ID: 1061485959

View in Genome Browser
Species Human (GRCh38)
Location 9:130920659-130920681
Sequence GCGGCAGGGGAGGCGGCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1572
Summary {0: 1, 1: 1, 2: 11, 3: 143, 4: 1416}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061485959_1061485973 23 Left 1061485959 9:130920659-130920681 CCACCTGCCGCCTCCCCTGCCGC 0: 1
1: 1
2: 11
3: 143
4: 1416
Right 1061485973 9:130920705-130920727 CCAGTAGCACCAAGCCACCGTGG No data
1061485959_1061485968 0 Left 1061485959 9:130920659-130920681 CCACCTGCCGCCTCCCCTGCCGC 0: 1
1: 1
2: 11
3: 143
4: 1416
Right 1061485968 9:130920682-130920704 CAAACCTCCTTAAACCAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061485959 Original CRISPR GCGGCAGGGGAGGCGGCAGG TGG (reversed) Intronic
900114494 1:1022709-1022731 GGAGGAGGGGAGGAGGCAGGAGG - Intronic
900158919 1:1214214-1214236 AGGGCAGAGGAGGCGGGAGGAGG + Intergenic
900296646 1:1955258-1955280 GCTGCAGGGCAGGAGGCATGGGG + Intronic
900329578 1:2127397-2127419 GGGGCAGGGGCGGCGGTGGGGGG - Intronic
900371604 1:2334590-2334612 GTGGCCGTGGAGCCGGCAGGAGG + Intronic
900395651 1:2452281-2452303 GGGGGATGGGGGGCGGCAGGGGG - Intronic
900400707 1:2471834-2471856 TCGGCAGGGGAGCAGGCCGGAGG - Intronic
900417381 1:2541221-2541243 GAGGCTGGGGAGGCGGGAGCAGG + Intergenic
900507897 1:3038796-3038818 GCGGCAGGGGCAGGGGCTGGAGG + Intergenic
900602275 1:3508216-3508238 GCTGAAGGGCAGCCGGCAGGTGG - Intronic
900633744 1:3651998-3652020 GGGGCAGGGGATGTGGCCGGCGG - Intronic
900860607 1:5226641-5226663 GCGGGGGGGGAGGAGGGAGGCGG - Intergenic
900958923 1:5907081-5907103 GTGGAAGGCAAGGCGGCAGGTGG + Intronic
901045472 1:6393314-6393336 GCGGCGGCGGATGCGGCGGGCGG + Intronic
901109865 1:6785705-6785727 CCGGCCGGGGAGGGGGCCGGCGG + Intronic
901235478 1:7665220-7665242 GTGGGAGGGGAGGTGACAGGTGG - Intronic
901246112 1:7732550-7732572 GCAGCAGTGGAGGCGGCAGCGGG + Exonic
901500811 1:9651823-9651845 GCGTCAGGGGAGGTGGGAAGAGG + Intronic
901741189 1:11343040-11343062 GCAGGAGGGGAGGAGCCAGGAGG + Intergenic
901794623 1:11673209-11673231 GCCCCAGGGGTGGGGGCAGGTGG - Intronic
902082328 1:13829444-13829466 GCTGGTGGGGAGGGGGCAGGGGG + Intergenic
902258548 1:15206811-15206833 GAGGCAGGGGAGCTGGGAGGAGG - Intronic
902332454 1:15737086-15737108 GAGCCAGGGGAGGGGGCAGAGGG + Intronic
902446522 1:16469021-16469043 GAGGCAGGGGAGAGGGCAGGGGG + Intergenic
902566812 1:17316777-17316799 GGGGCAGGGGAGACGGGTGGGGG - Intronic
902607276 1:17575716-17575738 GTGGCAGCGGAGGTGGCAGGTGG + Intronic
902659494 1:17891352-17891374 GCAGCAGCGGCGGCGGCAGCAGG - Intergenic
902807294 1:18869120-18869142 GAGTCAGGGGAAGTGGCAGGAGG - Intronic
902832982 1:19029646-19029668 GGAGCAAGGCAGGCGGCAGGCGG - Intergenic
903130967 1:21279332-21279354 CCTGCAGGGAAGGAGGCAGGAGG + Exonic
903285187 1:22272646-22272668 GCAGGAGGGGAGGAGGCTGGAGG + Intergenic
903322097 1:22549576-22549598 GAGGCTGGGGAGACGGTAGGTGG - Intergenic
903475993 1:23619563-23619585 GCGGCGGCGGCGGCGGCTGGCGG - Intronic
903512574 1:23887313-23887335 GTGGCAGGTGATGGGGCAGGGGG - Intronic
