ID: 1061453702

View in Genome Browser
Species Human (GRCh38)
Location 9:130682279-130682301
Sequence AAGCTGGCCTAAAGGAGAGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 207}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061453702_1061453706 -2 Left 1061453702 9:130682279-130682301 CCTTCTCTCCTTTAGGCCAGCTT 0: 1
1: 0
2: 2
3: 14
4: 207
Right 1061453706 9:130682300-130682322 TTACCCCCAAACCTGGCTCCTGG 0: 1
1: 0
2: 3
3: 21
4: 371
1061453702_1061453716 14 Left 1061453702 9:130682279-130682301 CCTTCTCTCCTTTAGGCCAGCTT 0: 1
1: 0
2: 2
3: 14
4: 207
Right 1061453716 9:130682316-130682338 CTCCTGGGGACGGATGAGGAAGG 0: 1
1: 0
2: 0
3: 29
4: 311
1061453702_1061453715 10 Left 1061453702 9:130682279-130682301 CCTTCTCTCCTTTAGGCCAGCTT 0: 1
1: 0
2: 2
3: 14
4: 207
Right 1061453715 9:130682312-130682334 CTGGCTCCTGGGGACGGATGAGG 0: 1
1: 0
2: 1
3: 14
4: 280
1061453702_1061453713 4 Left 1061453702 9:130682279-130682301 CCTTCTCTCCTTTAGGCCAGCTT 0: 1
1: 0
2: 2
3: 14
4: 207
Right 1061453713 9:130682306-130682328 CCAAACCTGGCTCCTGGGGACGG 0: 1
1: 0
2: 2
3: 23
4: 275
1061453702_1061453707 -1 Left 1061453702 9:130682279-130682301 CCTTCTCTCCTTTAGGCCAGCTT 0: 1
1: 0
2: 2
3: 14
4: 207
Right 1061453707 9:130682301-130682323 TACCCCCAAACCTGGCTCCTGGG 0: 1
1: 0
2: 2
3: 41
4: 315
1061453702_1061453704 -9 Left 1061453702 9:130682279-130682301 CCTTCTCTCCTTTAGGCCAGCTT 0: 1
1: 0
2: 2
3: 14
4: 207
Right 1061453704 9:130682293-130682315 GGCCAGCTTACCCCCAAACCTGG 0: 1
1: 0
2: 0
3: 8
4: 94
1061453702_1061453708 0 Left 1061453702 9:130682279-130682301 CCTTCTCTCCTTTAGGCCAGCTT 0: 1
1: 0
2: 2
3: 14
4: 207
Right 1061453708 9:130682302-130682324 ACCCCCAAACCTGGCTCCTGGGG 0: 1
1: 0
2: 4
3: 26
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061453702 Original CRISPR AAGCTGGCCTAAAGGAGAGA AGG (reversed) Exonic
901718916 1:11179516-11179538 AAGCTGGCCAAAAGGACAGAGGG - Intronic
901815654 1:11791954-11791976 GAGTTGGCCAACAGGAGAGAAGG - Intronic
902460678 1:16574043-16574065 AAGCTGACTTAAAGGAGATCCGG + Intronic
903040617 1:20527209-20527231 AAGCTGGCCTCAAGCACACATGG + Intergenic
904075933 1:27842432-27842454 AAGGTGGCCTAAAGGGGAAATGG - Intronic
907824655 1:58003876-58003898 AGGCTGGCATAAAAGAGAGATGG - Intronic
908635022 1:66154064-66154086 TAGCTGCCTTAAAGGAGAAAGGG - Intronic
910755077 1:90680993-90681015 AATCTGGCCTAGAGGAAAGGCGG + Intergenic
911125630 1:94338528-94338550 AAGTTGCCCTAAGGCAGAGAAGG + Intergenic
911216981 1:95205418-95205440 AAGCAGGTTTGAAGGAGAGATGG + Intronic
