ID: 1061459764

View in Genome Browser
Species Human (GRCh38)
Location 9:130727836-130727858
Sequence GTGGGATTACTTTGGTTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 137}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061459764_1061459768 22 Left 1061459764 9:130727836-130727858 CCAGAGAACCAAAGTAATCCCAC 0: 1
1: 0
2: 0
3: 10
4: 137
Right 1061459768 9:130727881-130727903 AAATAAAAACAAATTAAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061459764 Original CRISPR GTGGGATTACTTTGGTTCTC TGG (reversed) Intronic
901585475 1:10287216-10287238 GTGGGCTCACTTAGCTTCTCTGG + Intronic
904310027 1:29622958-29622980 ATGGGATCCCTCTGGTTCTCAGG + Intergenic
907411451 1:54286618-54286640 GTGGGATTGCTGAGGATCTCTGG - Intronic
908003729 1:59707410-59707432 GAGGGATGACTGTGTTTCTCAGG + Intronic
909146619 1:71941990-71942012 TTGATATTACTTTGGTTCTAAGG - Intronic
909246379 1:73290330-73290352 TTGGGATTACTTTGGGACGCAGG + Intergenic
912078878 1:105911419-105911441 CTGGGACTGCTTTGGTCCTCAGG + Intergenic
918021413 1:180695891-180695913 TTGGGATTGCTTTGGTTATTCGG + Intronic
918098199 1:181351417-181351439 GTGGCAGAACTTTGGTTTTCCGG + Intergenic
918100794 1:181372056-181372078 TTGGGATTACTTTGGGTATTTGG + Intergenic
919838589 1:201593289-201593311 GTGGGGCTACTTGGGTCCTCGGG + Intergenic
920123470 1:203675834-203675856 GTGGGCTTTCCTTGGGTCTCTGG + Intronic
921635400 1:217486756-217486778 GTGTGATGACTGTGGTTTTCCGG - Intronic
1069278565 10:66624688-66624710 GTTGGCTTACTTTAGTTCACAGG + Intronic
1073658756 10:105448553-105448575 CTGGGATTGCTTTGGCTATCTGG + Intergenic
1078593530 11:12666488-12666510 CTAGGATTACCTTGGTTCTTTGG + Intergenic
1080318322 11:30975891-30975913 TTGGGATTGCTTTGGTTATTTGG - Intronic
1080683923 11:34500075-34500097 TTGGGAATACATTTGTTCTCAGG + Intronic
1088226168 11:107622566-107622588 GAGAGGTTACTTTGCTTCTCTGG - Intronic
1088565081 11:111162860-111162882 GTGAGTTTATTTTGGTTCACTGG + Intergenic
1088670575 11:112136338-112136360 CTGGGAAAACTTTGGTTCTATGG + Intronic
1090246270 11:125218114-125218136 GTGGGAGGGCTTTGGTTCTGAGG + Intronic
1091096707 11:132829731-132829753 GGGGGTTTGCTTTGGTTTTCTGG + Intronic
1093464330 12:19434612-19434634 GGGGAATGACTTTGGTCCTCAGG + Intronic
1094440434 12:30470087-30470109 TTGGGATTGCTTTGGTACTTGGG + Intergenic
1097108564 12:56640522-56640544 GTAAAATTACTTTGGTTCGCTGG - Intronic
1097156417 12:57015540-57015562 TTTGGATTTCTTTGTTTCTCTGG - Intronic
1097634372 12:62104598-62104620 GTGAGATTTCTTTCATTCTCTGG - Intronic
1098400482 12:70069946-70069968 GTGAGATTTTTTTGGTTTTCAGG + Intergenic
1105469092 13:20675455-20675477 CTGAGACTACTTTGGTGCTCTGG - Intronic
1111348668 13:86997352-86997374 CTGGGATTTCTTTGGTTGGCAGG - Intergenic