903738201 1:25543668-25543690 GCGGCAGCGGCGGCGGCGGCCGG + Exonic
903828534 1:26161500-26161522 TCCGCCGGGGAAGCGGCAGGCGG + Exonic
903918375 1:26780914-26780936 GAGGGAGGGGAGGTGGAAGGAGG - Exonic
903925245 1:26826956-26826978 GCGGCAGCGGCAGCGGCAGCGGG + Exonic
904038611 1:27571712-27571734 GGGGGAGGGGAGGGGGCTGGGGG - Intronic
904564624 1:31421258-31421280 GCAGCAGGGGTGCTGGCAGGGGG - Intronic
904572455 1:31477189-31477211 GCTCCAGTGGAGGTGGCAGGGGG + Intergenic
904782970 1:32964474-32964496 GCGGCAGGGGCCGGGGCGGGCGG + Exonic
904822825 1:33256447-33256469 GCGGCGGCGGCGGCGGCGGGAGG - Intergenic
904822954 1:33256830-33256852 GCGGCGGCGGCGGCGGCAGCGGG + Intronic
905048904 1:35031725-35031747 GCGGCGGGGGCGGTGCCAGGTGG - Exonic
905058703 1:35121173-35121195 GCAGAAGAGGTGGCGGCAGGAGG - Intergenic
905172089 1:36115366-36115388 GCGGCAGCAGCGGCAGCAGGAGG + Intronic
905248191 1:36629167-36629189 GTGCCAGGGGAGGAGGCAGCTGG + Intergenic
905282987 1:36860767-36860789 GCGGCAGAGGACGTGGCAGGTGG + Intronic
905463113 1:38134127-38134149 GGGGCAGGGGAGCCGAGAGGGGG - Intergenic
905794022 1:40805391-40805413 GAGGCAGGGGAGGTGGAAAGCGG - Intronic
905855519 1:41309079-41309101 GCGGAAGGGGAAGGGGAAGGAGG - Intergenic
905975466 1:42170894-42170916 GCAGCTGGGGAGTGGGCAGGGGG + Intergenic
906027017 1:42682593-42682615 GCGGCGGGGGGGGCGGCGGGCGG - Exonic
906204400 1:43979346-43979368 GCGGCGGCGGCGGCGGCGGGAGG + Intronic
906517505 1:46448313-46448335 GCGGCAGGCGGGGCGGGAGCGGG - Intergenic
906556498 1:46718621-46718643 GCAGGAGAGGTGGCGGCAGGAGG + Exonic
906578827 1:46917546-46917568 GCTCCAGTGGAGGTGGCAGGGGG + Intergenic
906615758 1:47231966-47231988 GCGGGAGGGGCGGCGGCAGCCGG + Intronic
906653728 1:47533195-47533217 GAGCCAGGGGAGGAGGCGGGAGG - Intergenic
907671393 1:56477679-56477701 GCGGCCGGGGCGGCGGCTGCCGG - Intergenic
907720505 1:56967799-56967821 TCGGCAGGGGTGGCAGGAGGGGG - Intergenic
907929997 1:58990518-58990540 TGGGCAGGGGCGGGGGCAGGGGG - Intergenic
908514154 1:64875197-64875219 TTGCCAGGGGAGGTGGCAGGAGG + Intronic
908514289 1:64876166-64876188 CTGCCAGGGGAGGTGGCAGGAGG + Intronic
911517341 1:98882564-98882586 ATGGCTGGGGAGGCTGCAGGGGG - Intergenic
911527546 1:99004762-99004784 GCGGCGGCGGAGGCGGCGGGAGG + Exonic
912372715 1:109186228-109186250 GCAGGAGAGGAGGCGGCAGCTGG + Intronic
912533097 1:110340344-110340366 GCGGAGGTGGAGGGGGCAGGCGG - Exonic
913972334 1:143424306-143424328 CCGGCAGGGGAGGCTGCAGACGG - Intergenic
914066716 1:144249919-144249941 CCGGCAGGGGAGGCTGCAGACGG - Intergenic
914112437 1:144716435-144716457 CCGGCAGGGGAGGCTGCAGACGG + Intergenic
914196835 1:145452070-145452092 GGGCCAGGAGAGGAGGCAGGAGG - Intergenic
914200556 1:145480933-145480955 GAGGTAGGGGAGAGGGCAGGGGG - Intergenic
914479670 1:148054060-148054082 GAGGTAGGGGAGAGGGCAGGGGG - Intergenic
915142360 1:153775506-153775528 GCAGCAGGGGCAGCAGCAGGAGG - Exonic
915486164 1:156222238-156222260 GTGGCAGGGGTGAAGGCAGGGGG - Intronic
915935425 1:160087728-160087750 GGGGCGGGGGAGGGGGCGGGTGG + Exonic