911872505 1:103116966-103116988 AAACTAGCCTAATAGAGAGATGG - Intergenic
914436504 1:147664976-147664998 AAGCTTGCGCAAAGCAGAGATGG + Intronic
914680922 1:149937698-149937720 AAGCTGGGAACAAGGAGAGAAGG + Intergenic
918195098 1:182213729-182213751 TAGCTGCCCTAAGGGAGAAAGGG + Intergenic
918290313 1:183101084-183101106 AGACTGGGCCAAAGGAGAGAAGG - Intronic
919518249 1:198554344-198554366 TAGCAGGCCTAAAGGCAAGATGG + Intergenic
921324693 1:213979220-213979242 AAGATGGCCTTTAGGAGAAAAGG - Intergenic
922914922 1:229249417-229249439 AAGCTGGAGGAAAGGAGTGAAGG - Intergenic
924025195 1:239824938-239824960 AAGATGGGCTAAAGTTGAGAAGG - Intronic
1062795866 10:344800-344822 TAGCTGGCGTAAAGGTGAGGGGG - Exonic
1063544820 10:6970684-6970706 CAACTGGCCAAAAGGAGAGCAGG + Intergenic
1065741171 10:28798501-28798523 AAGTTGGCGTAAAGGAGACCAGG - Intergenic
1069500572 10:68949513-68949535 AAGAAGCCCTAAAGGAGGGAGGG + Intergenic
1070672282 10:78386443-78386465 GAGCTGGCCTGCAGGTGAGAGGG + Intergenic
1074367876 10:112874651-112874673 ACAATGGCCAAAAGGAGAGAAGG - Intergenic
1075920244 10:126205352-126205374 AAGTTGGCCTAAAGTACACAGGG - Intronic
1076572419 10:131441339-131441361 AAGGTGGAATAAAGGAGGGAGGG + Intergenic
1078991104 11:16647486-16647508 AAGATGGCATATAGGAGACAGGG + Intronic
1080103509 11:28486603-28486625 TAGATGGCCTAAAGGGCAGATGG - Intergenic
1080812019 11:35714127-35714149 AAGCTTTCCTAAAGAAAAGAGGG - Intronic
1081719274 11:45275367-45275389 AAACAAGCGTAAAGGAGAGAGGG - Intronic
1083658818 11:64242666-64242688 AAACTGGCTTAGAGGCGAGAGGG - Intronic
1090160653 11:124491098-124491120 ATGATGGCATAAAGGATAGAAGG - Intergenic
1091565386 12:1644317-1644339 AAGCTGGCTTAGAGCAGAGGAGG - Intronic
1091929609 12:4384323-4384345 AAGCTGGGAGATAGGAGAGAAGG + Intergenic
1092009786 12:5099804-5099826 CAGCTGGCTGAAAAGAGAGAAGG + Intergenic
1095403296 12:41839746-41839768 AAGCTAGTCTCCAGGAGAGATGG - Intergenic
1095628119 12:44342309-44342331 AAGCTGGCTAAAAAGAGGGAGGG - Intronic
1096837403 12:54359504-54359526 AAGACAGCCTACAGGAGAGACGG + Intergenic
1100330945 12:93581709-93581731 ACGTTGGCAGAAAGGAGAGAAGG - Intronic
1101229614 12:102726728-102726750 TAGCTGGCCTAATTGAAAGATGG + Intergenic
1101825075 12:108213861-108213883 GAGCTCCCCTAAAAGAGAGATGG - Intronic
1102261510 12:111446079-111446101 AAGATGGCCGAAAGAAGAAAAGG - Intronic
1104303387 12:127586748-127586770 AAGCTGACATAAAACAGAGAAGG - Intergenic
1104610221 12:130221434-130221456 AAGCTGGCCTCATGCAGAGACGG - Intergenic
