ID: 1061485055

View in Genome Browser
Species Human (GRCh38)
Location 9:130916299-130916321
Sequence CACTGGCAAAATCAACTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 227}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061485055_1061485066 29 Left 1061485055 9:130916299-130916321 CCATTCAGTTGATTTTGCCAGTG 0: 1
1: 0
2: 2
3: 27
4: 227
Right 1061485066 9:130916351-130916373 CCACTGACAGCCTTTGCCACGGG No data
1061485055_1061485064 28 Left 1061485055 9:130916299-130916321 CCATTCAGTTGATTTTGCCAGTG 0: 1
1: 0
2: 2
3: 27
4: 227
Right 1061485064 9:130916350-130916372 ACCACTGACAGCCTTTGCCACGG No data
1061485055_1061485061 4 Left 1061485055 9:130916299-130916321 CCATTCAGTTGATTTTGCCAGTG 0: 1
1: 0
2: 2
3: 27
4: 227
Right 1061485061 9:130916326-130916348 ACGGAGTACGCCCGCAGTTTGGG No data
1061485055_1061485060 3 Left 1061485055 9:130916299-130916321 CCATTCAGTTGATTTTGCCAGTG 0: 1
1: 0
2: 2
3: 27
4: 227
Right 1061485060 9:130916325-130916347 CACGGAGTACGCCCGCAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061485055 Original CRISPR CACTGGCAAAATCAACTGAA TGG (reversed) Intronic
900743792 1:4346462-4346484 CACTGGCCAGATGCACTGAATGG + Intergenic
903534750 1:24059620-24059642 AACTGGCAAAATCCACACAACGG + Intronic
908726102 1:67178728-67178750 CACAGCCAATATCATCTGAATGG - Intronic
910069483 1:83194480-83194502 CACTGGCAAAACAAGCTAAATGG - Intergenic
910336117 1:86133460-86133482 CACAGCCAATATCTACTGAATGG - Intronic
911504516 1:98732235-98732257 CCTTGGCAAAATAAACTAAATGG - Intronic
913830112 1:123228433-123228455 CACTGGCAAATTCCACAAAAAGG - Intergenic
915753161 1:158231370-158231392 CACTGGAGAAATCATCTGGACGG + Intergenic
1062967775 10:1623329-1623351 CACGGGCAAAGTCTATTGAATGG + Intronic
1065372802 10:25007062-25007084 CACAGGTAAAATCAAGTAAAGGG - Intronic
1066921199 10:41499659-41499681 CACTAGCAAACTCCACAGAAAGG - Intergenic
1066921320 10:41502034-41502056 CACTAGCAAACTCCACAGAAAGG - Intergenic
1066921442 10:41504410-41504432 CACTAGCAAACTCCACAGAAAGG - Intergenic
1066921564 10:41506785-41506807 CACTAGCAAACTCCACAGAAAGG - Intergenic
1066921907 10:41513571-41513593 CACTAGCAAACTCCACAGAAAGG - Intergenic
1066922154 10:41518321-41518343 CACTAGCAAACTCCACAGAAAGG - Intergenic
1066922257 10:41520356-41520378 CACTAGCAAACTCCACAGAAAGG - Intergenic
1066922383 10:41522732-41522754 CACTAGCAAACTCCACAGAAAGG - Intergenic
1066922502 10:41525107-41525129 CACTAGCAAACTCCACAGAAAGG - Intergenic
1066922730 10:41529518-41529540 CACTAGCAAACTCCACAGAAAGG - Intergenic
1066922845 10:41531893-41531915 CACTAGCAAACTCCACAGAAAGG - Intergenic
1066922970 10:41534268-41534290 CACTAGCAAACTCCACAGAAAGG - Intergenic
1066923088 10:41536643-41536665 CACTAGCAAACTCCACAGAAAGG - Intergenic