915981106 1:160420389-160420411 GCTGTGGGGGAGACGGCAGGAGG - Exonic
916022129 1:160802070-160802092 GTGCCATGGGAGGCGGCGGGTGG - Intronic
916961480 1:169893798-169893820 GCGGCGGGGGAGGAGGCCGAGGG + Exonic
917202597 1:172533155-172533177 GCGGCAGTGGCGGCTGCAGGAGG + Exonic
917498452 1:175564243-175564265 GAGACAGGGCAGGCAGCAGGAGG - Intronic
917755387 1:178093762-178093784 GCGGCGGCGGCAGCGGCAGGCGG - Intergenic
917804253 1:178599024-178599046 GCTGCAGTGGAGGCGTCAGCTGG + Intergenic
917968817 1:180194654-180194676 GGAGCAGGGGAGGCGGGAGAGGG - Intronic
918322278 1:183375600-183375622 GAGATAGGGGAGGCTGCAGGTGG - Intronic
918650142 1:186952475-186952497 GAGGCAGGGGTGGTGGAAGGTGG - Intronic
919639762 1:200036499-200036521 GAGGCAGGGGCGGCGGCACCAGG - Intronic
919763512 1:201112480-201112502 GGGGCAGGAGTGGGGGCAGGAGG + Exonic
919765917 1:201127283-201127305 GAGGGAGGAGGGGCGGCAGGGGG + Intergenic
919807186 1:201387057-201387079 GCGGAGGCAGAGGCGGCAGGTGG - Exonic
919809403 1:201399341-201399363 GCGCCAGGTGAGGCGGCGGCCGG - Exonic
919830761 1:201538975-201538997 GCGGCCGGGGGGCGGGCAGGAGG - Intergenic
919942651 1:202298877-202298899 GAGGCAAGGGAGGTGGCATGGGG - Intronic
920022671 1:202967321-202967343 GCGGCTGGGGGGGCAGGAGGCGG + Intergenic
920135989 1:203769772-203769794 GCGGGGGGGGGGGCGGCGGGGGG + Intronic
920316083 1:205076540-205076562 GCCCCAGAGGAGGCGGCAAGAGG + Exonic
920666116 1:207963986-207964008 AGGCCAGGGGAGGGGGCAGGCGG - Intergenic
920912551 1:210232558-210232580 GAAGCAGGGAAGGAGGCAGGGGG + Intergenic
920986857 1:210898665-210898687 GGGGCAGGCGTGGCGGCGGGGGG + Intronic
921138838 1:212286038-212286060 GCAGCGGCGGAGACGGCAGGAGG - Exonic
921217737 1:212951477-212951499 GCGGCAGCGGCGGCGGCGGCGGG - Exonic
921229206 1:213051382-213051404 GCGGCGGCAGAGGCGGCGGGAGG + Exonic
921238992 1:213157301-213157323 GAGGCAGGAGATGAGGCAGGAGG - Intronic
921327221 1:213997968-213997990 GGGGAAGGGGTGGCGGAAGGTGG - Exonic
921355562 1:214281436-214281458 GCGGCGGCGGCGGCGGCGGGCGG + Intronic
921577654 1:216855691-216855713 GGAGCAGGGGAGGGGGCAGGTGG - Intronic
921909134 1:220528499-220528521 GTGGAAGGGGAGCCGGGAGGCGG - Intronic
921918588 1:220641776-220641798 GCGGCAGGGGTGGGGGTGGGCGG + Intronic
922315083 1:224434689-224434711 GCGGCGGCGGCGGCGGCGGGCGG + Intronic
922335593 1:224616344-224616366 GCGGCAGCGGCAGCAGCAGGTGG + Exonic
922758322 1:228109055-228109077 GAGGCAGGGAAGGGGACAGGGGG - Intronic
922933336 1:229407024-229407046 GCGGGAGGGGAGGGGAGAGGGGG - Intergenic
923140918 1:231161417-231161439 GCGGACGGGAAGGCGGCAAGCGG - Intergenic
923309838 1:232725310-232725332 GGGGGAGGGGAGGGGGGAGGGGG + Intergenic
923592220 1:235328783-235328805 GCGGCAGTGGCGGCGGCTGGGGG + Intronic
924359218 1:243218371-243218393 GCCCCAGTGGAGGAGGCAGGGGG + Intronic
924415170 1:243850303-243850325 GCGGCGGCGGCGGCGGCGGGAGG + Intronic
924415173 1:243850306-243850328 GCGGCGGCGGCGGCGGGAGGGGG + Intronic
924415238 1:243850535-243850557 GGGGGCGGGGAGGCGGCGGGGGG - Intronic
924436549 1:244048593-244048615 GGGGGAGGGGAGGGGGCGGGAGG - Intergenic
