATCTGGCAAGG - Intergenic
1016149424 6:140721139-140721161 TGAGGGCCCTGCTACTTGGGAGG + Intergenic
1016906287 6:149153561-149153583 TGAGGGGCCGGCATCTGGTGAGG - Intergenic
1018131248 6:160734162-160734184 TGAGCAGACTGCTTCTGGGGAGG + Intronic
1018249197 6:161851288-161851310 CATGGGGCCTGCATCTGGTGAGG - Intronic
1020546750 7:9541987-9542009 ACAGGGCTCTGCTTCTGGGGAGG - Intergenic
1022527587 7:31048539-31048561 TCTAGGGCCTGCTTCTGGGGTGG + Intergenic
1023551285 7:41372551-41372573 TAAGGGGCGTGGCTTTGGGGTGG + Intergenic
1023789290 7:43739256-43739278 TAGTGCACCTGCTTCTGGGGAGG + Intergenic
1024070950 7:45784936-45784958 TGAGGGGCCTGCATCTGGTAAGG - Intergenic
1024557129 7:50613447-50613469 AAAGGGCCCTGCCTCTGGAGGGG - Intronic
1026040605 7:66865453-66865475 TGAGGGGCCTGCATCTGGTGAGG - Intergenic
1026241098 7:68575836-68575858 TCAAGGGGCTGCATCTGGGGAGG + Intergenic
1030335007 7:108316311-108316333 CAAGAGGCCTGCATCTGGTGAGG - Intronic
1034328783 7:150264073-150264095 TTAGGGGCCTACTCGTGGGGTGG - Intronic
1034669265 7:152845678-152845700 TTAGGGGCCTGCTCGTGGGGTGG + Intronic
1037415462 8:18644908-18644930 TAAGGGGCCTGCATCTGATGAGG + Intronic
1038726304 8:30085239-30085261 CCAGGGGCCTGCATCTGGTGGGG - Intergenic
1039638550 8:39193853-39193875 TTAGGAACCTGCTTCTGTGGAGG + Intronic
1039687487 8:39820600-39820622 TAAGGGAACTGCCTCAGGGGAGG - Intronic
1039853750 8:41395192-41395214 CAAGGGGCCGGCATCTGGTGAGG + Intergenic
1040517005 8:48143609-48143631 CAGGGGATCTGCTTCTGGGGAGG - Intergenic
1042481391 8:69307567-69307589 TAAGGGGCCCACATCTGGTGAGG - Intergenic
1043469882 8:80551594-80551616 GAAGGAGCCTGGTTGTGGGGAGG + Intergenic
1043621543 8:82198664-82198686 TAAGGGGCCAGCATCTGGTGAGG + Intergenic
1044561037 8:93612568-93612590 CAAGGGGCCGGCATCTGGTGGGG + Intergenic
1044693453 8:94900457-94900479 TAAGGGCCCTCCCTCTGAGGTGG - Intronic
1046069846 8:109237357-109237379 GAAGAGGCCTGATTCTGTGGTGG - Intergenic
1047006372 8:120624304-120624326 TGAGGGGCCTGCACCTGGTGAGG + Intronic
1048457269 8:134589700-134589722 TCAGAGCCCTGCCTCTGGGGAGG - Intronic
1049831060 8:144700829-144700851 TGAGGGGCATGTTCCTGGGGTGG + Intergenic
1051262000 9:15273677-15273699 GAAGGGGCCTGGTTGTGTGGGGG - Intronic
1052662860 9:31458180-31458202 AAAGGCTTCTGCTTCTGGGGAGG - Intergenic
1053345306 9:37373759-37373781 TGAGAGCCCTGCTTCTGTGGTGG - Intergenic
1053651188 9:40171265-40171287 TAAGCTGGTTGCTTCTGGGGTGG - Intergenic
1054533392 9:66204938-66204960 TAAGCTGGTTGCTTCTGGGGTGG + Intergenic
1054862926 9:69971736-69971758 TAAGGGGCCTGCTGTTGGCAGGG + Intergenic
1055916584 9:81408287-81408309 TAAGGGCCTTGCATCTGGTGAGG - Intergenic
1056765166 9:89440545-89440567 GAAGGGCCCTGCTGCTGTGGAGG - Intronic
1056800544 9:89687708-89687730 TCAAGGGCGTGCCTCTGGGGAGG + Intergenic
1056921330 9:90791975-90791997 TAAGGAGTCTGTTTCTGGGTGGG + Intergenic
1056931704 9:90883290-90883312 CTATGGGCCTGCTCCTGGGGAGG - Intronic
1057353324 9:94317699-94317721 GCAGGGGCCTGTTTCTGGGCAGG - Intergenic
1057546508 9:96022912-96022934 TAAGTGGCCTGTGTCTGTGGGGG - Intergenic
1057654427 9:96939893-96939915 GCAGGGGCCTGTTTCTGGGCAGG + Intronic
1057823435 9:98352653-98352675 TGAGGGTCCTGCTGCTGGAGGGG + Intronic
1060222457 9:121771935-121771957 CAAGGAGCTAGCTTCTGGGGAGG + Intronic
1060374472 9:123106162-123106184 TGAGGGTTCTGCTTTTGGGGAGG + Intergenic
1061452802 9:130677739-130677761 TAAGGGGCCTGCTTCTGGGGTGG - Intronic
1062589832 9:137268646-137268668 CAAGGGGCCTGCATCTGGCTGGG + Intronic
1062751191 9:138255013-138255035 TGAGGGGCCTGCATCTGGTAAGG - Intergenic
1187784134 X:22865645-22865667 CAAGGGGCCTGCATCTGGTGAGG - Intergenic
1188104523 X:26133575-26133597 CAAGGGGCTTGCATCTGGTGAGG + Intergenic
1192279338 X:69667802-69667824 TGAGGGGCCTGCATCTGGCGAGG + Intronic
1192336980 X:70229775-70229797 TAAGGGGCCTGCGTCTGGTGAGG + Intergenic
1192359958 X:70433155-70433177 TAAGTGGAATGCTTCAGGGGTGG + Exonic
1192706807 X:73534546-73534568 TAAGGCTTCTGCTTTTGGGGAGG - Intergenic
1193547187 X:82845012-82845034 TGTGGCTCCTGCTTCTGGGGAGG - Intergenic
1194831603 X:98630302-98630324 TGAGGGGCCTGCATCTGGTGAGG + Intergenic
1197640915 X:128967246-128967268 AAAGGTGCCAGCTTCTGGTGAGG + Intergenic
1197949004 X:131874040-131874062 TCATGGGCCTGGTTCTGGAGTGG + Intergenic
1200182150 X:154157089-154157111 TAAGGAGGCTGCCTCTGGGCAGG - Intronic
1200187804 X:154194203-154194225 TAAGGAGGCTGCCTCTGGGCAGG - Intergenic
1200193454 X:154231343-154231365 TAAGGAGGCTGCCTCTGGGCAGG - Intronic
1200199209 X:154269147-154269169 TAAGGAGGCTGCCTCTGGGCAGG - Intronic
1201187874 Y:11421418-11421440 CAAGGGGCCAGCTTCTGGTGAGG + Intergenic
1201759708 Y:17523399-17523421 TAAGGGGGCTGCCTCTGAAGGGG + Intergenic
1201841846 Y:18382591-18382613 TAAGGGGGCTGCCTCTGAAGGGG - Intergenic