1066923210 10:41539018-41539040 CACTAGCAAACTCCACAGAAAGG - Intergenic
1067278782 10:44855785-44855807 CAATGGCAAAATCAACTCAATGG - Intergenic
1067710574 10:48648358-48648380 CACTGCCCCAATCAACTGCAAGG - Intronic
1067752312 10:48979689-48979711 CACTGCCAGAATCAACTGAATGG - Intronic
1067776203 10:49166565-49166587 GACTGCCAAGAGCAACTGAAAGG + Intronic
1073718918 10:106142695-106142717 CAAGGGCAGAGTCAACTGAATGG - Intergenic
1077650472 11:3967049-3967071 CACTGACAAAATGAACAAAAAGG + Intronic
1077930451 11:6725882-6725904 CACTGGAAAAATTAAGTAAACGG + Intergenic
1081108947 11:39107571-39107593 CACTGCCAACATGGACTGAAGGG - Intergenic
1081142070 11:39513809-39513831 CACTGCCAATTTGAACTGAAAGG + Intergenic
1082320552 11:50802227-50802249 CACTTGCAGATTCTACTGAAAGG - Intergenic
1082325130 11:51130849-51130871 CACTTGCAGAATCCACGGAAAGG - Intergenic
1082333663 11:51254617-51254639 CACTTGCAGAATCAAAAGAAAGG - Intergenic
1082347278 11:51452693-51452715 CACTTGCAGAATCAAAAGAAAGG - Intergenic
1082349330 11:51482441-51482463 CACTTGCAGAATCAAAAGAAAGG - Intergenic
1082375342 11:51860582-51860604 CACTTGCAGAATCAAAAGAAAGG - Intergenic
1082394743 11:52143083-52143105 CACTTGCAGAATCAAAAGAAAGG - Intergenic
1082397262 11:52179634-52179656 CACTTGCAGAATCAAAAGAAAGG - Intergenic
1082399320 11:52209381-52209403 CACTTGCAGAATCAAAAGAAAGG - Intergenic
1082399918 11:52217883-52217905 CACTTGCAGAATCAAAAGAAAGG - Intergenic
1082425145 11:52582575-52582597 CACTTGCAGAATCAAAAGAAAGG - Intergenic
1082425612 11:52589374-52589396 CACTGGCAGAATCCAAAGAAAGG - Intergenic
1082453997 11:52999913-52999935 CACTTGCAGAATCAAAAGAAAGG - Intergenic
1082455098 11:53016061-53016083 CACTTGCAGAATCAAAAGAAAGG - Intergenic
1082458011 11:53058571-53058593 CACTTGCAGAATCAAAAGAAAGG - Intergenic
1082483648 11:53428600-53428622 CACTTGCAGAATCAAAAGAAAGG - Intergenic
1082486183 11:53465133-53465155 CACTTGCAGAATCAAAAGAAAGG - Intergenic
1082501600 11:53687124-53687146 CACTTGCAGAATCAAAAGAAAGG - Intergenic
1082516757 11:53906483-53906505 CACTTGCAGAATCAAAAGAAAGG - Intergenic
1082516870 11:53908182-53908204 CACTTGCAGAATCAAAAGAAAGG - Intergenic
1082517281 11:53914134-53914156 CACTTGCAGAATCAAAAGAAAGG - Intergenic
1082526693 11:54050331-54050353 CACTTGCAGAATCAAAAGAAAGG - Intergenic
1085133561 11:74063656-74063678 CACAGCCAATATCATCTGAATGG + Intronic
1086020094 11:82217162-82217184 CACTGGAAAAAGTAAATGAAAGG - Intergenic
1086611103 11:88757255-88757277 CACTGGCAAAATGATGTGGAGGG - Intronic
1086839804 11:91671117-91671139 CACAGCCAACATCAACTGAATGG + Intergenic
1087247840 11:95860621-95860643 CACTGGCAGAATAAAAAGAAAGG + Intronic
1088375605 11:109137731-109137753 CACTGAAAAAATAAATTGAAAGG - Intergenic
