ID: 1061473157

View in Genome Browser
Species Human (GRCh38)
Location 9:130843628-130843650
Sequence AAGGAGAAGCATCCTGTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061473154_1061473157 -10 Left 1061473154 9:130843615-130843637 CCCAAATGGGTTAAAGGAGAAGC No data
Right 1061473157 9:130843628-130843650 AAGGAGAAGCATCCTGTTGTGGG No data
1061473152_1061473157 -3 Left 1061473152 9:130843608-130843630 CCAGGTACCCAAATGGGTTAAAG No data
Right 1061473157 9:130843628-130843650 AAGGAGAAGCATCCTGTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061473157 Original CRISPR AAGGAGAAGCATCCTGTTGT GGG Intronic