ID: 1061471763

View in Genome Browser
Species Human (GRCh38)
Location 9:130832496-130832518
Sequence CAGCCAGGAGGTAGGAAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 551
Summary {0: 1, 1: 1, 2: 1, 3: 55, 4: 493}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061471763 Original CRISPR CAGCCAGGAGGTAGGAAGGT AGG (reversed) Intronic
900104182 1:975336-975358 CAGAGATGAGGTGGGAAGGTCGG - Exonic
900137193 1:1122590-1122612 TCGCCAGCAGGTAGGAAGGGGGG - Intergenic
900644130 1:3701317-3701339 CAGCCAGGAGGAACGACGGCTGG - Intronic
901012810 1:6210807-6210829 CAGCCAGGGGGCAGGAAGAGGGG - Intronic
901879577 1:12185904-12185926 GAGCCATGAGGGAGGAAGGTGGG + Intronic
902322178 1:15675751-15675773 CAGGCAGTAGGTAGGTAGGTAGG - Intergenic
902690801 1:18109217-18109239 AAGCCAGGAGGGAGGGAGGCGGG + Intronic
903190032 1:21651220-21651242 GAGCCAGGATGCAGGAAGGAGGG + Intronic
903539856 1:24090792-24090814 CAGCCCGGAGGAAGACAGGTGGG - Exonic
903855985 1:26337770-26337792 CAGCAAGGAGGTGGGAGGGCTGG - Intronic
904371433 1:30049974-30049996 TGGCCTGGAGGTAGGAAGGGAGG - Intergenic
904411923 1:30329808-30329830 CAGCCAGGAGGTAGCCGGGCAGG + Intergenic
904755238 1:32765330-32765352 CAGCCAGGAGGCTTGCAGGTGGG + Intronic
904819447 1:33232003-33232025 CAGCCAGGAAGAAGGAGGGATGG - Intergenic
904876037 1:33655160-33655182 CAGCCAAGAAGTGGGCAGGTTGG + Intronic
905343906 1:37298547-37298569 CAGGCCAGAGGTAGCAAGGTAGG + Intergenic
905960856 1:42041098-42041120 CAGCCAGGAGGAAGTTAGGTCGG + Intergenic
906580123 1:46929291-46929313 CAGGCAGGAGTTTGGGAGGTGGG + Exonic
906603605 1:47149602-47149624 CAGGCAGGAGTTTGGGAGGTGGG - Exonic
907243804 1:53094678-53094700 CAGCCAGGCGGCAGGAAGACAGG - Intronic
907329116 1:53659945-53659967 CAGCCAGGAGGGAGCAGGGCAGG - Intronic
907395481 1:54186754-54186776 CAGACGGCAGGTAGGAAGGCGGG + Intronic
907408053 1:54265815-54265837 CTGCTAGGAGGAAGGGAGGTCGG - Intronic
907603613 1:55794210-55794232 CAGCAAGGATGTAGGGAGGAAGG - Intergenic
908324252 1:63007648-63007670 CTGCCAGGAGGGAGGAAGAAGGG + Intergenic
908798497 1:67854871-67854893 TGGGCAGGAGGTAGGAAGGGGGG - Intergenic
908840979 1:68279867-68279889 GAGACAGGAGATAGGAGGGTAGG - Intergenic
909533346 1:76706208-76706230 AAGAAAGGAGGGAGGAAGGTGGG - Intergenic
909980920 1:82099777-82099799 CAGCCAAGAGGTGGAAAGCTTGG + Intergenic
909984628 1:82145504-82145526 CAGCCAGGCTGTAGCAAAGTGGG - Intergenic
911050505 1:93666949-93666971 CTTCCAGGAGGAAGGAAGGAAGG + Intronic
911202632 1:95061087-95061109 AAGCCAGGAGGAAGCAAGGAGGG + Intronic
912457196 1:109806129-109806151 CATCCAGGAGTTGGGAGGGTGGG - Intergenic
912554853 1:110508494-110508516 CAGCCTGCAGGGAGGAAGGCAGG + Intergenic
913111871 1:115664280-115664302 CATCCAGGAGGCAGAAAGGATGG + Intronic
913156133 1:116100459-116100481 CAGGGAGGAGGCAGGAAGGATGG - Intergenic
913228621 1:116722124-116722146 AGGCCAGGAGGTAGACAGGTAGG + Intergenic
913330451 1:117662964-117662986 CAGCCAGGATGCAGGAAGCAGGG - Intergenic
914407593 1:147391465-147391487 CAGTCGGGAGGTAAGAAGGGAGG + Intergenic
915492552 1:156259240-156259262 CAGCAGGGAGGTGGGAGGGTGGG - Intronic
915556370 1:156663135-156663157 CAGGGAGGAGGGAGGAAAGTAGG + Intergenic
915645701 1:157270412-157270434 GTCCCAGGAGCTAGGAAGGTTGG - Intergenic
915724275 1:158006815-158006837 AAGCCAGCATGTAGGAAAGTGGG + Intronic
918148652 1:181780029-181780051 CATCCAGGAGCTGGGAGGGTGGG - Intronic
919463054 1:197901887-197901909 CAGACGGGGGGTAGGAAGATGGG + Intergenic
919817859 1:201452948-201452970 ATGCCCTGAGGTAGGAAGGTAGG + Intergenic
919940402 1:202282154-202282176 CAGCCTGGAGGCAGGAAAATTGG + Intronic
920116143 1:203623291-203623313 CAGACAGGAGGGAGGGATGTCGG - Intergenic
920792986 1:209110432-209110454 CTGCCAGGAGGTTGGGTGGTGGG - Intergenic
921964091 1:221069372-221069394 CAGCAAGGAGGTGGAAAGCTAGG - Intergenic
922728825 1:227939647-227939669 CTGGCAGGAGGCAGGAAGGTCGG - Intronic
924374347 1:243389794-243389816 CATCCAGGAGGGAGGAGAGTAGG + Intronic
924661458 1:246022390-246022412 CAGCGAGGGGGTAAGAACGTGGG + Intronic
924736432 1:246761132-246761154 CAGAGAGGAGGAAAGAAGGTCGG - Intronic
1062958854 10:1558139-1558161 CAGCCTGGGGGTGGGAAGGATGG - Intronic
1064526309 10:16260381-16260403 GAGGGAGAAGGTAGGAAGGTAGG + Intergenic
1064841452 10:19596854-19596876 CAGAGAGGAGGAAGGAAGGAAGG + Intronic
1065145826 10:22767035-22767057 CCTCTAGGAGGTAGGAAGGAAGG + Intergenic
1065272767 10:24052912-24052934 TGGCCATGAGCTAGGAAGGTTGG - Intronic
1067442126 10:46314501-46314523 AAGGCAAGAGGTGGGAAGGTTGG + Intronic
1067799491 10:49349304-49349326 GAGCCGGGAGGGAGGAAGGCAGG + Intergenic
1067934793 10:50600657-50600679 CAGCCAGGAGGACTGAAGCTGGG - Intronic
1068679465 10:59803913-59803935 CAGCCAGGAAGTGGCAAGGCAGG - Intronic
1069609609 10:69764020-69764042 CTCCCAGGAGGAGGGAAGGTGGG + Intergenic
1069801996 10:71087486-71087508 AAGCCAGGAGCTAGGATGGTGGG + Intergenic