1094522099 12:31202350-31202372 TACTGGCAAAATCTCCTGCATGG - Intergenic
1097578581 12:61425894-61425916 CAGTGGCAAAATTAGCTAAACGG + Intergenic
1097698541 12:62798081-62798103 CCTTGGCAAAATAAACTGAATGG - Intronic
1101382525 12:104226674-104226696 CATTTGCAAAATGAAGTGAATGG + Intronic
1104744961 12:131204739-131204761 CACTGCCAAAATCAGGTCAAAGG + Intergenic
1104789444 12:131472661-131472683 CACTGCCAAAATCAGGTCAAAGG - Intergenic
1107263231 13:38519950-38519972 CATTTGAATAATCAACTGAATGG + Intergenic
1107408093 13:40133902-40133924 CATTGTGAAAAACAACTGAAAGG + Intergenic
1109926175 13:69142284-69142306 CAATGGAAAAAACGACTGAAGGG + Intergenic
1114670626 14:24408990-24409012 CCCTGGCAGCTTCAACTGAATGG - Exonic
1114808030 14:25860507-25860529 CAATGAGAAAATCAAATGAATGG - Intergenic
1115020553 14:28674999-28675021 AACTAGCAAAATCACATGAAAGG - Intergenic
1116709622 14:48350673-48350695 AACTGGAAATATCATCTGAAAGG - Intergenic
1116709794 14:48353341-48353363 CTGTGGCAAATTCAACTGAAAGG - Intergenic
1117649035 14:57882906-57882928 CACTGGCAAAATCAAGTCACAGG - Intronic
1118168286 14:63359530-63359552 CACTGCCAAATTGGACTGAAAGG + Intergenic
1118257130 14:64215042-64215064 CTCTGAGAAACTCAACTGAAAGG - Intronic
1120487736 14:85135896-85135918 CACTGGCAAAATCAAAGTCAAGG - Intergenic
1121456178 14:94040230-94040252 CACTGGCAAAACAATCTGAATGG - Intronic
1122642510 14:103168401-103168423 CACTGTCCAAGTCAACTGAGTGG - Intergenic
1123004725 14:105315611-105315633 CAATGGCAAGATCAACTGGGAGG - Intronic
1123905402 15:24915608-24915630 CACTGGGAAAACAAACTGATTGG - Intronic
1125678378 15:41514543-41514565 CACCTGCAAAATCATATGAAGGG + Intergenic
1126079552 15:44946049-44946071 CAGAGGCAAAAGCATCTGAAGGG + Intergenic
1126814544 15:52441953-52441975 CACTCCCAAAATCTTCTGAAAGG + Intronic
1127189196 15:56511636-56511658 CACAGCCAACATCTACTGAATGG - Intergenic
1129112683 15:73346941-73346963 CCCTGGCTAAACCCACTGAACGG - Intronic
1133823116 16:9254398-9254420 CCATGGCAAAGTCAACTGCAAGG - Intergenic
1134115611 16:11545711-11545733 AATGGGCAAAATCAACTTAATGG - Intergenic
1134469408 16:14510028-14510050 CAATGGCAAAAACAACTGGTAGG + Intronic
1136618808 16:31414586-31414608 CACTGGCAAAAGCAGCTTCAGGG - Exonic
1139735430 16:68983654-68983676 CACTGCCACACTCAACTGCAGGG - Intronic
1142826198 17:2512863-2512885 CACTGGCAAGACCAGCAGAACGG - Intergenic
1143964282 17:10745605-10745627 CAGTGCCACAATCATCTGAAGGG + Intergenic
1145684887 17:26642716-26642738 CACTTGCAAATTCAACAGAAAGG - Intergenic
1145684937 17:26643990-26644012 CACTTGCAAATTCAACAGAAAGG - Intergenic
1146737252 17:35249131-35249153 CACTGACAAAATGAGATGAAAGG - Intronic
1151151281 17:72089571-72089593 CACGGGCAAAATCTTCTGACTGG - Intergenic
1151299948 17:73216822-73216844 CACTGGAAAAATAAAATGAAAGG - Intronic
