ID: 1061473154

View in Genome Browser
Species Human (GRCh38)
Location 9:130843615-130843637
Sequence GCTTCTCCTTTAACCCATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061473154_1061473157 -10 Left 1061473154 9:130843615-130843637 CCCAAATGGGTTAAAGGAGAAGC No data
Right 1061473157 9:130843628-130843650 AAGGAGAAGCATCCTGTTGTGGG No data
1061473154_1061473159 1 Left 1061473154 9:130843615-130843637 CCCAAATGGGTTAAAGGAGAAGC No data
Right 1061473159 9:130843639-130843661 TCCTGTTGTGGGCGAGGTGATGG No data
1061473154_1061473162 3 Left 1061473154 9:130843615-130843637 CCCAAATGGGTTAAAGGAGAAGC No data
Right 1061473162 9:130843641-130843663 CTGTTGTGGGCGAGGTGATGGGG No data
1061473154_1061473164 9 Left 1061473154 9:130843615-130843637 CCCAAATGGGTTAAAGGAGAAGC No data
Right 1061473164 9:130843647-130843669 TGGGCGAGGTGATGGGGAGGAGG No data
1061473154_1061473166 18 Left 1061473154 9:130843615-130843637 CCCAAATGGGTTAAAGGAGAAGC No data
Right 1061473166 9:130843656-130843678 TGATGGGGAGGAGGAAGGACCGG No data
1061473154_1061473167 28 Left 1061473154 9:130843615-130843637 CCCAAATGGGTTAAAGGAGAAGC No data
Right 1061473167 9:130843666-130843688 GAGGAAGGACCGGTTAGAGAAGG No data
1061473154_1061473163 6 Left 1061473154 9:130843615-130843637 CCCAAATGGGTTAAAGGAGAAGC No data
Right 1061473163 9:130843644-130843666 TTGTGGGCGAGGTGATGGGGAGG No data
1061473154_1061473165 13 Left 1061473154 9:130843615-130843637 CCCAAATGGGTTAAAGGAGAAGC No data
Right 1061473165 9:130843651-130843673 CGAGGTGATGGGGAGGAGGAAGG No data
1061473154_1061473161 2 Left 1061473154 9:130843615-130843637 CCCAAATGGGTTAAAGGAGAAGC No data
Right 1061473161 9:130843640-130843662 CCTGTTGTGGGCGAGGTGATGGG No data
1061473154_1061473158 -5 Left 1061473154 9:130843615-130843637 CCCAAATGGGTTAAAGGAGAAGC No data
Right 1061473158 9:130843633-130843655 GAAGCATCCTGTTGTGGGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061473154 Original CRISPR GCTTCTCCTTTAACCCATTT GGG (reversed) Intronic