1069862860 10:71482163-71482185 CAGAAAGGAGGAAGGAAGGTGGG - Intronic
1069911673 10:71763545-71763567 CAGCCAGGAGGGAGGCAGCCTGG + Intronic
1070672544 10:78388262-78388284 CAGACAGGAGGCAGGGAGGATGG + Intergenic
1070823923 10:79380038-79380060 CAGGCAGGAGGAAGGGAGGTGGG - Intergenic
1071294643 10:84210988-84211010 CAGCCAGGAGCTGGGAAGGGGGG - Exonic
1071989705 10:91089442-91089464 GAGCCAGGAGGTAGTGGGGTGGG - Intergenic
1073116396 10:101094168-101094190 CAGCCAGGATGCAGGGAGGCGGG + Intronic
1073251329 10:102121604-102121626 TAGCCAGGAGGAGGGAAGGGAGG + Intergenic
1073898897 10:108195995-108196017 CCCCTAGGAGGTAGGAAAGTAGG - Intergenic
1074107664 10:110400460-110400482 CAGGCAGGAGGTAGGGAGGATGG + Intergenic
1074538129 10:114343545-114343567 CAGCAAGGAGGGAGGGAGGGAGG + Intronic
1075383229 10:122035815-122035837 CAGTCAGAAGGAAGGAAGGAGGG - Intronic
1075642570 10:124075360-124075382 CAGCCAGGAGGTATAAAGGATGG + Intronic
1075656249 10:124163032-124163054 CAGGCAGGAGGAAGGAAGGCAGG + Intergenic
1076724725 10:132407995-132408017 CAGCCGGGAGGGAGGACGGGAGG + Intronic
1076983626 11:219322-219344 CAAAGAGGAGGCAGGAAGGTTGG - Intronic
1077102367 11:827864-827886 CTGCAAGGAGGTGGGAAGGGAGG + Intronic
1077385986 11:2269706-2269728 CAGCCGGGAGGCAGGGAGGAGGG - Intronic
1078692642 11:13597435-13597457 CAGCGAGGAAGTAGGGAAGTGGG + Intergenic
1080640107 11:34153688-34153710 AAGCCAGGAAGTAGGGAGGCTGG + Intronic
1081600388 11:44488609-44488631 GAGCCAGGAGGGAGGGAGGGAGG - Intergenic
1081658855 11:44875479-44875501 CAGCTAGGATGAGGGAAGGTCGG - Intronic
1081766961 11:45618070-45618092 CAGCCAGGAAGTAGCAGGGTCGG + Intergenic
1081783867 11:45732791-45732813 CAGGCAGGAGGCTGGAAAGTGGG - Intergenic
1081997863 11:47376651-47376673 CAGGGAGGAGGGAGGAAGGTGGG - Intronic
1082844025 11:57712684-57712706 CCGACAGAAGGTAGTAAGGTTGG - Exonic
1083613097 11:64013743-64013765 CAGCCAAGAGGTGGGGAGATGGG - Intronic
1083614948 11:64021642-64021664 CAGCCAGGAGTTGGGGGGGTGGG + Intronic
1083648213 11:64185449-64185471 CAGCCAGGAGGCAGGAGGGCCGG + Exonic
1084575723 11:69986714-69986736 CAGCCAGGGGGGAGGAAGTCAGG - Intergenic
1085411983 11:76296832-76296854 CAGCCAGGTGGTAGGAAGGTGGG + Intergenic
1086293392 11:85336631-85336653 GAGCCAGGAGGAGGGAATGTGGG + Intronic
1087173419 11:95074186-95074208 TAGCAAGGAAGTAGGCAGGTAGG + Intergenic
1087704708 11:101477202-101477224 CAGAGAGCAGGCAGGAAGGTTGG - Intronic
1089177348 11:116558319-116558341 GAGCCAGGAGATAGGAGGTTGGG + Intergenic
1089613157 11:119680892-119680914 CAGCCACGAGTTGGGAAGGCTGG + Intronic
1089711342 11:120317077-120317099 GAGGCAGGAGGTAGTCAGGTGGG + Intronic
1090403013 11:126460982-126461004 CAGCCTGGAAGTAGGAAGCTTGG + Intronic
1090617224 11:128526140-128526162 CAGTCAGGAGGGAAGAAGGGAGG + Intronic
1090736825 11:129617947-129617969 CAGCCTGGAGGGAGAAAAGTGGG - Intergenic
1090930710 11:131295791-131295813 TAGCCAAGAGGTAGGGAGGGAGG - Intergenic
1090944528 11:131418122-131418144 CAGCTAGGAGGTAGCGAGGCCGG + Intronic
1091558616 12:1594255-1594277 CAGCCGGCAGGAAGGAAGGACGG - Intronic
1091637266 12:2206586-2206608 CAGTGAGTAGGTAGGGAGGTGGG - Intronic
1091914793 12:4263161-4263183 TTGCCAGGAGGTAGGATGTTTGG + Intergenic
1092395602 12:8122676-8122698 CAGAAAGGAGTTAGGAATGTGGG + Intergenic
1092629137 12:10359866-10359888 AAGCCAGGGATTAGGAAGGTGGG + Intergenic
1093245391 12:16730344-16730366 TAGACAGGAGGCAGGAATGTGGG + Intergenic
1093312975 12:17614871-17614893 AAGCCGGGAGGTAGAAAAGTGGG - Intergenic
1094016893 12:25874377-25874399 CACACAGGAGGGAGGAGGGTCGG + Intergenic
1095249133 12:39958259-39958281 CAGACAGGCAGTAGAAAGGTGGG - Intronic
1096537045 12:52281594-52281616 CAGCCTGGAGTAAGGAAGGAAGG + Intronic
1097190059 12:57215364-57215386 AAGCCAGGAGGCAGGAACCTGGG - Intergenic
1097277350 12:57822462-57822484 CAGCCAGGAAGGATGAAGGCTGG + Exonic
1097427290 12:59462244-59462266 AAGGCAAGAGGTAGGAAAGTAGG - Intergenic
1098437374 12:70482194-70482216 CAGCCATGAGCAAGGAAGGTGGG - Intergenic
1098870693 12:75813832-75813854 CAGACAGGATGTATGAAGTTTGG + Intergenic
1100606202 12:96154036-96154058 CAGCAAGGAGGTAGCAAGGGAGG + Intergenic
1101661119 12:106766472-106766494 CAGCAAAGTGGTAGGGAGGTGGG - Intronic
1102800146 12:115725015-115725037 CATCCAGGAGGAAGGCAGCTGGG + Intergenic
1102961174 12:117094241-117094263 CAGGCAGGGAGAAGGAAGGTGGG + Intronic
1104176529 12:126338370-126338392 CAGCCAGGAAGAAGGAGGGATGG + Intergenic
1104355083 12:128078148-128078170 CAGCCAGAGGGTAGGAAAGCAGG - Intergenic
1104459360 12:128942152-128942174 CAGGCAGCAGGAAGGAAGGTGGG + Intronic
1105858365 13:24390317-24390339 CAGTCATGAGATTGGAAGGTGGG + Intergenic
1106594345 13:31123792-31123814 CAGGAAGGAGAAAGGAAGGTAGG - Intergenic
1106594530 13:31125186-31125208 CAGCCAGCAGGCAGGGAGGATGG + Intergenic
1107800836 13:44106754-44106776 AACACAGGAGGTAGGAGGGTGGG - Intergenic
1108687423 13:52832794-52832816 CAGTTGGGGGGTAGGAAGGTGGG + Intergenic