1157641987 18:49224969-49224991 CAGTGTCAAATACAACTGAAAGG + Intronic
1157924767 18:51751680-51751702 CACTGGCCAAATCAAGTCACGGG - Intergenic
1158372099 18:56818837-56818859 AACTGGAAAAATCACCTGAATGG - Intronic
1158492618 18:57923858-57923880 CACTGCCAAAATCCACAGAGAGG - Intergenic
1158512760 18:58106189-58106211 CACTGCCCAAATCAACTGTCAGG + Intronic
1158791889 18:60790687-60790709 CGCTGTAAAAATCAATTGAATGG + Intergenic
1160071294 18:75630516-75630538 CACTTGCAATATTATCTGAAAGG - Intergenic
1160454448 18:78990351-78990373 AACTGGCTAAACCATCTGAAGGG - Intronic
1164518875 19:28961560-28961582 CACTGGCAAAATCAAGTCATCGG + Intergenic
1164614061 19:29655600-29655622 GGCTGGCAAAGTCATCTGAAGGG - Intergenic
925173109 2:1763948-1763970 CACAGCCAATATCAACTGAATGG + Intergenic
925228009 2:2203153-2203175 CACAGCCAATATCAACTGAATGG + Intronic
928106998 2:28476985-28477007 AACTGGCAGAAGCAACTGAGAGG + Intronic
929772258 2:44902318-44902340 CACTTACAAAATGAACTCAAAGG - Intergenic
930280135 2:49360138-49360160 CACTGGAAAAATGAAGAGAATGG + Intergenic
931024634 2:58095521-58095543 CACTGACAATATCAACAAAAAGG - Intronic
934186344 2:89680357-89680379 CATTTTCAAAATCAAGTGAACGG - Intergenic
938657520 2:133449355-133449377 CTTGGGCAAAAGCAACTGAATGG + Intronic
939862351 2:147435435-147435457 CACTGGCAAACTCAAATCATGGG + Intergenic
940001836 2:148974251-148974273 CCCTGATGAAATCAACTGAAAGG - Intronic
940302516 2:152190100-152190122 CACTCCCAGAATCGACTGAACGG + Intergenic
942954272 2:181756086-181756108 CATTGGCCAAATCAGCTCAATGG + Intergenic
943845822 2:192646129-192646151 CACTGGGAAAAAGAACTAAAAGG - Intergenic
945216253 2:207437130-207437152 CAAAGGCAAAACCAACTGACAGG - Intergenic
945347974 2:208741515-208741537 CACTAGCAAAATCAGATGTATGG - Intronic
945469000 2:210205385-210205407 AAATGGCAAAATTAACTGCATGG - Intronic
947944832 2:234092634-234092656 CAATTGCAAATGCAACTGAAAGG - Intergenic
948132542 2:235611141-235611163 AACTGGCAAAATGAAGTGAGAGG - Intronic
1168845695 20:943070-943092 CACTGGCAATAGCAATAGAATGG - Intergenic
1169858477 20:10128334-10128356 CACAGGCAAAATAAAATGATGGG + Intergenic
1169960864 20:11158807-11158829 CTCTGGCAAAATCCTCTGATTGG - Intergenic
1170856940 20:20065566-20065588 CCCTGGCCAAGTCAACTGCAAGG + Intronic
1171574064 20:26283412-26283434 CACTTGCAAATTCTACTAAAAGG - Intergenic
1171574547 20:26292301-26292323 CACTTGCAAATTCTACTAAAAGG - Intergenic
1171954300 20:31448287-31448309 AAATTGCAAAATCAAGTGAAAGG - Intronic
1172199977 20:33118585-33118607 CAATGACAAAACCAAGTGAACGG + Intergenic
1175503518 20:59466619-59466641 GACTGGCAACATCAAGAGAAAGG + Intergenic
1176029383 20:63004761-63004783 TACTTGCAAAATCAAGTGTATGG - Intergenic
1176378220 21:6097514-6097536 CACGGGCAAAATCAAAAGATGGG - Intergenic