1106230382 13:27816838-27816860 AAGCTGTCCTTAAGAAGAGATGG - Intergenic
1106787340 13:33120683-33120705 AAGATGGCCAAAGGGAAAGATGG + Intronic
1107352300 13:39528505-39528527 CAGCTGGCCTCTGGGAGAGAGGG - Intronic
1108176370 13:47796931-47796953 AACCTGGCCGAGAGGAGAAATGG - Intergenic
1108910358 13:55542782-55542804 AAGCTGGCACAAAAGAGAGTTGG - Intergenic
1115886020 14:37972238-37972260 AAGCAGGGATAAAGTAGAGAAGG - Intronic
1117239116 14:53810766-53810788 AAGATGGCAGAAAGGAGTGAAGG + Intergenic
1118046794 14:61978771-61978793 AAGGTGGACTAAAGCAGTGAGGG - Intergenic
1119199645 14:72742981-72743003 AAGGTGTCCCAAAGCAGAGAGGG - Intronic
1120330740 14:83090322-83090344 CAGCAGGTCTAAAGGACAGAGGG + Intergenic
1121002477 14:90461861-90461883 ACACAGGCCCAAAGGAGAGATGG + Intergenic
1121906471 14:97750714-97750736 AAGGTGGCATGAAGGAGGGAAGG + Exonic
1125268507 15:37912488-37912510 TTGCTGGCCCAGAGGAGAGATGG - Intergenic
1127048771 15:55057478-55057500 AAGCAGGTCTGAGGGAGAGAAGG + Intergenic
1127600211 15:60528006-60528028 TAGGTGGTCTAAAGGAGAGTTGG - Intronic
1127798581 15:62458404-62458426 GAGCTGGGCTTAATGAGAGATGG + Intronic
1132240776 15:100255717-100255739 AAGCTGGGCAAAGGGAGAAAGGG + Intronic
1134482087 16:14629115-14629137 AGGCTGGGCGAAAGGAGAAATGG + Intronic
1136625409 16:31459116-31459138 AAGCGAGCCTAGAGGAGAAAAGG + Exonic
1137301270 16:47150197-47150219 AATCAGGCCCAATGGAGAGAAGG - Intergenic
1140208144 16:72950121-72950143 CAGAAAGCCTAAAGGAGAGAGGG + Intronic
1140708400 16:77653088-77653110 ATGCTGGTCTACAGGAGAGAAGG - Intergenic
1141351028 16:83297015-83297037 AAGATGGAATGAAGGAGAGAGGG + Intronic
1143445990 17:7009882-7009904 AAGGTGACCTGAGGGAGAGATGG + Exonic
1143452809 17:7046162-7046184 AGGCTGGCAAAAGGGAGAGAGGG - Intergenic
1143976226 17:10831899-10831921 AAACTGGCCTCCAGGGGAGAAGG - Intronic
1144887178 17:18471286-18471308 AGCCTGGCCAAAGGGAGAGATGG + Intergenic
1145145038 17:20473009-20473031 AGCCTGGCCAAAGGGAGAGATGG - Intergenic
1149526108 17:57357141-57357163 AGGCTGTCCTCAAGGAGAAACGG - Intronic
1150448575 17:65246558-65246580 AAGCTGGCCTTAGGGAGGGAAGG + Intergenic
1151046599 17:70927420-70927442 AATCAGGCCTAAAGGAAATAGGG - Intergenic
1153589887 18:6662325-6662347 AAGCTGTCGTGAAGGAGAAATGG + Intergenic
1153917870 18:9761747-9761769 AAGCAGGCAAAAGGGAGAGAGGG + Intronic
1153918004 18:9762809-9762831 GAGCTGGGCTAGAGGAGACATGG + Intronic
1154306240 18:13232867-13232889 AAGCTGGCAGCAGGGAGAGAAGG + Intronic
1155372039 18:25111995-25112017 AAGCTTCCCTAAAGGACAAAGGG + Intronic
