ID: 1061481765

View in Genome Browser
Species Human (GRCh38)
Location 9:130900911-130900933
Sequence TAGGGGCACCAGAAGGAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061481749_1061481765 26 Left 1061481749 9:130900862-130900884 CCAAGCCAGCCAGAGGCCTGTGT No data
Right 1061481765 9:130900911-130900933 TAGGGGCACCAGAAGGAGGTAGG No data
1061481753_1061481765 17 Left 1061481753 9:130900871-130900893 CCAGAGGCCTGTGTGGACGAGGA No data
Right 1061481765 9:130900911-130900933 TAGGGGCACCAGAAGGAGGTAGG No data
1061481755_1061481765 10 Left 1061481755 9:130900878-130900900 CCTGTGTGGACGAGGACAGGTGG No data
Right 1061481765 9:130900911-130900933 TAGGGGCACCAGAAGGAGGTAGG No data
1061481751_1061481765 21 Left 1061481751 9:130900867-130900889 CCAGCCAGAGGCCTGTGTGGACG No data
Right 1061481765 9:130900911-130900933 TAGGGGCACCAGAAGGAGGTAGG No data
1061481748_1061481765 30 Left 1061481748 9:130900858-130900880 CCAGCCAAGCCAGCCAGAGGCCT No data
Right 1061481765 9:130900911-130900933 TAGGGGCACCAGAAGGAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061481765 Original CRISPR TAGGGGCACCAGAAGGAGGT AGG Intergenic
No off target data available for this crispr