924451766 1:244184975-244184997 GTGGGTGGGGAGGCGGCGGGGGG - Intergenic
924624061 1:245685702-245685724 GAGGCAGGAGAGGCTGCAGCCGG + Exonic
924754869 1:246931749-246931771 GTGGCCGGGGAGGTCGCAGGCGG - Intronic
924854712 1:247864782-247864804 ACGGCAGCTGAGGCGGCTGGAGG + Exonic
1062837321 10:644243-644265 GGGGATGGGGAGGCTGCAGGAGG + Intronic
1062844416 10:692833-692855 GGGGAAGGGGAGACGACAGGAGG - Intergenic
1062857235 10:785385-785407 GGGGCAGGAGAGCGGGCAGGAGG - Intergenic
1062978907 10:1705451-1705473 GCAGGAGGAGAGGCGGCAGATGG + Intronic
1062992918 10:1836805-1836827 GTGGGAGAGGGGGCGGCAGGCGG - Intergenic
1063348834 10:5336093-5336115 GCAGCAGGAGAAGAGGCAGGAGG + Intergenic
1063369840 10:5514070-5514092 GAGGGAGGAGAGGGGGCAGGGGG - Intergenic
1063929911 10:11018305-11018327 CCGGCACGGGACGCGGGAGGAGG + Intronic
1064017161 10:11781532-11781554 GTGGCAGCGGAGGCAGCAGCTGG + Intergenic
1064025317 10:11844101-11844123 GCTGCTGGGGAGGCTGCAGTGGG - Intronic
1064230928 10:13528894-13528916 GCGGCGGCGGAGGCGGGGGGCGG + Intronic
1064443049 10:15370871-15370893 GCGGCGGCGGCGGCGGCGGGAGG - Intronic
1064671031 10:17713961-17713983 GCGGCAGAGGGGGCCGCAGGGGG - Intronic
1064906149 10:20348023-20348045 GTGGTGGGGGAGGGGGCAGGGGG - Intergenic
1065140527 10:22714636-22714658 GCGGGCGGGCAGGCGGGAGGCGG + Intergenic
1065240141 10:23695800-23695822 GCGGCAGAGGTCGAGGCAGGAGG + Intronic
1065434837 10:25695317-25695339 GTGGAAGGAGAGGCTGCAGGAGG - Intergenic
1065712736 10:28533161-28533183 GCGGCGGCGGCGGCGGCGGGAGG + Intronic
1065712737 10:28533164-28533186 GCGGCGGCGGCGGCGGGAGGAGG + Intronic
1065712752 10:28533213-28533235 GCAGCAGCGGCGGCGGCGGGGGG + Intronic
1065818041 10:29500017-29500039 GCGGTTGGGGATGTGGCAGGAGG + Intronic
1065890764 10:30119237-30119259 GTGGCAGGGGAAAAGGCAGGAGG + Intergenic
1065901827 10:30214876-30214898 GCAGCAGGTGGGGCAGCAGGTGG - Intergenic
1066094074 10:32056205-32056227 GCGGCAGCGGCGGCGGCACCGGG + Exonic
1066397525 10:35040735-35040757 GCGGCATTGGTGGGGGCAGGTGG + Intronic
1066464514 10:35640824-35640846 GCGGCAGGGGCGGTGGCGGCGGG - Exonic
1067044207 10:42975285-42975307 CCTGCAGGGGAGGCTGGAGGGGG - Intergenic
1067079006 10:43203257-43203279 GGGGCACGGGCGGGGGCAGGGGG - Intronic
1067081888 10:43216804-43216826 GTGGCAGAGGAGGGGGAAGGAGG + Intronic
1067230193 10:44400972-44400994 GGGGGAGGGAAGGAGGCAGGGGG - Intergenic
1067261962 10:44700576-44700598 GCCCCAGGGGAGGAGGCAGGAGG + Intergenic
1067471627 10:46542171-46542193 GCTGCAGGGCAGGGGCCAGGTGG + Intergenic
1067474457 10:46556691-46556713 GCGGCGGGAGGGGCGGCGGGCGG + Intergenic
1067752665 10:48982355-48982377 GAGGCAGGGGAGGCAGTGGGAGG - Intronic
1067800273 10:49353805-49353827 GCTGCAGTGGAGGGGGCTGGAGG - Intergenic
1068962061 10:62877030-62877052 GCTGCAGGGGAAGGGGAAGGAGG - Intronic
1069019188 10:63466141-63466163 GCGGCGGCGGCGGCGGCAGCGGG + Intergenic
1069544555 10:69319066-69319088 GAGGCAGCGGAGGCGGCGAGCGG - Intronic
1069721871 10:70554947-70554969 GGGGGAGGGGAGGGGGGAGGAGG - Intronic