1177014311 21:15765504-15765526 AAATGGCAAAATGTACTGAAGGG - Intronic
1177833466 21:26166167-26166189 CACTTGCAAAATCAGCTTCAGGG + Intronic
1177955005 21:27586575-27586597 CACTGGGAATATTTACTGAATGG - Intergenic
1178921156 21:36739179-36739201 CACTGGCAGACACAGCTGAAGGG - Intronic
1179745253 21:43440732-43440754 CACGGGCAAAATCAAAAGATGGG + Intergenic
1180112699 21:45671070-45671092 CACTGGCAAGATCCAGTGATGGG + Intronic
1180677895 22:17600775-17600797 TAGTGGCAAAATCAAATTAAGGG + Intronic
1181596494 22:23918345-23918367 CACTGGCCAAGGCAACTAAAAGG - Intergenic
1181656818 22:24308216-24308238 AACTGGCAAAATTTAATGAAAGG - Intronic
1182220015 22:28751205-28751227 CAATGGAAAAATTAACAGAATGG + Intronic
1182530223 22:30949828-30949850 CACTGGCAGCATCACCTGAAAGG + Exonic
1183757211 22:39779590-39779612 CACTGGCAAAATTAAGTACATGG + Intronic
949995653 3:9614469-9614491 CAATGGCACAACCAACTGAAAGG - Intergenic
951412336 3:22380176-22380198 CACTTGCACCTTCAACTGAAGGG - Intergenic
952651618 3:35734478-35734500 CAGTGACAAAATCAACTGTTTGG - Intronic
955169533 3:56549795-56549817 CAATGACAAAATCACCTAAAAGG - Intergenic
955208336 3:56917715-56917737 AACTGGCAAACTCAACAGCAAGG + Intronic
957129337 3:76203233-76203255 CATTGGCCAAACCAACTGGAAGG - Intronic
957696219 3:83640892-83640914 CAGAGCCAATATCAACTGAATGG + Intergenic
959898953 3:111638694-111638716 CACAGGCATAATCAACTTCAGGG + Intronic
960176265 3:114521276-114521298 CCTTGGCAAAATCATTTGAAAGG - Intronic
962140074 3:132781003-132781025 GACTGGGCAAACCAACTGAAAGG - Intergenic
962550915 3:136490420-136490442 CAGTGGCAAAATACACAGAAAGG + Intronic
963769373 3:149374184-149374206 CACTGGTAAAATAAAATCAATGG - Intronic
964243807 3:154626888-154626910 CACTGGTGAAAGAAACTGAAGGG + Intergenic
964581507 3:158244231-158244253 TATTGCCAATATCAACTGAATGG - Intronic
964948381 3:162255381-162255403 CACTGCCAGCTTCAACTGAAAGG - Intergenic
965098483 3:164267345-164267367 CACTGACAAAATAAACACAAGGG + Intergenic
965313906 3:167166710-167166732 CACTGCCAAAATAAAAAGAATGG - Intergenic
969806060 4:9609632-9609654 CACTGGCCAAAACAACTCATAGG + Intergenic
971279348 4:25229735-25229757 CAGTAACAACATCAACTGAAAGG - Intronic
973935844 4:55845762-55845784 CACAGCCAATATCTACTGAATGG + Intergenic
974638466 4:64596767-64596789 CACTGGCAAATTCCACATAATGG - Intergenic
975036659 4:69692839-69692861 CACAGCCAACCTCAACTGAATGG - Intergenic
975907938 4:79237566-79237588 CACTGTCAAAATGAAGTGAAAGG - Intronic
979569082 4:122194825-122194847 CAGTGGAAAAATCTACTGAAAGG - Intronic
983703453 4:170627664-170627686 CACTAGCAAATCCAACTCAACGG - Intergenic
986366099 5:7033152-7033174 CACTGGTAAAATTAAGTGCATGG + Intergenic
986841435 5:11702152-11702174 TACAGGCAAAATCAGCAGAATGG + Intronic
987279380 5:16397086-16397108 CACAGCCAATATCATCTGAATGG - Intergenic