1115497499 14:34021084-34021106 GTGGGATTTTGTTGCTTCTCTGG - Intronic
1122657236 14:103270248-103270270 GTGGGAGTACTTTGGGTTTTGGG + Intergenic
1124191062 15:27576633-27576655 GTGGCTTTTCTTTGGTCCTCAGG - Intergenic
1124473196 15:30007293-30007315 GTGGCATTGCTTTGGGTGTCAGG + Intergenic
1124662366 15:31560746-31560768 GTGGGATTCCTTGGGACCTCAGG - Intronic
1126549686 15:49913746-49913768 ATGGGATTGCTTTCTTTCTCAGG - Intronic
1127743847 15:61943299-61943321 TTGGGATTGCTTTGGTTATTTGG - Intronic
1128995570 15:72291944-72291966 GTGGGTGTACTTTGCTTCTGGGG + Intronic
1129811263 15:78512145-78512167 CAGGGTTTTCTTTGGTTCTCTGG + Intronic
1137069247 16:35885971-35885993 ATGGGATTACTATGGTTATTCGG - Intergenic
1138348714 16:56335241-56335263 CTGGGATTACTTGGGTCCTCAGG - Intronic
1138850417 16:60622406-60622428 GTGGGATTGTGTTGTTTCTCTGG - Intergenic
1141531852 16:84651704-84651726 GTGGGAGAAAATTGGTTCTCGGG + Intronic
1144331606 17:14229186-14229208 TTGGTATTACTTTGTTTATCTGG - Intergenic
1144540986 17:16142890-16142912 GTGGCATTACTTTGTTTTTCAGG - Intronic
1155444028 18:25891903-25891925 GTGGGTTTACTTTCTTTCTTGGG - Intergenic
1156926870 18:42592394-42592416 TTGGGATTACTTTGGCTATTTGG + Intergenic
1157113596 18:44843244-44843266 GTGGGATGACTGTGGCCCTCAGG - Intronic
1157302112 18:46486545-46486567 CTGGGATGGCTTTGGGTCTCTGG - Intronic
1159269256 18:66127877-66127899 GCAGGATCACTTTAGTTCTCTGG + Intergenic
1159391830 18:67803270-67803292 GTGGGATTAGGTAGCTTCTCAGG - Intergenic
1164499377 19:28802577-28802599 TTGGGATTGCTTTGGTTCTTGGG - Intergenic
1164664947 19:30022930-30022952 TTAGGATTACTTTGGTTATTTGG + Intergenic
926532726 2:14070701-14070723 GTGTGATTATATTTGTTCTCTGG + Intergenic
928412299 2:31064449-31064471 GTGGAGTTCCTTTGGTTTTCGGG - Intronic
929272886 2:39992887-39992909 AAGGGATTAATTTGGTTCCCAGG - Intergenic
931534106 2:63252944-63252966 TTAGGATTGCTTTGGTTATCTGG - Intronic
933295718 2:80488713-80488735 GTGGGATTTATTTAGTTATCTGG - Intronic
933439423 2:82292739-82292761 TTGGGATTACCTTGGCTCTTTGG + Intergenic
940132766 2:150402636-150402658 CTGAGATTATTTTGGTCCTCTGG - Intergenic
941565780 2:167104555-167104577 GTGGCATTTCTTTGTTTCTTAGG + Intronic
942178860 2:173360666-173360688 GTGGGCTCACTTTGTTGCTCAGG + Intronic
944949004 2:204725771-204725793 GGGGCATTGCTTTGGTTTTCTGG - Intronic
948121171 2:235531576-235531598 TTGGGACACCTTTGGTTCTCTGG + Intronic
948270166 2:236667885-236667907 TTTGGATCACTTTGGTTGTCAGG + Intergenic
948510994 2:238465236-238465258 GTGGGAATACATTGGAACTCAGG - Intergenic
1170321867 20:15109005-15109027 GTGGGATTCCTTTGGCCCACAGG - Intronic
1171094790 20:22321409-22321431 GTGGGATTACTATCTTTCCCTGG + Intergenic
1173385812 20:42587028-42587050 ATGGGATTTCCTTGGCTCTCAGG - Intronic
