ID: 1061455909

View in Genome Browser
Species Human (GRCh38)
Location 9:130697591-130697613
Sequence TGAAGTAGGAGACATCGTAG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 96}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061455905_1061455909 7 Left 1061455905 9:130697561-130697583 CCCTTGTGTTTTGTCTTTCAGAT 0: 1
1: 0
2: 8
3: 67
4: 712
Right 1061455909 9:130697591-130697613 TGAAGTAGGAGACATCGTAGTGG 0: 1
1: 0
2: 0
3: 6
4: 96
1061455904_1061455909 8 Left 1061455904 9:130697560-130697582 CCCCTTGTGTTTTGTCTTTCAGA 0: 1
1: 1
2: 2
3: 57
4: 477
Right 1061455909 9:130697591-130697613 TGAAGTAGGAGACATCGTAGTGG 0: 1
1: 0
2: 0
3: 6
4: 96
1061455906_1061455909 6 Left 1061455906 9:130697562-130697584 CCTTGTGTTTTGTCTTTCAGATA 0: 1
1: 0
2: 0
3: 37
4: 428
Right 1061455909 9:130697591-130697613 TGAAGTAGGAGACATCGTAGTGG 0: 1
1: 0
2: 0
3: 6
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061455909 Original CRISPR TGAAGTAGGAGACATCGTAG TGG Exonic
908047021 1:60181994-60182016 TGAACTTGGAGACATAGTAATGG - Intergenic
910725772 1:90337089-90337111 TTAAGTAGGTGACATGGTATGGG - Intergenic
910854338 1:91679859-91679881 TGAAGAAAGAGACATTTTAGAGG + Intergenic
911280539 1:95922000-95922022 TGATGTAGTAGACATCGAAAAGG + Intergenic
912370249 1:109168158-109168180 TTAAGTAGGAGACATAGAAGAGG - Intronic
915549635 1:156624746-156624768 TGAAGCAGAAGGCGTCGTAGCGG - Exonic
917276807 1:173339987-173340009 TGAATTAGTAGACATAGTAAAGG + Intergenic
920357414 1:205384805-205384827 AGAAGTAGGAGCAATTGTAGGGG + Intronic
920869118 1:209778778-209778800 TGAAGATAGAGACATGGTAGGGG + Intronic
921685796 1:218087905-218087927 GGAACTTGGAGACATCATAGGGG + Intergenic
921831492 1:219732695-219732717 TGAAGTTTGAGACACCCTAGGGG + Intronic
923361170 1:233212609-233212631 TGAACTAGGAGATAGCGGAGTGG - Intronic
924635661 1:245785231-245785253 TGGAGGAGGAGATATTGTAGTGG + Intronic
1063497203 10:6520842-6520864 TCAAGTAGGCGACATCCTGGTGG - Intronic
1067715344 10:48686012-48686034 TGGAGGAGGAGACCTCGTGGAGG + Intronic
1071683749 10:87733848-87733870 TAAGATAGGAGACATAGTAGGGG - Intronic
1071734323 10:88281444-88281466 TGGAGTGGGAGACAGAGTAGAGG - Intronic
1074019998 10:109572702-109572724 TGAAGGAGGAGAGATAGGAGTGG + Intergenic
1075677142 10:124303569-124303591 TGAAGGAGGAGGCACTGTAGAGG - Intergenic
1076311894 10:129514511-129514533 TGAACTAGGAGAAATTATAGTGG - Intronic
1078014986 11:7605337-7605359 AGAAGAGGGAGACATGGTAGGGG + Intronic
1091392735 12:135733-135755 TGAAGCAGGCCACATGGTAGGGG + Intronic
1101271004 12:103144478-103144500 TGAAAAATGAGATATCGTAGAGG + Intergenic
1102386613 12:112515519-112515541 TGAGGTAGGAGGCATGGAAGAGG - Intergenic
1105733240 13:23241271-23241293 TGAAAAAGGAGACATCATAATGG + Intronic
