ID: 1061472037

View in Genome Browser
Species Human (GRCh38)
Location 9:130834948-130834970
Sequence GCGCAACTCCACCGCGGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2718
Summary {0: 1, 1: 0, 2: 1, 3: 45, 4: 2671}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061472037_1061472044 23 Left 1061472037 9:130834948-130834970 CCCAGGCCGCGGTGGAGTTGCGC 0: 1
1: 0
2: 1
3: 45
4: 2671
Right 1061472044 9:130834994-130835016 CAGGCCTGCACCCTCCCCGCCGG No data
1061472037_1061472043 4 Left 1061472037 9:130834948-130834970 CCCAGGCCGCGGTGGAGTTGCGC 0: 1
1: 0
2: 1
3: 45
4: 2671
Right 1061472043 9:130834975-130834997 CTTCTAAAGTGGAGTGGAGCAGG No data
1061472037_1061472042 -2 Left 1061472037 9:130834948-130834970 CCCAGGCCGCGGTGGAGTTGCGC 0: 1
1: 0
2: 1
3: 45
4: 2671
Right 1061472042 9:130834969-130834991 GCGCGGCTTCTAAAGTGGAGTGG No data
1061472037_1061472045 24 Left 1061472037 9:130834948-130834970 CCCAGGCCGCGGTGGAGTTGCGC 0: 1
1: 0
2: 1
3: 45
4: 2671
Right 1061472045 9:130834995-130835017 AGGCCTGCACCCTCCCCGCCGGG No data
1061472037_1061472041 -7 Left 1061472037 9:130834948-130834970 CCCAGGCCGCGGTGGAGTTGCGC 0: 1
1: 0
2: 1
3: 45
4: 2671
Right 1061472041 9:130834964-130834986 GTTGCGCGCGGCTTCTAAAGTGG No data
1061472037_1061472046 25 Left 1061472037 9:130834948-130834970 CCCAGGCCGCGGTGGAGTTGCGC 0: 1
1: 0
2: 1
3: 45
4: 2671
Right 1061472046 9:130834996-130835018 GGCCTGCACCCTCCCCGCCGGGG No data
1061472037_1061472048 29 Left 1061472037 9:130834948-130834970 CCCAGGCCGCGGTGGAGTTGCGC 0: 1
1: 0
2: 1
3: 45
4: 2671
Right 1061472048 9:130835000-130835022 TGCACCCTCCCCGCCGGGGCTGG No data
1061472037_1061472049 30 Left 1061472037 9:130834948-130834970 CCCAGGCCGCGGTGGAGTTGCGC 0: 1
1: 0
2: 1
3: 45
4: 2671
Right 1061472049 9:130835001-130835023 GCACCCTCCCCGCCGGGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061472037 Original CRISPR GCGCAACTCCACCGCGGCCT GGG (reversed) Intronic
Too many off-targets to display for this crispr