1173459624 20:43232780-43232802 GTGGGCTGACTTTGCTTCTAGGG - Intergenic
1176667056 21:9697337-9697359 TTGGGATTAATTTGGTTCTAGGG + Intergenic
1177621254 21:23597639-23597661 TTGGGATTACATTGATTCTATGG - Intergenic
1179798816 21:43800939-43800961 GTGGGAGTGGTTTGGTTCTAGGG + Intronic
1184182199 22:42837268-42837290 GTGGTCTCACTTTGGTTCCCAGG - Intronic
954937539 3:54340694-54340716 TTTGGATTTCTGTGGTTCTCTGG + Intronic
955621830 3:60872745-60872767 GATGTATTACTTGGGTTCTCAGG - Intronic
956519802 3:70091389-70091411 GTGGGATTTGTGTGGTTTTCAGG + Intergenic
957445095 3:80306843-80306865 GTGGGATTAATGTGGTTGTTTGG - Intergenic
960077606 3:113505514-113505536 TAGGGATTAGTTTGGATCTCAGG - Intronic
961403693 3:126664463-126664485 GTGGGTCTCCTTTGGTCCTCTGG + Intergenic
962998821 3:140656813-140656835 ATAGGACTACTTTGGTTTTCTGG - Intergenic
963830093 3:149998048-149998070 TTAGGATTGCTTTGGTTTTCTGG - Intronic
964678896 3:159316114-159316136 GTAGGATTTCTTTGGTTCTTTGG + Intronic
966499384 3:180621889-180621911 TTAGGATTACTTTGGTTATTTGG + Intronic
968879468 4:3291927-3291949 GTGTGATTAGTTTGGATCCCAGG - Intergenic
970190174 4:13508551-13508573 GTGGGAGGACTTTGGATCACGGG + Intergenic
972824484 4:42741166-42741188 TTAGGATTGCTTTGGTTCTTTGG - Intergenic
973540536 4:51930876-51930898 GTGGGATTATTCTGGTGCACTGG + Intergenic
974261067 4:59524396-59524418 TTGGGATTACTTTGGCTTTGGGG + Intergenic
977932303 4:102761804-102761826 GTGGTATTTCTTGGGTACTCTGG - Intergenic
978182187 4:105812280-105812302 CTGTGATTACTTTGGTTATTTGG + Intronic
980704007 4:136468735-136468757 TTGGAATTACTTTGGCTCTTTGG + Intergenic
981917192 4:150047427-150047449 GTGTGACTGCTTTGGTGCTCAGG + Intergenic
983762345 4:171426520-171426542 GTGGGAGTACTTTGCTTATAAGG - Intergenic
983827708 4:172284904-172284926 TTAGGATTACTTTGGTTATTTGG + Intronic
985407957 4:189655000-189655022 TTGGGATTAATTTGGTTCTAGGG - Intergenic
986197388 5:5550584-5550606 GTGGGATGAATTTGGTTTACTGG + Intergenic
988918408 5:35919198-35919220 GTGAAATTAGTTTGGATCTCAGG + Intronic
990528542 5:56652037-56652059 CTGGGATGACTTTCCTTCTCAGG - Intergenic
992162543 5:74016885-74016907 ATGGGATTCTTTTGTTTCTCTGG + Intergenic
993974587 5:94461883-94461905 GTGGAATTACTTTTGATTTCTGG - Intronic
994750488 5:103731599-103731621 GAGGGAGTAGTTTGGTTGTCTGG + Intergenic
995452740 5:112320577-112320599 GTGGGATAACTTAAGTTCCCAGG - Intronic
999916240 5:156265183-156265205 GTGGGATTTCTTTACTTCTTTGG + Intronic
1000417750 5:161000805-161000827 TCAGGATTACTTTGGCTCTCTGG + Intergenic
1000979941 5:167805963-167805985 GTGAGAATACTTTGGGTTTCAGG + Intronic
1005145043 6:22679897-22679919 GTGTGGATACTTTGGTTCCCTGG - Intergenic
1011360761 6:86522021-86522043 TTAGGATTACTTTGGTTATTTGG + Intergenic