1069722623 10:70559512-70559534 GGGGCGGGAGAGGTGGCAGGGGG + Intronic
1069885015 10:71618278-71618300 GCTGCAGAGGAGGAGGCAGGAGG + Intronic
1070255966 10:74813537-74813559 GAGGCAGGGGAGGCGGGCGGAGG - Intergenic
1070288854 10:75102007-75102029 GTGGCAGGGGAGGCTGGAAGAGG - Intronic
1070345591 10:75538347-75538369 GCGGTAGAGGATGCAGCAGGTGG - Intronic
1070592428 10:77810624-77810646 GTGGCAGGGGAGGTGGCAGCTGG - Intronic
1070830281 10:79413926-79413948 GCGGCAAGGAGGGCAGCAGGTGG - Intronic
1071306467 10:84303167-84303189 GCGGCGGGGGGGGGGGCGGGGGG + Intergenic
1071857965 10:89645049-89645071 GAGGTGGGGGAGTCGGCAGGAGG - Exonic
1071910688 10:90229603-90229625 GCTTCAGTGGAGGTGGCAGGGGG - Intergenic
1072221828 10:93333496-93333518 GGTGCAGGGGTGGTGGCAGGGGG + Intronic
1072521860 10:96236393-96236415 GCTGCAGGGGAGGCGGTGGGTGG + Intronic
1072562225 10:96586880-96586902 GCGGCGGAGGAGGCGGCGGCGGG - Exonic
1072562252 10:96586964-96586986 GCGGCAGAGGAGGCAGCGGCTGG - Exonic
1072791523 10:98321515-98321537 GCAGCAGGGGAAGCGCAAGGAGG - Intergenic
1073047126 10:100646128-100646150 GAGGGAGGGGAGGAGGCTGGGGG + Intergenic
1073444179 10:103571123-103571145 GAGGCGGGGGCGGGGGCAGGGGG - Intronic
1074561576 10:114539875-114539897 GGGGCAGGGGAAGGGGGAGGAGG + Intronic
1074754051 10:116611302-116611324 GGGGCAGGGGAGGCAGCAGATGG + Intergenic
1074815704 10:117139805-117139827 GAGGCAGGGGAGGTGGCGGCGGG - Intergenic
1075010549 10:118866137-118866159 GTAGCAGGGGAATCGGCAGGGGG - Intergenic
1075334485 10:121598444-121598466 GCGGCGCGGGCGGCGGCTGGAGG - Intronic
1075443631 10:122498872-122498894 GGGACTGGGGAGGCAGCAGGAGG - Intronic
1075559759 10:123460111-123460133 GTGGCAGTGAAGGTGGCAGGTGG + Intergenic
1075775593 10:124984035-124984057 GAGAGAGGGTAGGCGGCAGGGGG + Intronic
1075945271 10:126427642-126427664 ACGGCAGGAGGGGCGGGAGGAGG - Intronic
1076035588 10:127196445-127196467 GGGGCAGAGGAGGGAGCAGGAGG + Intronic
1076243579 10:128928656-128928678 GGGGAAGGGGAGGCGGGAAGTGG - Intergenic
1076349008 10:129801882-129801904 GCTGGAGGGGAGGCAGAAGGGGG + Intergenic
1076461468 10:130650127-130650149 GCTGCAGGTGAGGGGGCTGGGGG + Intergenic
1076591611 10:131587441-131587463 GCTGCAGTGGAGGGGGCTGGTGG - Intergenic
1076790685 10:132775208-132775230 GGGGCAGGGGGAGGGGCAGGGGG + Intronic
1076825029 10:132962631-132962653 GGGGCAGGGGAGCCCCCAGGTGG - Intergenic
1076830561 10:132992321-132992343 GAGGCAGAGGAGGCAGCAGCGGG + Intergenic
1076851595 10:133095962-133095984 GGGGCTGGGGAGGGGCCAGGCGG + Intronic
1076859412 10:133133564-133133586 GAGGCAGGGGACGGGGTAGGGGG + Intergenic
1076872990 10:133202662-133202684 GCGGCAGGAGAGGAGCAAGGAGG - Intronic
1077009443 11:373675-373697 GAGGCAGGGAAGGGGGCAGGTGG - Intronic
1077043666 11:535286-535308 GCGGCGGCGGCGGCGGCGGGTGG - Intronic
1077052075 11:571498-571520 GGGGCAGGGGTGGCTGGAGGAGG - Intergenic
1077053100 11:576498-576520 GCGGCAGAGGCGGCGGCGGCCGG + Exonic
1077074668 11:694944-694966 GCGGCCGCGGCCGCGGCAGGAGG - Exonic
1077104434 11:836035-836057 GAGGCAGGGGAGGGGTCAGCGGG - Intronic