988059402 5:26148382-26148404 CACTGGCAAAATTGACTAGAAGG + Intergenic
992232788 5:74680118-74680140 CACTGCCAGCATGAACTGAAAGG + Intronic
992480391 5:77145741-77145763 CACTGCCAACTTAAACTGAAAGG + Intergenic
993005757 5:82426602-82426624 CAGTTGCAAAAGCAGCTGAAAGG - Intergenic
993506697 5:88717275-88717297 CACCTTCAAAATCAAGTGAAAGG + Intergenic
994267256 5:97732771-97732793 AACTGGCATAATTAACTGGAAGG + Intergenic
995178807 5:109210604-109210626 CACAGCCAATATCTACTGAATGG - Intergenic
998111874 5:139508696-139508718 CACTGCCAAAACCATCAGAAAGG + Intergenic
999463015 5:151772636-151772658 CACTGCAAGAATCAAATGAAAGG - Intronic
1001330165 5:170756298-170756320 CACTGGCAAAATCAAGTCCCTGG - Intergenic
1002353327 5:178601430-178601452 CAGTGGAAAAATAAAATGAAGGG + Intergenic
1002515439 5:179754664-179754686 CTTTGTCAAAATCACCTGAAGGG + Intronic
1002534958 5:179870931-179870953 AACTGGCAACAACAACAGAAAGG + Intronic
1002820321 6:718724-718746 CACTGGCACACTCACCTGAATGG + Intergenic
1003078746 6:3004181-3004203 CACTGGCCATCTCAACTGCAAGG + Intronic
1003084592 6:3051541-3051563 CACTGGCCATCTCAACTGCAAGG - Intergenic
1004248714 6:14004490-14004512 TACTGGGAAAATCAAATGAACGG - Intergenic
1005245592 6:23880941-23880963 CATTGGCAGACTCAACTGAAAGG + Intergenic
1005262397 6:24075367-24075389 CACGGCCAACATCTACTGAATGG - Intergenic
1005356112 6:24984980-24985002 CACCTGCCAAATCAACTTAATGG + Intronic
1007628089 6:43257804-43257826 CACTGACATGATCAACTGCAGGG - Exonic
1009352127 6:62694044-62694066 AACTTGCAAAAACAAATGAATGG + Intergenic
1010474078 6:76264662-76264684 CACTGGCATGAGCAACTGCAAGG - Intergenic
1014873358 6:126624570-126624592 CACTGGCACAATTAAGTGAAAGG + Intergenic
1017624177 6:156331263-156331285 CACTGGCAAAATTAAGTACATGG - Intergenic
1019211101 6:170405800-170405822 CCCTGGCAAAATGAAACGAAAGG - Exonic
1019646251 7:2130613-2130635 CCCTGGCATAATAAACTGAGAGG - Intronic
1023024813 7:36040899-36040921 CACTGGAAGAATAAAATGAAGGG + Intergenic
1023068488 7:36403526-36403548 CAATGGCAAAACCAACTTCAGGG + Intronic
1023673817 7:42608631-42608653 CACTGGAAAACTGAGCTGAAGGG + Intergenic
1025876654 7:65486608-65486630 AACTGGCAGAATCAACAGAAAGG + Intergenic
1025935247 7:66030577-66030599 CACTAGCAAAACCATCTGATAGG - Intergenic
1025949009 7:66128794-66128816 CACTAGCAAAACCATCTGATAGG + Intronic
1027287263 7:76659662-76659684 CACTGGCAAAAGAAGCTAAATGG - Intergenic
1027470735 7:78570819-78570841 CAATGGAAAAATGAACTCAAAGG - Intronic
1027907286 7:84201330-84201352 TAATGGCAAAATCAACTGTTTGG + Intronic
1028608417 7:92681243-92681265 CACAGGGAAAATGAGCTGAATGG + Intronic
1030166072 7:106556578-106556600 CACAGCCAATATCATCTGAATGG - Intergenic
1031116760 7:117677344-117677366 AACTAGCAAAATAAACTAAATGG - Intronic