1111637104 13:90919670-90919692 CAGAAAGAAGGTAGGCAGGTAGG - Intergenic
1112160406 13:96861122-96861144 CAGCCAGGCAGTGGGAAGGCAGG - Intergenic
1112202545 13:97291084-97291106 CAGCCTGGAGGAGGGATGGTAGG + Intronic
1112220348 13:97483049-97483071 CAGACAGCAGGAGGGAAGGTGGG + Intergenic
1112370147 13:98786905-98786927 CAGGCAGGAGGGAGGAAATTGGG - Intergenic
1112414732 13:99194874-99194896 CAGGCAGGAGGGAAGATGGTTGG - Intergenic
1112935673 13:104795051-104795073 CAAGCAAGAGGGAGGAAGGTGGG - Intergenic
1113348205 13:109501889-109501911 TAGACAGTAGGTAGGTAGGTAGG - Intergenic
1113650052 13:112028291-112028313 CAGCCAGAAGGGAGGGAGGGTGG + Intergenic
1114537200 14:23430520-23430542 CAGCCAGGGGGTGGGAGGATTGG - Intronic
1114811828 14:25909796-25909818 AAGTAAGTAGGTAGGAAGGTAGG + Intergenic
1115880423 14:37910993-37911015 CAGCCATGGGGTAGAAAGGTGGG - Intronic
1116727237 14:48575973-48575995 CAGCCAGGTGGCAGCAAGGCTGG - Intergenic
1117583839 14:57179838-57179860 CAGCAAGCTGGTAGGAAGGCAGG + Intergenic
1118012308 14:61622370-61622392 GAGCCAGGAGAGAGGAAAGTTGG + Intronic
1118139522 14:63064838-63064860 CAGACAGAAGGAAGGAAGGAAGG + Intronic
1118738927 14:68724178-68724200 CAACCAGGAGGGAGGATGGGAGG - Intronic
1118903703 14:70007664-70007686 CAGCCAGGAGAGAGAAAGGCTGG - Intronic
1120859418 14:89241488-89241510 CAGCCAGAAAGGAGGAAGCTGGG - Intronic
1120983294 14:90310317-90310339 CAGCCAGGCAGCAGCAAGGTTGG - Intronic
1121001367 14:90454148-90454170 TACCCAGGAGGGAGGAGGGTGGG - Intergenic
1121277066 14:92675798-92675820 CAGGAAGGAGGGTGGAAGGTGGG - Intronic
1122104537 14:99442142-99442164 CAGCCAGGAAGTGGCTAGGTTGG - Intronic
1122673039 14:103386204-103386226 CACCCAGGAGGCAGCCAGGTCGG + Intronic
1122901467 14:104783995-104784017 CAGCCATGGGGCAGGAAGGTGGG - Intronic
1123043384 14:105499664-105499686 CAGCCTGGCGGAAGGAGGGTCGG + Intergenic
1125554365 15:40572013-40572035 CTGCCTTAAGGTAGGAAGGTAGG - Intronic
1125598869 15:40904713-40904735 CAGGCAGGAGCTGGGAAGGCGGG - Intergenic
1125750550 15:42024649-42024671 CTGGCAGGAGGTGGGAAGGAAGG - Intronic
1125906952 15:43401501-43401523 CAGCCAGGACGTTGGAGGGAGGG + Intronic
1126688051 15:51265467-51265489 CAGCCCGGAGGGAGGAAGACAGG + Intronic
1127854775 15:62945363-62945385 CAGAGAGAAGGAAGGAAGGTAGG - Intergenic
1128154330 15:65383351-65383373 CAGCCAGGGGCAAGGAAGGAGGG + Exonic
1128680707 15:69649303-69649325 GAGCTGGGAGGTAGGAAGGCAGG + Intergenic
1128764523 15:70243023-70243045 AAGCAAGGAAGTGGGAAGGTGGG + Intergenic
1129178332 15:73855959-73855981 CAGCCAGCAGGTACCATGGTGGG - Intergenic
1129769409 15:78193812-78193834 CAGGGAGGAGGCAGGATGGTGGG + Intronic
1130241525 15:82197868-82197890 CAGGCAGCAGGTAGGCAGGCAGG - Intronic
1130458904 15:84143296-84143318 CAGGCAGCAGGTAGGCAGGCAGG + Intergenic
1130910750 15:88269343-88269365 CAGCCAGGACCTAGAAAGCTTGG - Intergenic
1130950796 15:88585877-88585899 TTGCCAGGAGTTAGGAAGGGAGG + Intergenic
1132538664 16:496842-496864 CAGCAAGAAGGTGGCAAGGTAGG + Exonic
1132611999 16:821833-821855 CAGCCAGGAGCTGGGGAGGGTGG + Intergenic
1133303624 16:4797277-4797299 GTGCCAGGAGGAAGGAAGGCTGG - Exonic
1134455185 16:14390196-14390218 AAGGCAGGAGGTAGGGAGATGGG + Intergenic
1134834278 16:17348021-17348043 CTGGTAGGAGATAGGAAGGTGGG - Intronic
1135527103 16:23221980-23222002 ACTCCAAGAGGTAGGAAGGTGGG + Intergenic
1136041102 16:27579603-27579625 CAGCCAGGAAGCAGGAAGGCTGG - Intronic
1136561208 16:31040219-31040241 CGTCCAGGAGGTAAGGAGGTTGG - Intronic
1137273704 16:46919569-46919591 CAGCCAGGAGCTGGAAAGGAGGG + Intronic
1138009220 16:53362214-53362236 CTGCCAGGCAGTTGGAAGGTGGG - Intergenic
1138382241 16:56610723-56610745 CAGCCAGGAAGTGGTAAAGTGGG - Intergenic
1139288133 16:65833529-65833551 CAGGCAGGCGGAAGGAAGGAAGG + Intergenic
1139441449 16:66969769-66969791 GAGGCAGGAGGGAGGAAGCTAGG + Intronic
1139475085 16:67199102-67199124 GAGTCTGGGGGTAGGAAGGTAGG - Exonic
1140031207 16:71340691-71340713 CAGACAGGAGGTGGGAGGGCGGG - Intergenic
1140252355 16:73305176-73305198 TGGCCAGGTGGGAGGAAGGTGGG + Intergenic
1140317477 16:73913100-73913122 CAGGTAGGAGGCAGAAAGGTAGG - Intergenic
1140709921 16:77667874-77667896 CAGCCAGAAGGAAGGAAGAAAGG + Intergenic
1140771250 16:78205888-78205910 AAGACAGGAGGAAGGAAGGGAGG - Intronic
1141243078 16:82281024-82281046 CAGACAAGAGGTAGGGAGGTAGG + Intergenic
1141828847 16:86498502-86498524 CAGCCAGGAGGGGAGACGGTTGG - Intergenic
1141987012 16:87586647-87586669 CTGCCAGGAGGAAGGAGGATGGG + Intergenic
1142591917 17:1009987-1010009 CAGCCAGGAGGCCGGCTGGTGGG + Intronic
1142605730 17:1080095-1080117 AACCCATGAGGTAGGAAGGAAGG + Intronic
1142958191 17:3535278-3535300 CAGGAAGGAGGGAGGAAGGGAGG - Intronic
1143326418 17:6101349-6101371 GAGCCTGGGGGTAGGAAGCTAGG + Intronic
1143830579 17:9647270-9647292 GAGGCAGGAGGGAGGAAGGTGGG - Intronic
1144527676 17:16004273-16004295 CAGCCAGGGAGTAGGACTGTGGG + Intronic