1077159304 11:1105453-1105475 GGGGCTGGGGAGCTGGCAGGTGG - Intergenic
1077204558 11:1336367-1336389 AGGGCAGGGGAGGTGGGAGGAGG - Intergenic
1077230203 11:1455306-1455328 GCGGTGGGGGAGGCGGGTGGGGG - Intronic
1077231716 11:1460771-1460793 GGGGCAGGGCGGGCGGCGGGCGG - Exonic
1077307523 11:1874726-1874748 CCGGCAGGGGAGGCTGCAGACGG + Intronic
1077332163 11:1988514-1988536 GAGGGAGAGGAGGGGGCAGGAGG + Intergenic
1077453022 11:2662372-2662394 GGGGCAGGGGAGGGGGCTGGGGG - Intronic
1077461264 11:2711896-2711918 GAGGCATGGCAGGTGGCAGGTGG + Intronic
1078068877 11:8095590-8095612 GACGCAGGGGAGACGGCAGCTGG + Exonic
1078171568 11:8932693-8932715 GTGGCCGGGGAGGAGGAAGGAGG - Intronic
1078210330 11:9265157-9265179 GCGGTAGCGGCGGCGGCGGGAGG - Exonic
1078928419 11:15894703-15894725 GGGGCAGGGGAGGTGGCTGGAGG - Intergenic
1079996911 11:27304894-27304916 GAGGGAGCCGAGGCGGCAGGGGG - Intergenic
1080805308 11:35647822-35647844 GGGGCAGGGCAGGAGGTAGGGGG + Intergenic
1081634199 11:44710003-44710025 GCAGCAGGGGAGGCAGGAGGAGG + Intergenic
1081683003 11:45021966-45021988 GGGGCAGGGCAGGAGGGAGGTGG + Intergenic
1081933737 11:46890219-46890241 GGGGCAGGGACGGGGGCAGGAGG + Intronic
1082023369 11:47553091-47553113 GCGGCAGCGGCGGCGGGACGCGG - Intronic
1083307621 11:61769389-61769411 GAGGTAGGGGAGGAGGGAGGGGG + Intronic
1083573447 11:63772190-63772212 GAGGAAGGGGAGGCGACCGGAGG + Intergenic
1083667985 11:64285683-64285705 GGGTTACGGGAGGCGGCAGGAGG - Intronic
1083728042 11:64638455-64638477 GCGGCTGGGGAGGGGCCTGGCGG - Intronic
1083728869 11:64642719-64642741 GCGGCGGTGGAGGCGGCGGCAGG + Intronic
1083857427 11:65400062-65400084 GGGGCAGGGGAGGCCGCAGCTGG + Intronic
1083883648 11:65560230-65560252 ACCTCAGGGGAGGCTGCAGGGGG + Intergenic
1083945900 11:65922431-65922453 GAGGCTGGGGAGGGCGCAGGTGG + Intergenic
1083950607 11:65953594-65953616 GCGGCAGGAGGAGCGGCAGCAGG + Exonic
1083952716 11:65965773-65965795 GCGGCAGGTGAGGCTGCAGCAGG + Exonic
1084072392 11:66744827-66744849 GCGGCGGCGGCGGCGGCGGGCGG + Intronic
1084146140 11:67266395-67266417 GCGGCAGGCGGGGCCGGAGGCGG + Exonic
1084146223 11:67266658-67266680 GCGGCGGCGGCGGCGGCGGGAGG + Exonic
1084146224 11:67266661-67266683 GCGGCGGCGGCGGCGGGAGGAGG + Exonic
1084385161 11:68839232-68839254 GTGGCAGCGGCGGCGGGAGGCGG - Intronic
1084492983 11:69488447-69488469 GCAGCTGGGGTGGCGGGAGGGGG - Intergenic
1084547101 11:69819892-69819914 GGGCCTGGGGAGGCGGGAGGAGG + Intergenic
1084604677 11:70165595-70165617 GCGGCAGGGGCGGGGCCAGGCGG + Intronic
1084698346 11:70769548-70769570 ACGGCAGGGGGTGGGGCAGGGGG + Intronic
1084943548 11:72626872-72626894 GCCCCAGAGGAGGCTGCAGGAGG - Intronic
1085109237 11:73873156-73873178 ACAGCAGGCGAGGCGGCAAGAGG - Exonic
1085151241 11:74254213-74254235 GTGGCAGGTGAGGGCGCAGGAGG - Exonic
1085510515 11:77085819-77085841 GGTGGAGGGGAGGCTGCAGGAGG + Intronic
1085513674 11:77100349-77100371 GAGGGAGGGGAGGAGGCAGAGGG - Intronic
1087293209 11:96341540-96341562 GCTGCTTGGGAGGCCGCAGGAGG + Exonic
1087293215 11:96341552-96341574 GCCGCAGGAGGGGCAGCAGGGGG + Exonic
