ID: 1061461272

View in Genome Browser
Species Human (GRCh38)
Location 9:130741293-130741315
Sequence CCATGCCGGAGTAACAGTTA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061461262_1061461272 23 Left 1061461262 9:130741247-130741269 CCACAGCAGACCCATGGTCGAGG 0: 1
1: 0
2: 3
3: 12
4: 124
Right 1061461272 9:130741293-130741315 CCATGCCGGAGTAACAGTTACGG No data
1061461267_1061461272 12 Left 1061461267 9:130741258-130741280 CCATGGTCGAGGGAGAGGAGCAG 0: 1
1: 0
2: 2
3: 13
4: 239
Right 1061461272 9:130741293-130741315 CCATGCCGGAGTAACAGTTACGG No data
1061461266_1061461272 13 Left 1061461266 9:130741257-130741279 CCCATGGTCGAGGGAGAGGAGCA 0: 1
1: 0
2: 0
3: 9
4: 149
Right 1061461272 9:130741293-130741315 CCATGCCGGAGTAACAGTTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061461272 Original CRISPR CCATGCCGGAGTAACAGTTA CGG Intronic
No off target data available for this crispr