1145112087 17:20172628-20172650 CAGCCAGGTGCTGGGAGGGTTGG + Intronic
1145753037 17:27368822-27368844 AAGGCAGGAGGTAGTAAGCTGGG - Intergenic
1146418599 17:32661287-32661309 GAGACTGGAGGTAGGGAGGTGGG - Intronic
1146683279 17:34823892-34823914 CAGCCAGGAGGTAGGGATACTGG + Intergenic
1147480085 17:40752480-40752502 CAACCAGGAGGAAAGAAGGCTGG - Intronic
1147944352 17:44072022-44072044 CAGCCTGGGGGAAGGAAGGGAGG + Intronic
1148442157 17:47716976-47716998 CAGGCAGGAGGGATGAGGGTGGG + Intergenic
1149602685 17:57903460-57903482 CAGGAAGGAGCTAGGAGGGTGGG + Intronic
1150293065 17:63992980-63993002 GAGTCAGGAGGGAGGAAGGAAGG + Intergenic
1150617147 17:66781186-66781208 GAGCCAGGAGGGAGGAAGACTGG - Intronic
1150760751 17:67958649-67958671 AACCCAGGAGGTGGGGAGGTTGG + Intronic
1151417720 17:73977395-73977417 CTGGCAGGAGGCAGGCAGGTGGG - Intergenic
1152241521 17:79163701-79163723 CAGCCAGGAGGGAAGCAAGTGGG - Intronic
1153142111 18:1984990-1985012 CATCCACGAGGTAGGGAGTTGGG - Intergenic
1153172073 18:2327812-2327834 CAGCCAGGAGGTGGAAAGACAGG - Intergenic
1153540664 18:6150796-6150818 CAGGCAGAAGGTAGGAAGTCTGG - Intronic
1153805191 18:8704977-8704999 CTGCCAGGAGCTAGGGAGGAAGG - Intergenic
1153946570 18:10023333-10023355 CAGCCAGGACTCAGGAAGCTGGG - Intergenic
1154041456 18:10860020-10860042 CAGACAGGAGGGAGGCAGATTGG + Intronic
1154110055 18:11559976-11559998 CAGCCAGGAGCTGGCAGGGTCGG + Intergenic
1154123680 18:11671603-11671625 CACCCAGGAGGCAGGCAGGGAGG - Intergenic
1154133689 18:11758002-11758024 CAGGCAGCAGCTGGGAAGGTAGG + Intronic
1155050160 18:22139754-22139776 CAGCAAGAACCTAGGAAGGTTGG + Intergenic
1156447017 18:37244643-37244665 CAGCCATGAGGCAGGAAGGAGGG + Exonic
1157534591 18:48449006-48449028 GTGCCTGGAGGTAGAAAGGTGGG - Intergenic
1157592079 18:48842070-48842092 CTGCCAGGGGGTGGGAGGGTTGG + Intronic
1158233055 18:55280094-55280116 CAGAGAGGAGGTAGGGAGGGGGG + Intronic
1158298879 18:56030160-56030182 CAGCAAGCAGGCAGGAAGGTAGG - Intergenic
1158407877 18:57176472-57176494 CAGACAGTAGTTAGGAAGTTTGG - Intergenic
1159251138 18:65878417-65878439 CAGCTAATATGTAGGAAGGTTGG + Intronic
1159254784 18:65931619-65931641 CAGTCAGGAGGCAGGGAAGTAGG - Intergenic
1159310094 18:66696904-66696926 CAGGCATTAGGTAGGTAGGTAGG + Intergenic
1159627650 18:70713487-70713509 CAGCAAGGAGGAAGGGAGGTTGG + Intergenic
1159793934 18:72819112-72819134 CAGACAGAAGGTGGGAAGGGAGG - Intronic
1159979189 18:74755559-74755581 CAGAAAGGAGGAAGGAAGGAAGG - Intronic
1160418913 18:78731057-78731079 CAGACAGGCGGTGGGAGGGTGGG - Intergenic
1161073237 19:2272679-2272701 GGCCCAGGAGGTAGGCAGGTGGG + Intronic
1161607264 19:5222089-5222111 CAGCCAGCAGGCAGGCAGGCAGG - Intronic
1161960028 19:7518045-7518067 CAGCAAGGGGGTAGGAAGCTAGG + Intronic
1162386301 19:10362251-10362273 CAACCAGGAGGTACGATGATAGG - Exonic
1163506337 19:17709269-17709291 AAGCCAGGAGCTGGGAAAGTGGG - Intergenic
1164931204 19:32177589-32177611 CAGGCAGGAGGGAGGGAGGAAGG + Intergenic
1165278949 19:34780584-34780606 CAGGGAGGAGGGAGGAAGGAAGG + Intergenic
1165847945 19:38831029-38831051 TTGCCAGGAGCTAGGAAGGCTGG + Intronic
1166258408 19:41621385-41621407 CTGCCTGGAGGGAGGAAGGGAGG - Intronic
1166684178 19:44785486-44785508 AAGAGAGGAGATAGGAAGGTAGG + Intronic
1166893711 19:46010006-46010028 CAGCCAGGAATTAGGGAGTTTGG + Intronic
1167539004 19:50073550-50073572 ATGCCTGGAGGCAGGAAGGTGGG + Intergenic
1167654195 19:50752810-50752832 GAGCCAGGAGGTAGGAGCTTGGG + Intergenic
1167655892 19:50763951-50763973 GAGCCAGGAGGTAGGAGCTTGGG + Intergenic
1168056242 19:53866709-53866731 CATCCAGGAGTCAGGAATGTAGG + Intronic
1168241005 19:55088860-55088882 CAGGCAGGAGGTGGCAAAGTGGG - Intergenic
1168307433 19:55443031-55443053 GCGCCAGGAGGCAGGAAGGGCGG + Intergenic
926283233 2:11466876-11466898 CAGGAAGGAGGAAGGAAGGAAGG - Intergenic
926731554 2:16039403-16039425 CAGGGAGGAGGGAGGAAGGAAGG - Intergenic
926874814 2:17464116-17464138 CAGCCAGGAGGTGGGAAGTCAGG - Intergenic
927039452 2:19213443-19213465 CAGCCAGGGGGAGAGAAGGTGGG + Intergenic
927747268 2:25634056-25634078 CAGCCAGGAGGGAGGTGGGGGGG + Intronic
928142215 2:28739694-28739716 CAGCAATTAGGTAGAAAGGTTGG - Intergenic
928425932 2:31177741-31177763 CTGCCATGAGGGAGGCAGGTAGG - Exonic
931244365 2:60480128-60480150 CAGCGAGGAGGGGGGAAGGTGGG + Intronic
931318982 2:61158003-61158025 CAGGCAGGAGGTAGGCAGTAGGG + Intronic
931697237 2:64880384-64880406 CTGCCAGGAGGGAGGAAGAAAGG + Intergenic
932399887 2:71473060-71473082 CAGCTAGGATTTAGGAAGGTGGG + Intronic
932420194 2:71596984-71597006 CAGGAAAGAGGTGGGAAGGTTGG - Intronic
932441701 2:71741393-71741415 AAGCCAGGAGGAAGGAAGCTGGG + Intergenic
934518568 2:95005050-95005072 CTGGCAGGCTGTAGGAAGGTGGG - Intergenic
935644262 2:105320496-105320518 CAGAAAGGAGGCAGGAATGTGGG + Intronic
935829531 2:106986415-106986437 CTTGCAGCAGGTAGGAAGGTAGG + Intergenic
935858801 2:107304742-107304764 CAACCAGCAGGAAGGAAGGAAGG + Intergenic
