ID: 1061473152

View in Genome Browser
Species Human (GRCh38)
Location 9:130843608-130843630
Sequence CTTTAACCCATTTGGGTACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061473152_1061473165 20 Left 1061473152 9:130843608-130843630 CCAGGTACCCAAATGGGTTAAAG No data
Right 1061473165 9:130843651-130843673 CGAGGTGATGGGGAGGAGGAAGG No data
1061473152_1061473166 25 Left 1061473152 9:130843608-130843630 CCAGGTACCCAAATGGGTTAAAG No data
Right 1061473166 9:130843656-130843678 TGATGGGGAGGAGGAAGGACCGG No data
1061473152_1061473157 -3 Left 1061473152 9:130843608-130843630 CCAGGTACCCAAATGGGTTAAAG No data
Right 1061473157 9:130843628-130843650 AAGGAGAAGCATCCTGTTGTGGG No data
1061473152_1061473158 2 Left 1061473152 9:130843608-130843630 CCAGGTACCCAAATGGGTTAAAG No data
Right 1061473158 9:130843633-130843655 GAAGCATCCTGTTGTGGGCGAGG No data
1061473152_1061473159 8 Left 1061473152 9:130843608-130843630 CCAGGTACCCAAATGGGTTAAAG No data
Right 1061473159 9:130843639-130843661 TCCTGTTGTGGGCGAGGTGATGG No data
1061473152_1061473163 13 Left 1061473152 9:130843608-130843630 CCAGGTACCCAAATGGGTTAAAG No data
Right 1061473163 9:130843644-130843666 TTGTGGGCGAGGTGATGGGGAGG No data
1061473152_1061473161 9 Left 1061473152 9:130843608-130843630 CCAGGTACCCAAATGGGTTAAAG No data
Right 1061473161 9:130843640-130843662 CCTGTTGTGGGCGAGGTGATGGG No data
1061473152_1061473164 16 Left 1061473152 9:130843608-130843630 CCAGGTACCCAAATGGGTTAAAG No data
Right 1061473164 9:130843647-130843669 TGGGCGAGGTGATGGGGAGGAGG No data
1061473152_1061473156 -4 Left 1061473152 9:130843608-130843630 CCAGGTACCCAAATGGGTTAAAG No data
Right 1061473156 9:130843627-130843649 AAAGGAGAAGCATCCTGTTGTGG No data
1061473152_1061473162 10 Left 1061473152 9:130843608-130843630 CCAGGTACCCAAATGGGTTAAAG No data
Right 1061473162 9:130843641-130843663 CTGTTGTGGGCGAGGTGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061473152 Original CRISPR CTTTAACCCATTTGGGTACC TGG (reversed) Intronic