1157596600 18:48867892-48867914 CAGCTGACCTGAAGCAGAGATGG + Intergenic
1158218496 18:55125897-55125919 ACACTGGCCAAAAGGACAGATGG - Intergenic
1158300488 18:56046766-56046788 AAGAGGGCCTAAATGAGAAAAGG - Intergenic
1158324807 18:56302466-56302488 AACCAGGCCACAAGGAGAGAGGG - Intergenic
1158886365 18:61830660-61830682 AGGCTGAACTAAAGGAAAGAGGG + Intronic
1159689983 18:71475882-71475904 TAGCTGCCCTGAAGGAGAGTTGG + Intergenic
1159737625 18:72120743-72120765 AAGCTGGCATACAGAAAAGATGG + Intergenic
1160606046 18:80050124-80050146 CAGCTGCCTTGAAGGAGAGAGGG + Intronic
1161372889 19:3923638-3923660 AAGATGGACTGATGGAGAGATGG + Intronic
1161492002 19:4567279-4567301 GCGCTGGCCTGGAGGAGAGAAGG - Intergenic
1163038385 19:14584840-14584862 AGGCTGGGCTATAGTAGAGAGGG - Intronic
1163039080 19:14589101-14589123 AGGCTGGGCTATAGTAGAGAGGG - Intronic
1163176703 19:15569290-15569312 GGGCTGGCTTGAAGGAGAGATGG + Intergenic
1163488390 19:17602978-17603000 AGGCTGGACTGGAGGAGAGACGG + Exonic
1164498980 19:28796415-28796437 AACCTAGCCTCAAGGAGAGGGGG + Intergenic
1164849856 19:31472484-31472506 AAGCAGGCTTACAGGACAGAAGG + Intergenic
1165380004 19:35472521-35472543 AAACTGGCCTGGAAGAGAGACGG - Intergenic
925636175 2:5943012-5943034 GGCCTGGCCTGAAGGAGAGATGG - Intergenic
925887249 2:8403546-8403568 AAGCTGGCCAAAAGAAGAAAAGG + Intergenic
926783434 2:16497018-16497040 AAGCTAGGCTAAAAGAGACAGGG + Intergenic
927388528 2:22564886-22564908 AAGCAGGCAGAAAGGAAAGATGG + Intergenic
929776529 2:44934060-44934082 GGGCTGGGCAAAAGGAGAGAGGG + Intergenic
932318423 2:70801955-70801977 AACCTCCCCTGAAGGAGAGAAGG + Intergenic
932642139 2:73459936-73459958 AAACAGGCCTACAGGGGAGAGGG - Intronic
932815637 2:74859167-74859189 AAGCTGGACTGATGGATAGAAGG - Intronic
934149646 2:89134113-89134135 AAGCTGTCCTCAGGGAGAGCTGG - Intergenic
934217649 2:90047915-90047937 AAGCTGTCCTCAGGGAGAGCTGG + Intergenic
934920716 2:98343059-98343081 AAGCTGACCTGAAAGAGACAGGG + Intronic
935653638 2:105403460-105403482 AAGCCCACCTACAGGAGAGACGG - Intronic
936733126 2:115407531-115407553 CTGCTGGCCTGAAGGAGAGAAGG + Intronic
940491558 2:154368563-154368585 AAGTTGACCTAATGCAGAGATGG + Intronic
941086829 2:161127672-161127694 GAGATGGCCAAAAAGAGAGATGG - Intergenic
941352039 2:164449117-164449139 AAGCTGGTCTAGGGGAGATAAGG - Intergenic
943788005 2:191900196-191900218 AAACTGTCCTAAAAGAGAAAGGG - Intergenic
944606864 2:201359684-201359706 AGGCTGGCATAACAGAGAGATGG - Intergenic
944744267 2:202639515-202639537 AAGTTGGGTAAAAGGAGAGAAGG - Intronic