936095500 2:109527975-109527997 CAGCCAGGCGGGAGGACGGGTGG + Intergenic
937091448 2:119209135-119209157 CAGCCATGTGGTAGGTATGTGGG + Intergenic
937291564 2:120785158-120785180 CTGCCAGGAGGGAGGGAGGGTGG + Intronic
938238581 2:129725344-129725366 TAACCAGGAGGCAGGTAGGTTGG - Intergenic
938961848 2:136351255-136351277 CAGCCAGAAGATAGCAAAGTGGG - Intergenic
939712828 2:145544127-145544149 AAGCCAGGAGGTAGGAGATTAGG - Intergenic
939993836 2:148901766-148901788 GAGCAAGGAGCTAGGAAGGCTGG - Intronic
940531754 2:154886636-154886658 CAGCAATGAGGTAGCATGGTGGG + Intergenic
940984453 2:160038680-160038702 CAGAAAGGAGATTGGAAGGTAGG + Intronic
941604517 2:167580710-167580732 CATCCAGGATGAAGGAAGGTGGG + Intergenic
942261794 2:174172433-174172455 TTGTCAGGAGGTAGGAAGGTGGG - Intronic
942449679 2:176101017-176101039 CAGCCAGGAGCAAGGAGAGTTGG - Exonic
942558873 2:177199647-177199669 GAGCCAGGAGGTAGGAATAAGGG - Intergenic
944255379 2:197618988-197619010 CATCCGGGAGGGAGGGAGGTGGG + Intronic
945983827 2:216339007-216339029 CAGCCAAGAGGTAGGAACACAGG - Intronic
946324942 2:218980496-218980518 CCGCCAGGAGGGATGAAGGTCGG + Intergenic
946419968 2:219559183-219559205 CAGAGAGGAGGTAGAGAGGTAGG - Intronic
947840723 2:233206116-233206138 GAGCCAGGAGGTGGGAGGGCTGG - Intronic
947976282 2:234368957-234368979 CAGCAAGGAGGAGGGAGGGTGGG - Intergenic
948209249 2:236179824-236179846 CAGCCAGGAGATTCAAAGGTGGG - Intergenic
1168965436 20:1895337-1895359 CAGCCGGGAGGGGGGAAGGGGGG + Intronic
1169023434 20:2347858-2347880 CATCAAGGGGGTGGGAAGGTGGG + Intergenic
1169813093 20:9628910-9628932 CAGCAAGGAGCAAGGAAGTTGGG - Intronic
1169908832 20:10630485-10630507 CAGCCAGGAGGTGGGAGACTGGG + Intronic
1170603797 20:17861065-17861087 CCGCCAGCCGGTAGGAAGGTGGG - Intergenic
1173732954 20:45341170-45341192 TGGCCAGGAGGAAGGCAGGTAGG - Intronic
1173959038 20:47057128-47057150 CAGGAAGGAGGGAGGAAGGAAGG + Intronic
1173991052 20:47303827-47303849 CAGCCAGGAGGTGGTGGGGTTGG - Intronic
1174129401 20:48331716-48331738 CAGCTAGGAGGTGGGGGGGTGGG - Intergenic
1174435363 20:50502766-50502788 CAGCCAGTAGGTAGTCAAGTGGG - Intergenic
1174562957 20:51444461-51444483 CAGCCAGGAAGCAGTAGGGTTGG + Intronic
1175243011 20:57563482-57563504 CAGCCCAGAGGTTGGAATGTAGG - Intronic
1175260404 20:57670479-57670501 CACCTAGGAGGGAGGGAGGTTGG - Intronic
1175615288 20:60393178-60393200 CAGCAAGGTGAGAGGAAGGTGGG - Intergenic
1175807589 20:61838307-61838329 AAGGCAGGAGGTGGGGAGGTAGG + Intronic
1176958226 21:15130403-15130425 CAGAATGGAGGTAGAAAGGTGGG - Intergenic
1179021825 21:37647751-37647773 CAGCCAGGAGGGAACAAGGGAGG - Intronic
1179720909 21:43315603-43315625 CAGCCAGGAGGGAGGCTGGCAGG + Intergenic
1179781154 21:43702027-43702049 CAGCCAGGATGTAGGGGGGCTGG + Intergenic
1179828865 21:43983529-43983551 CGTCCAGGAGGTAGGGAGCTGGG - Exonic
1179982919 21:44905803-44905825 CAGCCGGGAGGGAGGCAGCTGGG - Intronic
1179983777 21:44910239-44910261 CACCCAGGAGCTGGGCAGGTGGG + Intronic
1180927663 22:19567319-19567341 CAGCCTGGTGCCAGGAAGGTGGG + Intergenic
1180984491 22:19896506-19896528 CATCCAGGAGCCAGGAGGGTAGG + Intronic
1181093420 22:20489791-20489813 CAGCCAGGAGTCTGGGAGGTGGG + Intronic
1181438385 22:22923266-22923288 CAGGCAGGAGGCAGGGAGGTGGG - Intergenic
1182001891 22:26926571-26926593 CAGCCAGGAGTAAGGAGGGGTGG + Intergenic
1182083513 22:27545501-27545523 GAGACAGGAGGTTGGAGGGTGGG - Intergenic
1182282131 22:29224022-29224044 CACCCAGGATGGAGGAAGGTGGG - Intronic
1183280309 22:36928764-36928786 CAGCCTGGAGGTAGGGAAGGGGG + Intronic
1183304627 22:37075916-37075938 GAGACAGAAGGTAGGAAGGAAGG + Intronic
1183418021 22:37693769-37693791 CAGCCTGGAGCTGGGAAGGCTGG + Intronic
1183629218 22:39023005-39023027 CAGGCAGGAGGTAAGCAGCTGGG + Exonic
1183947726 22:41336158-41336180 CAGCCTGGAGGTTGGAGTGTGGG + Intronic
1184307734 22:43618136-43618158 CAGAGAGGAGGAAGGAAGGAAGG + Intronic
1184410211 22:44321957-44321979 CAGACAGGAGGCAGGAGGCTGGG + Intergenic
1184433146 22:44453497-44453519 CAGACATGGGGTGGGAAGGTGGG - Intergenic
1184552513 22:45212122-45212144 CAGACAGGAGTGAGGAAGGACGG + Intronic
1184715480 22:46279546-46279568 CAGCCAGGATGTTGGGAGGCAGG - Intronic
1184856391 22:47148863-47148885 CAGCCAGGAGGTGGCAAGGCTGG - Intronic
1185033982 22:48461179-48461201 CAGCCCGGAGGAGAGAAGGTGGG + Intergenic
1185280609 22:49968335-49968357 CGGCCTGGAGGAAGGCAGGTTGG + Intergenic
1185422093 22:50740447-50740469 CAGCCTGGAAGCAGGAAGGCTGG - Intronic
949868287 3:8565335-8565357 CACCCAGGAAGTAGAAAGGCTGG + Intronic
950327172 3:12121699-12121721 CAGGGAGGAGGGAGGAAGGGAGG + Intronic
950577290 3:13839891-13839913 CAGCCAGGAGGGAGCAGGGCTGG + Intronic
950642639 3:14358493-14358515 GAGCCAGGAGGCAGGGAGGCGGG - Intergenic
950647698 3:14387044-14387066 CAGCTAGAAAGTAGGAAGGATGG - Intergenic
950728948 3:14939414-14939436 CAGGCAGGATGGAGGGAGGTAGG + Intergenic