1106948688 13:34858361-34858383 TGAAGAAGGAGGCATCCTACAGG + Intergenic
1107577171 13:41738472-41738494 AGTAGTAGGAGACGTGGTAGAGG - Intronic
1109608419 13:64730573-64730595 TGGAGTAGGAGAAATAGTGGGGG - Intergenic
1110378758 13:74825114-74825136 AGAAGTGGGAGACATAGCAGAGG + Intergenic
1113425190 13:110201640-110201662 TGAAGTAGCAGCAATGGTAGCGG + Intronic
1114224776 14:20727405-20727427 TAAAGTAGGAGGCATCTTATGGG + Intergenic
1114822703 14:26040861-26040883 TGAGGTTGGAGTCTTCGTAGTGG + Intergenic
1118548614 14:66923081-66923103 TCAAGAAGGAAACATAGTAGTGG - Intronic
1125890906 15:43266651-43266673 AGAACCAGGAGACAGCGTAGAGG - Intronic
1130910596 15:88268250-88268272 TGAAGTAGGAGACAGTGAAGTGG + Intergenic
1132789033 16:1674778-1674800 AGAATTAGGAGACATGGAAGAGG + Exonic
1133502629 16:6380101-6380123 TGAGGTAGGAGGCATCTGAGAGG + Intronic
1143703429 17:8679312-8679334 GGAAGGAGGAGACATTGTTGAGG + Intergenic
1144166494 17:12616452-12616474 TGAAGGAGGAGATATGGTGGCGG - Intergenic
1148398032 17:47325546-47325568 TGAAGCAGGAGAGATCAGAGAGG - Intronic
1148461087 17:47839393-47839415 GGAAGTGGGAGAGATGGTAGGGG - Intronic
1150555182 17:66247993-66248015 TGAAGTTGCTGACATCATAGTGG + Intronic
1154977139 18:21469898-21469920 TGAAGTAGAAAACATGGGAGAGG - Intronic
1158067415 18:53427275-53427297 TGAAGTAACAGTCATCCTAGGGG - Intronic
1164441281 19:28282441-28282463 TGGAGAAGAAGACATCGTGGGGG - Intergenic
925864166 2:8211470-8211492 TGGAGTAGGAGACACAGAAGTGG - Intergenic
926350082 2:11986278-11986300 AGAAATAGGAGACACCTTAGAGG - Intergenic
927441331 2:23119997-23120019 TAAAGTTGGAGACATGGTGGGGG - Intergenic
929279485 2:40062234-40062256 TTTAGTAGGAGACATGGCAGGGG + Intergenic
933385538 2:81606258-81606280 TGAAGTAGAAAACATGGGAGAGG - Intergenic
933665247 2:84959576-84959598 TGAAGAAGGAGACAGTGTATGGG - Intergenic
937631478 2:124106814-124106836 TGAAGCTGGAGCCATCGTATGGG + Intronic
939848124 2:147272334-147272356 TGAAGTAGAAGACATTGGAGAGG - Intergenic
942133936 2:172906883-172906905 TGAAGGAGGAGACATTATAGAGG - Intronic
945932391 2:215867965-215867987 TGAAGCAGGAGCCATCTCAGAGG + Intergenic
948003035 2:234583748-234583770 TGGAGTAGGAGGCATCTTTGAGG + Intergenic
948940264 2:241191756-241191778 TTAAGTAGTAGCCATCCTAGTGG - Intronic
1170414143 20:16122166-16122188 TGAAGTAGGTGACCTCAGAGGGG + Intergenic
1173022579 20:39279340-39279362 TGAAGTTGTAGAAATAGTAGGGG + Intergenic
1181308107 22:21928296-21928318 TGCAGGTGGAGACATCGCAGAGG - Intronic
952131900 3:30373608-30373630 TGGAGTTGGTGACATCGAAGTGG + Intergenic
953086312 3:39671458-39671480 TGAAGGAGGAGAATGCGTAGAGG + Intergenic
953886289 3:46716042-46716064 TGAAGTAGGGGACATGGTGAGGG - Intronic
957026638 3:75189867-75189889 AGAAGAAGGAGACATAGTAAAGG + Intergenic