947918424 2:233849425-233849447 AAGCTGCCCTATAGAAGTGAGGG + Intronic
948053207 2:234993338-234993360 AAGCCGTCATAAAGGACAGATGG - Intronic
1171146670 20:22790137-22790159 AAGCTTGCCCAAAGGATACAGGG + Intergenic
1172018710 20:31897526-31897548 AAGGGGGCCTAGAGGAGAGCTGG - Intronic
1172767249 20:37357340-37357362 AAGGTGGCCCAGAGAAGAGAAGG - Intronic
1176257450 20:64159678-64159700 AAGCTGGCCCAGAGGACAGCCGG + Intronic
1181134044 22:20751843-20751865 CAGCTGGCCTGAAGCAGATATGG - Intronic
1182321672 22:29481781-29481803 CAGCTTCCCTAAAGGAGAAAGGG - Intronic
1182933195 22:34194506-34194528 ATGCTGTCCTCAAGTAGAGAGGG - Intergenic
1184818150 22:46888013-46888035 AAGCTGACCTGAAAGAGAGCGGG - Intronic
1185002475 22:48254286-48254308 AGGCTGGCCAGAAGGAGTGAGGG + Intergenic
950630672 3:14279720-14279742 AGGCTGGCATGCAGGAGAGAGGG + Intergenic
951484390 3:23195626-23195648 AAGCTAGGTTAAAGCAGAGATGG + Intergenic
951781535 3:26368698-26368720 AAACTGCCCGAAAGGATAGAAGG - Intergenic
952124718 3:30286995-30287017 GAGATGGCCTTAAGGAAAGAGGG - Intergenic
953747687 3:45587592-45587614 AAGCTTTCCTAAAGGAAAGCTGG + Intronic
953818469 3:46183150-46183172 AAGATGGCATGAAGGAGAGCTGG - Intronic
956837032 3:73103922-73103944 AGGCTGGAGGAAAGGAGAGATGG - Intergenic
959866726 3:111279106-111279128 ATGCTGGCCTCACTGAGAGAAGG + Intergenic
959972729 3:112425121-112425143 AACGTGGCCTAGAAGAGAGATGG + Intergenic
960522128 3:118667354-118667376 AAGCTGGCCTAGCAGAGACACGG - Intergenic
960599849 3:119445710-119445732 AAGATGGACTAATGGATAGAGGG + Intronic
962855284 3:139339582-139339604 AATATGGCCCAAAAGAGAGAAGG - Intronic
963273954 3:143312422-143312444 AACCTGTCCCAGAGGAGAGAAGG + Intronic
963822084 3:149908697-149908719 AAGCTGATCTATAGGACAGAAGG + Intronic
967404483 3:189100276-189100298 AATTTGGCCTTCAGGAGAGAAGG - Intronic
969995096 4:11303821-11303843 AAGCTAGCAGAGAGGAGAGAAGG - Intergenic
970960945 4:21870620-21870642 AAGCTGCTCAAAGGGAGAGATGG - Intronic
972174187 4:36383010-36383032 AAGATAGCCTGATGGAGAGAAGG - Intergenic
972816616 4:42653187-42653209 AAGTTGGCATGAAGGAGATAAGG - Intronic
977483066 4:97603823-97603845 AAGCTGGCTGAAGGGAGAGATGG + Intronic
978367787 4:108000665-108000687 AAGTTTCACTAAAGGAGAGATGG + Intronic
978382015 4:108139001-108139023 AACCAGGCCTGAAGGAGAGTTGG + Intronic
979531302 4:121771645-121771667 AAGATGGTCGAGAGGAGAGAAGG + Intergenic
979609264 4:122672215-122672237 AAACTGGCCTTATGGAGAAAAGG - Intergenic
979864708 4:125739123-125739145 AAGCCTGATTAAAGGAGAGAGGG + Intergenic
