ID: 1061481751

View in Genome Browser
Species Human (GRCh38)
Location 9:130900867-130900889
Sequence CGTCCACACAGGCCTCTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061481751_1061481764 17 Left 1061481751 9:130900867-130900889 CCAGCCAGAGGCCTGTGTGGACG No data
Right 1061481764 9:130900907-130900929 GGGTTAGGGGCACCAGAAGGAGG No data
1061481751_1061481763 14 Left 1061481751 9:130900867-130900889 CCAGCCAGAGGCCTGTGTGGACG No data
Right 1061481763 9:130900904-130900926 GAAGGGTTAGGGGCACCAGAAGG No data
1061481751_1061481761 3 Left 1061481751 9:130900867-130900889 CCAGCCAGAGGCCTGTGTGGACG No data
Right 1061481761 9:130900893-130900915 ACAGGTGGCAGGAAGGGTTAGGG No data
1061481751_1061481757 -8 Left 1061481751 9:130900867-130900889 CCAGCCAGAGGCCTGTGTGGACG No data
Right 1061481757 9:130900882-130900904 TGTGGACGAGGACAGGTGGCAGG No data
1061481751_1061481758 -4 Left 1061481751 9:130900867-130900889 CCAGCCAGAGGCCTGTGTGGACG No data
Right 1061481758 9:130900886-130900908 GACGAGGACAGGTGGCAGGAAGG No data
1061481751_1061481760 2 Left 1061481751 9:130900867-130900889 CCAGCCAGAGGCCTGTGTGGACG No data
Right 1061481760 9:130900892-130900914 GACAGGTGGCAGGAAGGGTTAGG No data
1061481751_1061481766 27 Left 1061481751 9:130900867-130900889 CCAGCCAGAGGCCTGTGTGGACG No data
Right 1061481766 9:130900917-130900939 CACCAGAAGGAGGTAGGCACTGG No data
1061481751_1061481762 4 Left 1061481751 9:130900867-130900889 CCAGCCAGAGGCCTGTGTGGACG No data
Right 1061481762 9:130900894-130900916 CAGGTGGCAGGAAGGGTTAGGGG No data
1061481751_1061481759 -3 Left 1061481751 9:130900867-130900889 CCAGCCAGAGGCCTGTGTGGACG No data
Right 1061481759 9:130900887-130900909 ACGAGGACAGGTGGCAGGAAGGG No data
1061481751_1061481765 21 Left 1061481751 9:130900867-130900889 CCAGCCAGAGGCCTGTGTGGACG No data
Right 1061481765 9:130900911-130900933 TAGGGGCACCAGAAGGAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061481751 Original CRISPR CGTCCACACAGGCCTCTGGC TGG (reversed) Intergenic
No off target data available for this crispr