1087615979 11:100487012-100487034 GCTCCAGTGGAGGTGGCAGGGGG - Intergenic
1088365876 11:109039366-109039388 GTGGCAGGAGAGTTGGCAGGTGG - Intergenic
1088597124 11:111449162-111449184 AGGGCAGGGGAGGAGTCAGGGGG - Intronic
1088903932 11:114139833-114139855 GCGGCTGTGGAGGAGGCCGGGGG + Intronic
1089243074 11:117098282-117098304 GCCGCAGGGGACACGGCAGCGGG + Exonic
1089289386 11:117428587-117428609 GTGGCTGTGGAGGCGGCAGCGGG + Exonic
1089363549 11:117907230-117907252 GCGGCAGGGCAGGAGGTAGCGGG + Intronic
1089496079 11:118909355-118909377 GGGGAGGGGGAGGCGGCGGGGGG - Intronic
1089497908 11:118916939-118916961 GCAGCAGGGGATGGGGCAGTGGG + Intronic
1089599402 11:119604309-119604331 GAGGCAGGAGTGGAGGCAGGTGG + Intergenic
1089628210 11:119765138-119765160 GTGGCAGTGGAGGTGGGAGGGGG - Intergenic
1089674411 11:120080394-120080416 GTGGAATGGGAGGCCGCAGGAGG - Intergenic
1089753084 11:120665791-120665813 GTGGCAGGGGAGGAGCAAGGAGG - Intronic
1090022286 11:123138603-123138625 GTGGCAGGGGAGGGGGAGGGGGG - Intronic
1090204861 11:124878496-124878518 GAGGAAGGGGAGGGGGCAGCAGG + Intronic
1090247620 11:125227957-125227979 CCAGCAGTGGAGGCAGCAGGGGG - Intronic
1090252077 11:125258736-125258758 GCAGCAGGGGAGGGGGCAGAAGG - Intronic
1090266687 11:125357678-125357700 GCGGCCTGGCAGGAGGCAGGTGG + Intronic
1090984138 11:131750894-131750916 GAGGCAGGGGAGGAGGCCTGTGG - Intronic
1091168975 11:133503928-133503950 TGGGCAGGGAAGGCGGGAGGAGG + Intronic
1202815144 11_KI270721v1_random:43690-43712 GAGGGAGAGGAGGGGGCAGGAGG + Intergenic
1091558677 12:1594443-1594465 GAGGCGGAGGATGCGGCAGGGGG - Intronic
1091558684 12:1594462-1594484 GGAGCAGCGGCGGCGGCAGGAGG - Intronic
1091614868 12:2042694-2042716 GAGACAGGAGAAGCGGCAGGTGG + Intronic
1091740741 12:2959218-2959240 GCGGCGGGGGAGGGGGCCGAGGG - Intergenic
1092002441 12:5043798-5043820 CCGGGAGGGGAAGCGGGAGGAGG + Intergenic
1092122270 12:6052719-6052741 GCGGCAGGTCAGGTTGCAGGGGG + Exonic
1092125464 12:6072245-6072267 TCAGCAGGGGTGGTGGCAGGTGG - Intronic
1092204420 12:6606758-6606780 GGGCCAGGGGAGGCCGCAGGCGG + Intronic
1092246552 12:6867395-6867417 GCGGCCGGGGCGGCGGCAGGAGG + Exonic
1092335427 12:7628752-7628774 GCGGCAGGGGCGGCGGCGGCAGG - Intergenic
1092377342 12:7966914-7966936 GCAGCAGGAGAGGTGGCAGAGGG + Intergenic
1093131779 12:15400356-15400378 GCAGCAGGTGAGGCTGCTGGGGG - Intronic
1093435396 12:19129924-19129946 GCGGGAGGGCAGGAGGCGGGCGG + Intronic
1093473923 12:19534168-19534190 GGGGCAGGGGCGGTGGCTGGTGG + Intronic
1093583236 12:20807514-20807536 GGGGGAGGAGGGGCGGCAGGGGG + Intergenic
1094041117 12:26122633-26122655 GCGGCAGCGGCGGCGGCCCGGGG - Exonic
1094199192 12:27780001-27780023 GCGGCGGGGGAGGAGGCTGCTGG + Exonic
1094477574 12:30853397-30853419 GCTGCAGGGGAGGGGTGAGGGGG + Intergenic
1094555706 12:31497829-31497851 GGGCAAGGGGAGGGGGCAGGGGG + Intronic
1094588677 12:31800988-31801010 GCGGCGGGGGCGGGGGCGGGAGG + Intergenic
1094839828 12:34338240-34338262 GCGGCAGGGGCGGTGTCCGGGGG - Intergenic
1094841187 12:34343323-34343345 GCGGCAGGGGAGGCGGGGGGAGG - Intergenic