982758229 4:159250383-159250405 TAGCTGGCCTAGGGGAGAAATGG + Intronic
983737383 4:171078874-171078896 AAGCTGGCAGAAAAGGGAGAAGG + Intergenic
985162780 4:187061744-187061766 CTTCTGTCCTAAAGGAGAGATGG - Intergenic
986834149 5:11616185-11616207 AAAATGGCCCAGAGGAGAGAAGG - Intronic
988516412 5:31908452-31908474 AAGATGGTCTGTAGGAGAGAGGG + Intronic
992569325 5:78038721-78038743 AAGCTGACCAGGAGGAGAGATGG + Intronic
993969619 5:94402382-94402404 AAGCTAGAACAAAGGAGAGATGG + Intronic
994992487 5:107015028-107015050 AAGCTGACATAGTGGAGAGAAGG - Intergenic
995478638 5:112573159-112573181 AAACTGGATTAAAGGAGGGAAGG - Intergenic
998074091 5:139222195-139222217 ACTCAGGCTTAAAGGAGAGAAGG + Intronic
1000277361 5:159750247-159750269 AAACTGGCCTAAAAGACAAAAGG + Intergenic
1002378165 5:178803754-178803776 CAGCCAGGCTAAAGGAGAGAGGG + Intergenic
1003258559 6:4495290-4495312 AATCTGTCTTAGAGGAGAGAAGG + Intergenic
1003887044 6:10531232-10531254 AACTTGGACCAAAGGAGAGATGG - Intronic
1006234230 6:32614520-32614542 GAGCTGGCATGCAGGAGAGAGGG - Intergenic
1007337212 6:41162422-41162444 AACCTGGGCAAGAGGAGAGACGG - Intronic
1007506269 6:42337631-42337653 AAGATGGCTTCAAGGAGACATGG + Intronic
1008229012 6:48960334-48960356 AAGGTAGCATAAAGGATAGAGGG + Intergenic
1009533985 6:64857277-64857299 AGGTTGGGCAAAAGGAGAGAGGG - Intronic
1009682046 6:66907921-66907943 ATTTAGGCCTAAAGGAGAGACGG + Intergenic
1011823669 6:91281499-91281521 GAGCTGGCTTAAAGAAGGGAGGG + Intergenic
1012198597 6:96376808-96376830 AAGCTGCCCAACAGCAGAGAGGG - Intergenic
1014480643 6:121932360-121932382 AATTTAGCCTAAAGAAGAGAAGG - Intergenic
1015707430 6:136103385-136103407 TATCTGGCCTAAAAGAGAGGAGG - Intronic
1016317595 6:142807803-142807825 AAGCTGCCATAAAGAACAGAAGG + Intronic
1017045393 6:150342819-150342841 TCGCTAGTCTAAAGGAGAGAGGG - Intergenic
1017926235 6:158913836-158913858 GAGCTGGCCCCAAGGAGACAGGG - Intergenic
1018626793 6:165787499-165787521 CTTCTGGCATAAAGGAGAGATGG - Intronic
1020521582 7:9194980-9195002 AGGCTGCGCTAAAGGAGAGTGGG - Intergenic
1021575217 7:22100223-22100245 CAGCTGGCCAGAGGGAGAGATGG + Intergenic
1024331513 7:48160016-48160038 AAGCTGTGCTAAAGGGGAGGTGG + Intergenic
1024537687 7:50451379-50451401 AAGGTGGCAGAATGGAGAGATGG - Intronic
1026617577 7:71919624-71919646 AAACTGGCCTAAGGGAGTCAGGG + Intronic
1027329681 7:77078538-77078560 TAGCTTGTCTAAAGGACAGAGGG - Intergenic
1029786081 7:102792800-102792822 TAGCTTGTCTAAAGGACAGAGGG + Intronic