951669491 3:25164181-25164203 CAGCCAGAAGGTAGTAGGGGTGG + Intergenic
951670039 3:25170921-25170943 CAGACAGGAGGTAGCATGATTGG - Intergenic
952287610 3:31983226-31983248 CAGACTGAAGGTGGGAAGGTAGG + Intronic
952966042 3:38621902-38621924 CAGCTAGGAGGTAGGCAGCTAGG - Intronic
952966045 3:38621917-38621939 CAGCTAGGAGGTAGGCAGCTAGG - Intronic
954332082 3:49896505-49896527 TGGCCAGGAGGGAGGAAGGCTGG - Intronic
954433714 3:50484889-50484911 CGGCCATGGGGTAGGCAGGTGGG + Intronic
955778728 3:62461593-62461615 TAGCCAGGAGGCAGGAAAGCAGG - Intronic
956121660 3:65972071-65972093 CTGCCAGGCTGGAGGAAGGTGGG - Intronic
956697874 3:71934011-71934033 CAACCAGGAGCTAGGAAGAGAGG + Intergenic
957824608 3:85424416-85424438 CAGGCAAGAAGTTGGAAGGTGGG - Intronic
958904134 3:99923571-99923593 CAGCCATGAGGTTGGGAGGGGGG - Intronic
959437208 3:106330605-106330627 CCAGCAGGAGGTAGGTAGGTAGG - Intergenic
959526342 3:107381680-107381702 AAGCCAGGAGGGATGGAGGTGGG - Intergenic
959683886 3:109124442-109124464 CATCCAGGAGGGAGGTAGGGGGG + Intergenic
959685279 3:109139327-109139349 CAACCAGGAGTTAAGAAGCTGGG + Intergenic
961250554 3:125500970-125500992 TATCCAGAAGGTAGGTAGGTAGG + Intronic
961381373 3:126498357-126498379 CAGCCAGGAGGCAGGGATGGAGG - Intronic
961489204 3:127240826-127240848 CACCCAGGAGGTTGGGGGGTGGG + Intergenic
961553410 3:127681579-127681601 CACCCAGAAGGTAGGCAGGCAGG - Intergenic
961748660 3:129082304-129082326 CGCCCAGGAAGGAGGAAGGTGGG + Intergenic
963038256 3:141050939-141050961 CAGCCAGGAGGAAAAAAGGGTGG - Intergenic
963395404 3:144725979-144726001 TAGCCAGGAGGAAGGAAGGAAGG + Intergenic
963783399 3:149509541-149509563 CAGCCAGGTGGTGGGGAGCTTGG - Intergenic
963913000 3:150830914-150830936 CAGACAGGAGGAAGGAAGGAAGG - Intergenic
966441639 3:179951513-179951535 CAGCAAGCAGGAAGAAAGGTGGG - Intronic
966629633 3:182058186-182058208 CTGACAGGAGGCAGGAGGGTTGG + Intergenic
966846656 3:184135601-184135623 CAGCCAGAGGGCAGGAAGGGTGG + Intronic
967253544 3:187567065-187567087 CAGCCAGGACCTGGGGAGGTGGG + Intergenic
967753651 3:193143346-193143368 CAGTCAGTAGTTAGGTAGGTAGG - Intergenic
968755099 4:2411640-2411662 CAGCCAGGAGGAAGCAGGGCTGG - Intronic
969293113 4:6253107-6253129 CACCCAGCAGGGAGGAAGGAAGG + Intergenic
969858010 4:10015369-10015391 CAGCCAGGAGGTGGCAGTGTTGG - Intronic
970516050 4:16831253-16831275 CAGCAAGGAGGTGGGATGGCTGG + Intronic
970993160 4:22236273-22236295 CATCCAGAAGGAAGGGAGGTAGG - Intergenic
971164681 4:24170930-24170952 CAGCCAGGGGGTCAGATGGTTGG - Intergenic
971252945 4:24988547-24988569 CAGCCAGCAGGTGCAAAGGTGGG - Intergenic
974611815 4:64227887-64227909 CAGCCAGGACTTATGAAAGTGGG - Intergenic
974803910 4:66855849-66855871 GAGCCAGGAGGAAGAGAGGTTGG + Intergenic
974877156 4:67714691-67714713 CAGTGAGGAAGAAGGAAGGTTGG + Intergenic
975389738 4:73802375-73802397 CAGCCTGAAGGCAGTAAGGTTGG - Intergenic
977240789 4:94566121-94566143 CAGCCAGAAGGTAGAATGTTAGG + Intronic
977467346 4:97399288-97399310 CAGCCAAGAGGAAGAAAGATAGG - Intronic
978378965 4:108106346-108106368 CAGGCAGGAGGTAATAAGGAAGG + Intronic
979641485 4:123015991-123016013 CATCCAGGAGGAAGGTAGGGGGG - Intronic
980199376 4:129635924-129635946 CAACCAGGGGGTGGGAAGCTAGG - Intergenic
980626679 4:135381941-135381963 CAGAGAGGAGATGGGAAGGTGGG - Intergenic
980785262 4:137545368-137545390 CAGGAAGGAGGTATGAATGTTGG + Intergenic
981864502 4:149399411-149399433 AGGCCAGGAGGAAGGGAGGTTGG + Intergenic
982329359 4:154164105-154164127 CACCCAGGAATCAGGAAGGTGGG + Intergenic
982927212 4:161353406-161353428 TAACCAGTAGATAGGAAGGTTGG - Intergenic
984095028 4:175424226-175424248 AAGCCAGGAGGAAGCAAGGAAGG - Intergenic
985715796 5:1460339-1460361 GAGCCAGGAGAAATGAAGGTGGG - Intronic
985719322 5:1481087-1481109 CAGCCAGGGGGAAGGGAGGAGGG + Intronic
986067251 5:4246611-4246633 CAACCAGCAGGTAAGCAGGTTGG + Intergenic
986996263 5:13611002-13611024 CAGCCATGATGTGGGAGGGTAGG - Intergenic
987794416 5:22608174-22608196 CAGCCAGGAGGTGGTGAGGGGGG + Intronic
988653643 5:33182815-33182837 TAGCCAGGAGATAGGGAGGTTGG - Intergenic
988669407 5:33364751-33364773 CACCCATAAGGTAAGAAGGTGGG + Intergenic
989232694 5:39104073-39104095 AAGGCAGGAGGGAGGATGGTTGG + Intergenic
990368496 5:55093770-55093792 CAGCCAGGAGGAAGGGAGGGAGG + Intergenic
990874834 5:60473038-60473060 CAGACAGAAGGAAGGAAGGAAGG + Intronic
992179451 5:74182512-74182534 CAGCAAAGAGGTAGGGAGGGTGG + Intergenic
993426463 5:87770907-87770929 CCACCAGGAGGTGGGGAGGTGGG - Intergenic
994103959 5:95924721-95924743 CAGACAGGAGGTTGGGAGGAGGG - Intronic
994302738 5:98165137-98165159 CAGCAAGAAGAAAGGAAGGTGGG - Intergenic
995544735 5:113218453-113218475 CAACCAGGAGGGCAGAAGGTGGG + Intronic
995561606 5:113388000-113388022 CTGCCAGCAGGGAGGAAGGGTGG - Intronic
995836274 5:116402735-116402757 CAGACAGGTGGAAGGAAGGATGG + Intronic
996192651 5:120564421-120564443 CATCCCAGAGGTCGGAAGGTCGG - Intronic
997693760 5:135845477-135845499 CAGCCAGAAGGAAGGAAAGAAGG - Intronic