1031474088 7:122202159-122202181 CACTGACAAAAGAAATTGAAGGG + Intergenic
1033500946 7:141948913-141948935 CAATGGCAAATGCAACTGAGGGG + Intronic
1035821741 8:2600388-2600410 CACTTGCAAAGACAAGTGAAAGG + Intergenic
1036406462 8:8459776-8459798 CACTGGCAAAATGTACTGCCTGG + Intergenic
1036790978 8:11719819-11719841 CACTGTCAATAACAGCTGAATGG + Intronic
1036813746 8:11886020-11886042 CACTGGGAAAATGAACAGAAGGG - Intergenic
1037326470 8:17696206-17696228 GGCTGGCAAAATCAAATGACAGG + Intronic
1038038320 8:23704596-23704618 CACTGGCACAATCTCCTGGAGGG + Intronic
1038865842 8:31438090-31438112 CACTTCCAAAATCATCTGAATGG - Intergenic
1043014508 8:74921248-74921270 AACAGGCAAAATGAAATGAAGGG - Intergenic
1043786732 8:84411753-84411775 CACTGGCAAAATATATTCAAAGG - Intronic
1044760532 8:95513195-95513217 CACTGCCAAAAGCAATTAAAAGG - Intergenic
1046737841 8:117796003-117796025 GAATGACAAAACCAACTGAAAGG + Exonic
1048181837 8:132202271-132202293 CCATGGGAAAATGAACTGAAAGG - Intronic
1051725389 9:20083573-20083595 CACTGGCAGACTTGACTGAATGG - Intergenic
1052139535 9:24962120-24962142 CACTGCCAATATCAGCAGAATGG + Intergenic
1055037549 9:71834331-71834353 CACTGATAAAATAAATTGAAAGG + Intergenic
1055373012 9:75620462-75620484 CACAGCCAACATCAACTGAATGG - Intergenic
1055551653 9:77437096-77437118 CACTGTCAAAATCAGGTTAACGG + Intronic
1055833817 9:80415548-80415570 CACAGCCAACATCTACTGAATGG - Intergenic
1056545625 9:87610762-87610784 CACAGGAACAATCAACTGATTGG - Intronic
1056887156 9:90454493-90454515 CACTTGCAAAATGAACTGATGGG - Intergenic
1057255036 9:93539298-93539320 CACTGGCAAAAACAACTCTAGGG - Intronic
1058416665 9:104795834-104795856 AACTGTCAAAAGAAACTGAAAGG + Intronic
1061485055 9:130916299-130916321 CACTGGCAAAATCAACTGAATGG - Intronic
1187700905 X:21963568-21963590 AACTGGCACAATTAACAGAAAGG - Intronic
1188486730 X:30690006-30690028 CACTGTCAAAATGAAGTGCAGGG + Intronic
1190094216 X:47466052-47466074 CAAAGGAAAAAACAACTGAAAGG + Intronic
1190624013 X:52318671-52318693 CACTGGAAATATTAACTGTATGG - Intergenic
1190778422 X:53574007-53574029 CACTGGCAAAATCAAGTCTTAGG + Intronic
1191205179 X:57826059-57826081 CACAGCCAACATCAACTGAATGG - Intergenic
1192890750 X:75388247-75388269 CACTGGCAAAATTAAGTACATGG + Intronic
1193156529 X:78180377-78180399 CATTGGCAAAAACAAGGGAAAGG - Intergenic
1196146182 X:112319669-112319691 CAGTGGCAAAATCAGATTAATGG - Intergenic
1198226942 X:134653881-134653903 CACTGGCACAATTAACAAAAAGG - Intronic
1198482884 X:137056980-137057002 CTCTGGCATATTCCACTGAAAGG - Intergenic
1202243238 Y:22791524-22791546 CACTGCCAAAACCATCAGAAAGG + Intergenic
1202396225 Y:24425274-24425296 CACTGCCAAAACCATCAGAAAGG + Intergenic
1202474559 Y:25244818-25244840 CACTGCCAAAACCATCAGAAAGG - Intergenic