1032044383 7:128591973-128591995 CAGCTGGCGTAAAGGAGAGCTGG + Intergenic
1032443769 7:131962448-131962470 AAGATGTCCTAATGCAGAGACGG - Intergenic
1033259134 7:139827093-139827115 ATGCTTGGCTAGAGGAGAGAGGG - Intronic
1033539258 7:142340863-142340885 AAGCTGGCAAAGAAGAGAGAAGG - Intergenic
1036830107 8:12014577-12014599 TGGCTGGCCAAAAGGAGAGGGGG - Intronic
1036899190 8:12658869-12658891 CAGCTGGCCAAAAGGGGAGGGGG - Intergenic
1038343339 8:26708201-26708223 AAGCAGGCAAAAATGAGAGATGG - Intergenic
1039252346 8:35680685-35680707 AAGCTGCCCTAAAGGAGTCTTGG - Intronic
1040860848 8:51998185-51998207 ATGCTTGACTAACGGAGAGAGGG - Intergenic
1040861398 8:52002818-52002840 AAGCTGGTCTAGAGGAGACAGGG - Intergenic
1042136583 8:65638494-65638516 AGGCTGGGCTACAGGAGAGCTGG - Intergenic
1044309584 8:90678301-90678323 AAGGTGGCCCAATAGAGAGAAGG + Intronic
1047667109 8:127104164-127104186 GAGCTGGTCTAAAGAAGAGGGGG + Intergenic
1051377083 9:16412958-16412980 GAGCTGGGCTGAAGCAGAGAGGG + Exonic
1051711604 9:19935916-19935938 AAGCTTCTCTAAAGGAAAGAAGG + Intergenic
1052980054 9:34441551-34441573 AAGCAGACCTAAAGGAGAGAGGG + Intronic
1055934713 9:81593947-81593969 AGGCTGGGCTAAAGGAGACCGGG - Intronic
1059527851 9:115008704-115008726 GAGCTGGCCTGATGGAGAAAAGG - Intergenic
1060300116 9:122370088-122370110 GAGCTGGCGAAAAGGAGAGCTGG + Intergenic
1060698458 9:125730218-125730240 AGGCTGGTCTCAAGGAGGGATGG - Intergenic
1061453702 9:130682279-130682301 AAGCTGGCCTAAAGGAGAGAAGG - Exonic
1062104871 9:134749766-134749788 CAGCTGGCCTAAAGTAGATGAGG - Intronic
1062209134 9:135353758-135353780 AAGGTGACCCAAAGGAGAGGGGG + Intergenic
1185644208 X:1605556-1605578 AAGCTGGGCGAGAGGAGAGAAGG - Intergenic
1186531452 X:10299873-10299895 AAACCAGCCTAGAGGAGAGATGG + Intergenic
1188028487 X:25236663-25236685 GAGAAGGCCTAAAGGAGAGATGG + Intergenic
1189582383 X:42420497-42420519 AAGCTGGCCCTAAGGCCAGAAGG - Intergenic
1190430429 X:50373269-50373291 AGGCTGTCCTAGAGGTGAGATGG - Intronic
1190480247 X:50870241-50870263 AAGCTGGCAGAAGGGAAAGAGGG + Intergenic
1191791581 X:64976975-64976997 AAGCTGGGGGAAAGGAGAGTGGG + Intronic
1192432796 X:71124093-71124115 AAGGTGGGCCAAAAGAGAGAGGG - Intronic
1195012306 X:100744627-100744649 AAGCAGCCCAAAAGGATAGAGGG - Intergenic
1195138104 X:101931523-101931545 AAGATGGACTGAAGCAGAGAGGG - Intronic
1196761655 X:119206103-119206125 AATCTGCCTTAAAGGAGAGAGGG + Intergenic
1198003624 X:132467752-132467774 AAAATGGCCTAAAAGAGCGATGG - Intronic
1199573356 X:149289831-149289853 AGGCTAGCCTAAAGGAGTTATGG - Intergenic