1014143941 6:117974738-117974760 ATGGGCTTACTTTTGTTCTTTGG - Intronic
1016466697 6:144332539-144332561 GTGGGAGTATTTTGGATCTTTGG + Intronic
1017676683 6:156821442-156821464 TTGGTATTACTTTGGTCCTTTGG - Intronic
1020949325 7:14654941-14654963 GGGGGATTTCTTTGGGACTCTGG + Intronic
1022544985 7:31178080-31178102 GATGGATTACTTTGGGTCTCAGG - Intergenic
1027500811 7:78948461-78948483 CTGAGATTACTTTGGTTCACTGG + Intronic
1027685225 7:81272147-81272169 GTGGCATTGCTTTGGTTCCAAGG + Intergenic
1028184774 7:87769382-87769404 GTGTGATTACTTTTGTACTAGGG + Intronic
1029030693 7:97463488-97463510 GTGAGATTACATTTGTTTTCTGG + Intergenic
1030192986 7:106828078-106828100 GAGGGATTAGTTTGGTTCTAGGG + Intergenic
1039327612 8:36502493-36502515 GTGGGATTTCGTGTGTTCTCAGG + Intergenic
1039418187 8:37413673-37413695 GTGGGAGGTGTTTGGTTCTCGGG + Intergenic
1040101244 8:43508486-43508508 ATTGGCTTACTTTTGTTCTCAGG + Intergenic
1041412388 8:57571178-57571200 GTGAAATTACTTTGGATCTAGGG - Intergenic
1042539414 8:69893059-69893081 CATGGATTACTTTCGTTCTCTGG - Intergenic
1043495893 8:80799543-80799565 GTAGGATTACTGTGGTTTGCTGG - Intronic
1044176117 8:89124993-89125015 ATGGAATTAGTTTGGTTCTGAGG + Intergenic
1044384955 8:91577190-91577212 GTGGGATGGATTTGGTTCACAGG - Intergenic
1046448819 8:114360078-114360100 GTGAGATTATTTTGTTTCACAGG - Intergenic
1051318437 9:15870131-15870153 GTGGGCTGGATTTGGTTCTCAGG + Intronic
1052793812 9:32903598-32903620 GTGGGATTGGTTTCGTTCTGAGG + Intergenic
1055829642 9:80362853-80362875 TTCAGATTACTTTTGTTCTCAGG - Intergenic
1059077893 9:111214143-111214165 TTAGGATTACTTTGGTTATTCGG + Intergenic
1059843710 9:118247242-118247264 GTGGTTTTATTTTGTTTCTCTGG + Intergenic
1060103802 9:120861318-120861340 CTGGGATGACTTTGGCTCCCTGG - Intronic
1060503603 9:124181290-124181312 GTGGGATCACTCTGGTTTACTGG + Intergenic
1061459764 9:130727836-130727858 GTGGGATTACTTTGGTTCTCTGG - Intronic
1203659040 Un_KI270753v1:24425-24447 TTGGGATTAATTTGGTTCTAGGG - Intergenic
1186373548 X:8971641-8971663 GTGAGAGTTCTTAGGTTCTCAGG + Intergenic
1186947796 X:14588541-14588563 TTAGGATTGCTTTGGTTATCTGG + Intronic
1187325579 X:18283967-18283989 GTAGGATTGCTTTGGTTATTTGG - Intronic
1187346994 X:18474532-18474554 CTGTGTTTACTTTGGTCCTCAGG - Intronic
1192388533 X:70699419-70699441 GTGGGATTTCGTTGGGTCTTTGG - Intronic
1193225139 X:78973548-78973570 CAGGGCTTACTTTGGTTGTCAGG + Intergenic
1194029015 X:88789112-88789134 GTAGGATTGCTGTGGTTTTCTGG + Intergenic
1194834493 X:98664907-98664929 GTGGATTTACTTTCTTTCTCAGG + Intergenic
1194880446 X:99244259-99244281 TTAGGATTACTTTGGTTATTGGG + Intergenic
1197368952 X:125601698-125601720 TTAGGATTACTTTGGTTATTTGG + Intergenic
1198325805 X:135571461-135571483 GTGGAGTCACTTTGGTTCTTTGG - Intronic