957348897 3:78997524-78997546 TGAAGCAGGAGACACTGTATTGG + Intronic
960008260 3:112804361-112804383 AGAGGAAGGAGACATAGTAGTGG - Intronic
960284542 3:115812465-115812487 GGGAGTAGGAGACATAGAAGTGG - Intronic
967949753 3:194831739-194831761 TGAAACAGGAGACATAGGAGGGG + Intergenic
968028832 3:195465649-195465671 GGAAGTAGGAGACAGCCTTGTGG + Intergenic
970072440 4:12176661-12176683 TGAAGTAAGAGATATTTTAGAGG + Intergenic
973928656 4:55766546-55766568 TGAAGAAGGTGACTTCATAGGGG - Intergenic
974931103 4:68361978-68362000 AGAAGTAGTAGATATTGTAGTGG + Intergenic
975431406 4:74295703-74295725 TGAAGGAGGTGACATGGAAGAGG - Intronic
977459903 4:97312153-97312175 TGAAGTGGGAGACATTCTTGTGG - Intronic
983151637 4:164289967-164289989 TGAAGTAGGAGAAGCCTTAGGGG - Intronic
990101059 5:52187845-52187867 TGAAGGGGTAGACATCGTTGGGG - Intergenic
992063023 5:73075836-73075858 TGAAGTTTAAGACATCTTAGTGG + Intronic
996595862 5:125201992-125202014 TGCAGTAGGAGACAAAGAAGGGG - Intergenic
997377453 5:133407274-133407296 TGAAGATGGAAACATCATAGTGG - Intronic
1001600553 5:172925590-172925612 GGAAGGAGGAGACATCGGAGAGG - Intronic
1005263870 6:24090770-24090792 TGGAGTAGGGGACATGGTATTGG + Intergenic
1011899999 6:92281633-92281655 TGAAGTAGGAGTCATAGCATTGG + Intergenic
1012417897 6:99029756-99029778 TGAAGTAAGAGACTTAATAGGGG + Intergenic
1014401841 6:120999517-120999539 TGAAGTAGGAGTTATCCAAGTGG + Intergenic
1015418293 6:132975713-132975735 TGAAGGAGCAGACATCTGAGAGG - Intergenic
1017612081 6:156198024-156198046 AGAAGTAGGAAACATCTTAGTGG + Intergenic
1027146109 7:75695929-75695951 TGAACTGGGAGACATCATACTGG - Intronic
1028512249 7:91638247-91638269 TGAAGTTGTAGACATCCCAGTGG - Intergenic
1030551415 7:110965664-110965686 TAAAATAGGAGACATGGGAGGGG - Intronic
1033652362 7:143352680-143352702 TGAAGCAGGGGACAACGGAGGGG - Intergenic
1034551007 7:151820653-151820675 TGAAGTTGGAGACCACGGAGCGG - Intronic
1034686206 7:152973499-152973521 TGAAGTTGGAGAAATAGAAGAGG + Intergenic
1037740963 8:21608908-21608930 TGAAGCAGGAGACACAGTAAGGG + Intergenic
1037899878 8:22681716-22681738 TGAAGTCGGAGAGATAGTATGGG - Intergenic
1040588742 8:48769508-48769530 TGAAATAGGAGGCATGGTTGTGG + Intergenic
1041635028 8:60133295-60133317 TGAAGAAGGAGAGACTGTAGAGG + Intergenic
1045221200 8:100202033-100202055 TGGAGTAGGAGACAGCCTTGGGG + Intronic
1048248788 8:132839895-132839917 TGAAGGAGGACACAACGTATAGG - Intronic
1048605162 8:135960600-135960622 TGAGGAAGGAGCCAACGTAGCGG + Intergenic
1052904032 9:33817910-33817932 TGAAGTAGCCGCCTTCGTAGAGG - Exonic
1059701227 9:116776966-116776988 GGATGAAGGAGACATCGTAAAGG + Intronic
1061455909 9:130697591-130697613 TGAAGTAGGAGACATCGTAGTGG + Exonic
1200832737 Y:7703540-7703562 TGAAGAAGGACACATCATTGGGG + Intergenic