997763354 5:136472481-136472503 AAGACAGGAGGAAGGAAGGAAGG - Intergenic
998132881 5:139660044-139660066 CAGGCAGGAGGAGGGAAGCTGGG + Intronic
998474222 5:142407213-142407235 CAGCCAGGAGCTCACAAGGTGGG - Intergenic
999743805 5:154576589-154576611 CAGCCAGGAGATAAGAATGATGG + Intergenic
1000543125 5:162565950-162565972 CATCAAGGAGGTAGGAAGTCAGG + Intergenic
1000981385 5:167820478-167820500 CAGCCAGGACCTTGGCAGGTTGG + Intronic
1001114545 5:168928533-168928555 CAGGCAGAAGGAGGGAAGGTAGG - Intronic
1001208788 5:169790833-169790855 CAGCCTGGTGGTAGTAAGGCTGG + Intronic
1001404279 5:171464663-171464685 CAGCAGGTAGGTAGGTAGGTAGG - Intergenic
1001408739 5:171495387-171495409 CGGGAAGGAGGAAGGAAGGTGGG + Intergenic
1001882854 5:175259674-175259696 TAGCCAGGAGGTAGGAGTGATGG - Intergenic
1002195664 5:177499679-177499701 GAGGAAGGAGTTAGGAAGGTGGG - Intergenic
1002541064 5:179907147-179907169 CAGCCAGGAGCAGGAAAGGTGGG + Intronic
1002877049 6:1220010-1220032 CAGTCTGTAGGTATGAAGGTAGG + Intergenic
1003664948 6:8102246-8102268 CCTCCAGGAGGTAGGATGGCAGG + Intronic
1003899852 6:10644458-10644480 CAGACAGAAGGAAGGAAGGAAGG - Intergenic
1004157547 6:13183619-13183641 CAGGGAGGAGGAAGGAGGGTGGG + Intronic
1005423639 6:25678667-25678689 CACCCAGGAAGTAGGTAGGCTGG + Intronic
1005650398 6:27879936-27879958 CAGCCAGGAAGGATGAAGGCTGG + Intergenic
1005691558 6:28311619-28311641 CAGCTAGGAGGTTGGTAGGCTGG - Intergenic
1006470072 6:34223784-34223806 CAGACAGAAGGTGGGAGGGTGGG - Intergenic
1007366302 6:41396525-41396547 CAGCCAGGTGGGTGGAAAGTGGG - Intergenic
1007812820 6:44498284-44498306 CAGCTAGGAAGTAGGGAGCTGGG + Intergenic
1008149466 6:47932783-47932805 TAGCCAGGAAGTGGCAAGGTTGG - Intronic
1008281257 6:49598969-49598991 CTGCAAGGAGGTAGGGAGGCTGG + Intergenic
1008759413 6:54835572-54835594 CAGGTTGGAGGTAGGAAGGATGG + Intergenic
1010273956 6:73948163-73948185 CAGCCATGAGCTGGGCAGGTGGG + Intergenic
1012585477 6:100916324-100916346 CAGCAAGGAGGCAGGATGGTTGG - Intergenic
1012840916 6:104327830-104327852 TAGCCAGGAGATAGGAATCTTGG + Intergenic
1012926715 6:105274814-105274836 CAGCCAGGAGGTGGGCAGGCAGG - Intergenic
1013077232 6:106782237-106782259 CAGGCAGGAAGCAGGAACGTAGG + Intergenic
1013616633 6:111849566-111849588 CAGGCTGGAGGGAGAAAGGTGGG + Intronic
1013676205 6:112465928-112465950 TAGCCAGAAGGAAGGAAGGAAGG - Intergenic
1014273859 6:119365055-119365077 GAGCCTGGAGGTAGGAAGCAAGG - Intergenic
1014779120 6:125543045-125543067 CATACAGGAGGTAGGAATGTTGG + Intergenic
1015276583 6:131388635-131388657 GAGTCAGGAGGAAGGAAGGAAGG - Intergenic
1015307049 6:131721153-131721175 AAGCACGTAGGTAGGAAGGTAGG - Intronic
1015503037 6:133953040-133953062 CAGGAAGGAGGAAGGAAGGGTGG + Intronic
1017245264 6:152217557-152217579 CAGCCAGGAGGAGGGGAGGTTGG + Intronic
1017878675 6:158544654-158544676 CAGCCAGCCGGAAGGAAGGCGGG - Intronic
1018610021 6:165639102-165639124 CAGGCAGGCGGCAGGAAGGAAGG + Intronic
1019428123 7:986894-986916 CAGCCAGGAGGTAGGGAGCTTGG - Intronic
1019648516 7:2143739-2143761 CTGCCTGGAGGCAGCAAGGTGGG + Intronic
1020186073 7:5960600-5960622 CAGCCATGAGGGGGCAAGGTCGG - Intronic
1020296842 7:6764170-6764192 CAGCCATGAGGGGGCAAGGTCGG + Intronic
1020814152 7:12883672-12883694 GAGAAAGGAGGAAGGAAGGTAGG + Intergenic
1021733457 7:23619524-23619546 CAACAAGGATGTAGTAAGGTGGG - Intronic
1023381685 7:39614425-39614447 CAGCCATGAGGTATGAGGATTGG + Intergenic
1023477535 7:40597086-40597108 CAGCAAGTAGGTAAGAAGATAGG + Intronic
1026000242 7:66555495-66555517 CAGACAGCAGGTAGCAGGGTGGG + Intergenic
1026394737 7:69940198-69940220 CAGCCAGAAGTTAGGAACGCAGG - Intronic
1026931534 7:74225461-74225483 CAGACAGGAGGCAGGGACGTTGG + Intronic
1027139182 7:75645058-75645080 CACTCAGGAACTAGGAAGGTGGG + Intronic
1029374125 7:100167744-100167766 CAGGCAGGAGGAAGGGAGGTTGG + Intronic
1029697374 7:102222768-102222790 CAGCCAGGAGCTAGGTGGATGGG - Intronic
1029944061 7:104513238-104513260 CAGCTGGTAGGTAGGATGGTAGG + Intronic
1030105387 7:105982662-105982684 GAGCCAGGAGATAGGAGGGGAGG - Intronic
1033229913 7:139588627-139588649 GAGCTAGGAGGTAGGGAGGAGGG + Intronic
1034658113 7:152745375-152745397 CTGCCAGGAGGAAGGAGGCTGGG + Intergenic
1035466629 7:159083715-159083737 CATCCAGGAGGTATGCAGTTTGG + Intronic
1035472801 7:159120950-159120972 CAGCCAGGAGGCGGCAAAGTAGG - Intronic
1035739293 8:1914091-1914113 CACCAAGGAGGGAGGAAGGCGGG + Intronic
1035898863 8:3435671-3435693 AAGGCAGGAGGTAGGACGGAAGG - Intronic
1036636122 8:10550636-10550658 CAGGCAGGAGAGAGGAAGGCTGG - Intronic
1037828791 8:22176510-22176532 CTGCCAGGAGGAAGGAAGCCAGG - Intronic
1037864202 8:22430060-22430082 CAGACATGAGGGAAGAAGGTTGG + Intronic
1038100571 8:24369653-24369675 CTGCCAGGAGTTAGGGAGGAGGG - Intergenic
1038740628 8:30213570-30213592 CAGCCAGGTGGAAGGAAGCGGGG - Intergenic
1039430316 8:37520445-37520467 CAGCCGGGAGGTGGGGAGGGAGG - Intergenic
1039750449 8:40473693-40473715 CAGCCAGGAGGGAGCTAGCTAGG - Intergenic
1039832104 8:41223620-41223642 GAGCCAAGAGGGAGGAAGGGAGG + Intergenic
1040067715 8:43161725-43161747 CAGCCATGTGGGAGGAAGGAAGG - Intronic
1040441543 8:47448607-47448629 CAGCCAGTAGGTAGGTCAGTAGG + Intronic
1040900267 8:52410865-52410887 CAGCCAGGGCTGAGGAAGGTAGG + Intronic
1041163734 8:55071463-55071485 GATCCAGGAGGTAAGAAGCTTGG + Intergenic
1041839242 8:62249255-62249277 CAGCCAGGCGGTGGGGAGGGTGG - Intronic
1042333602 8:67608155-67608177 CAGACAGGAGGCAGGAGAGTAGG + Intronic
1043888589 8:85631131-85631153 CAGACTGGAGGCAGGAAGGAAGG - Intergenic
1044539246 8:93391468-93391490 CAGCTAGTAAGTAGGAAGGTCGG - Intergenic
1044618065 8:94162703-94162725 CAGCCTGCAGGAAGCAAGGTGGG + Intronic
1044869423 8:96603831-96603853 AAGCCAGGCGGTAGGAAGGCAGG + Intronic
1046017416 8:108621528-108621550 CAGCCAGGAAGTATGAAGCAGGG + Intronic
1046343459 8:112889818-112889840 AAGTCTGGAGGTAGGAAGGGAGG - Intronic
1046396782 8:113650829-113650851 CAGACAGGAGGTAGGAGGGCGGG + Intergenic
1046954243 8:120046861-120046883 CAGCCAGGTGTTAGGAAGATAGG + Intronic
1047547857 8:125837731-125837753 CAGACAGGAGGTAGGACGCATGG + Intergenic
1049290732 8:141800310-141800332 CCCCAAGGAGGAAGGAAGGTGGG + Intergenic
1049311777 8:141937376-141937398 AAGGAAGGAGGGAGGAAGGTGGG - Intergenic
1049398104 8:142411293-142411315 CACCCAGCAGGCAGGAAGGTTGG - Intergenic
1049515892 8:143055275-143055297 CAGGCAGCAGGAAGGAAGCTGGG + Intronic
1049930838 9:455092-455114 CAGCCAGTGGGGAGAAAGGTGGG - Intronic
1050347930 9:4711209-4711231 CAGGCAGCAGAAAGGAAGGTGGG + Exonic
1051481755 9:17569286-17569308 CATCCAGGAGGTCTGAAGTTGGG + Intergenic
1051533074 9:18127032-18127054 CAGCCAGCAGGGAGGCAGCTAGG + Intergenic
1052697624 9:31898551-31898573 CTGTCAGGAGGTGGGGAGGTAGG - Intergenic
1052801154 9:32969548-32969570 CATTCTGGAGGTAGGAAGCTGGG - Intergenic
1053472705 9:38358245-38358267 CAGCTGGGAGGTAGCAAGGGTGG - Intergenic
1054803900 9:69379860-69379882 AAGCGAGGAGACAGGAAGGTCGG - Intronic
1056736576 9:89214963-89214985 CAGCCAGGTGATAGGGAGGGAGG + Intergenic
1056786824 9:89598507-89598529 CAGCCAGGAGGTGGCAAAGCTGG - Intergenic
1058649515 9:107161766-107161788 CAGGAAGGAGGCAGGAAGGGAGG - Intergenic
1059216957 9:112573323-112573345 CAGCCAGGAGACAGGAAGCCTGG + Intronic
1059551960 9:115237901-115237923 CAGCCAGGGGGTTGGCAGGGAGG - Intronic
1059571763 9:115445329-115445351 CTGTCAGGAGGGAGGAAGGATGG - Intergenic
1059977731 9:119736107-119736129 AGGGCAGGAGGTAGGAAGGAAGG + Intergenic
1060215900 9:121738031-121738053 CAACCTGGAGGTGGGGAGGTGGG + Intronic
1061287656 9:129633301-129633323 CAGCCATGAGACAAGAAGGTGGG - Intronic
1061395245 9:130340204-130340226 CAGCCAGGGGGAGGGAAGGACGG + Intronic
1061471763 9:130832496-130832518 CAGCCAGGAGGTAGGAAGGTAGG - Intronic
1061508837 9:131048440-131048462 CAGCCAAGGGGTAAGAAGGAAGG - Intronic
1061640304 9:131948993-131949015 CAGGAAGAAGGTAGGCAGGTTGG - Intronic
1062054228 9:134462636-134462658 CCGCTCGGAGGTAGGAGGGTAGG + Intergenic
1062064394 9:134518349-134518371 CAGCCAGGCTGCAGGAATGTGGG + Intergenic
1062177892 9:135174451-135174473 CGGCCAGGAGGTGGGCAGGGAGG - Intergenic
1062254184 9:135613411-135613433 CAGGCAGGAGGAAGGAGGGCAGG + Intergenic
1062317051 9:135972559-135972581 CAGACAGAAAGTAGAAAGGTGGG - Intergenic
1062383464 9:136298756-136298778 GAGACAGGAAGTAGGAAGGTAGG + Intronic
1062445949 9:136594831-136594853 GAGACAGGAAGTAGAAAGGTGGG + Intergenic
1062480303 9:136747942-136747964 CAGGCTGGAGGTTGGAAGGCTGG - Intronic
1062714523 9:138000516-138000538 CAGGCAGGAGGCAGAAAGATAGG - Intronic
1186206731 X:7208649-7208671 AAGGAAGGAGGAAGGAAGGTAGG - Intergenic
1186664273 X:11702636-11702658 CAGCCAGGAACTAGTGAGGTGGG + Intergenic
1188060995 X:25601953-25601975 CAGGGAGGAGGGAGGAAGGGAGG - Intergenic
1188779360 X:34261184-34261206 AAGACAGGAGGTAGGCAAGTAGG + Intergenic
1189668287 X:43380915-43380937 CAGCCAGGAGGTTGGTAGCCTGG + Intergenic
1190740039 X:53282597-53282619 CAGCAGGGAGGCAGGAAGGCTGG - Intronic
1191070382 X:56394449-56394471 CAGCAAGGTGGCAGCAAGGTTGG - Intergenic
1192228326 X:69245302-69245324 CTGTCAGGGGGTAGGAGGGTAGG + Intergenic
1193440537 X:81535466-81535488 CAGCCTGGAGGCAGAAAGGGTGG + Intergenic
1193569260 X:83122157-83122179 CAGCCAGGAAGAAGGAATCTGGG - Intergenic
1195679665 X:107535028-107535050 AAGACAGGAGGTTGGGAGGTTGG - Intronic
1196590534 X:117481763-117481785 CAGCTAGGAGGCAGGTAGCTTGG - Intergenic
1198936063 X:141903711-141903733 CATCCTGGAGGTGGGAAGGAAGG + Intergenic
1199362546 X:146939861-146939883 AAGACAGGAGGAAGGAAGGAAGG - Intergenic
1199758948 X:150890679-150890701 CAGCCAGGAGAAAGGCAGGCTGG + Intronic
1199766237 X:150943514-150943536 AAGCCATGAGGAAGAAAGGTCGG + Intergenic
1200212091 X:154351248-154351270 CACCCAGGTGGCAGGAAGGGAGG + Intronic
1201499890 Y:14630310-14630332 GAGCCAGGAGAAAGGAATGTAGG + Intronic