1094842423 12:34347692-34347714 GCGGCAGGGGCGGCGTGTGGGGG + Intergenic
1095038459 12:37419249-37419271 GCTGCAGCCGAGGCGGCAGCTGG + Intergenic
1095095659 12:38147156-38147178 AGGGCAGGGGTGGGGGCAGGGGG - Intergenic
1096183954 12:49566306-49566328 GAGGCAGGGGAGGGGCCAAGAGG - Intronic
1096370304 12:51063845-51063867 GCGGAAGGGGAGGCTTGAGGGGG + Exonic
1096495561 12:52037451-52037473 GCTGCCGGGGTGGCGGGAGGTGG + Intronic
1096557437 12:52412010-52412032 GCGGGAGGGGAGCAGGCATGGGG - Intergenic
1096627609 12:52904986-52905008 GAGGCAGGAGTGGAGGCAGGCGG + Exonic
1096628066 12:52907318-52907340 GGGACAGGGAAGGCGGAAGGAGG + Intronic
1096749947 12:53752154-53752176 GCGGCGGCGGCGGCGGCAGCGGG - Intergenic
1096783123 12:54002034-54002056 GGGGCAGAGGAGGAGGGAGGTGG + Intronic
1096796781 12:54082635-54082657 GCGGGAGGGGAGGCGGAGGCGGG + Intergenic
1096837392 12:54359410-54359432 GCGACTGGGGAGGGGGCGGGGGG + Intergenic
1096981216 12:55729021-55729043 GCGGCAGGCGGGGCGGGAGCCGG - Intronic
1097046258 12:56189545-56189567 GCGGCCGCGGCGGCGGGAGGCGG - Exonic
1097872120 12:64610458-64610480 CCTGGCGGGGAGGCGGCAGGAGG + Intergenic
1098822728 12:75253213-75253235 GTGGCAGTGGACACGGCAGGGGG - Intergenic
1098924396 12:76333630-76333652 GGGGCAGGGGAGGCTGCACTTGG - Intergenic
1099165964 12:79307634-79307656 GCGTGGGGGGGGGCGGCAGGAGG + Intronic
1099289724 12:80761826-80761848 GGGGCAGGGCAGGGGCCAGGTGG + Intergenic
1100225531 12:92552215-92552237 GGGGCAGGGGAGGTGCAAGGTGG - Intergenic
1100390394 12:94141767-94141789 GTGGGAAGGGAGGCTGCAGGGGG + Intergenic
1100490400 12:95073134-95073156 GCGACAGGGGCGGCGGGACGCGG - Intronic
1101340889 12:103841165-103841187 GCGGCGGCGGTGGCGGCAGCAGG - Exonic
1101479621 12:105084465-105084487 GCGGCAGCGCGGGAGGCAGGCGG + Exonic
1101653114 12:106695452-106695474 GGTGTAGGGGAGGCGGCAAGGGG + Intronic
1101883176 12:108639674-108639696 GCGGCAGGGCAGGCAACACGGGG + Intergenic
1101909146 12:108849822-108849844 GAGCCAGGGGAGGAGGCATGGGG + Intronic
1101967603 12:109291933-109291955 GCCGGAGGGGTGGCGGCCGGAGG - Intronic
1102025880 12:109714196-109714218 GCGGCGGCGGCGGCGGCAGCGGG - Intergenic
1102244738 12:111348134-111348156 TTGGCAGGGGGGGCGCCAGGTGG - Exonic
1102592389 12:113966486-113966508 GCAGCGGAGAAGGCGGCAGGGGG + Intergenic
1102796857 12:115696350-115696372 GCTGCAGGGGTGGAGGCTGGGGG + Intergenic
1103217364 12:119212235-119212257 GCGGCATGGGTGGCGGGAGTGGG + Intronic
1103405174 12:120669869-120669891 TCAGCAGGGGAGGAGGCAGGAGG - Intergenic
1103433070 12:120904250-120904272 GCGGCGGCGGCGGCGGCCGGGGG + Exonic
1103526891 12:121575194-121575216 GGGGCAGGGGAGGAGGCTTGGGG - Intronic
1103563389 12:121804048-121804070 GCTGCCCGGGAGGCGGCTGGCGG - Intergenic
1103595424 12:122022201-122022223 GCGGCCGGGGAGGCGGCTGGCGG - Intronic
1103659916 12:122506020-122506042 GCCGGGGGGCAGGCGGCAGGGGG - Intronic
1103795379 12:123499634-123499656 GAGGCTGGGGAGGAGGCCGGGGG - Intronic
1103800355 12:123533734-123533756 GCGGCGGCGGCGGCGGCAGCGGG + Intergenic
1103905371 12:124324969-124324991 GCGGGATGGGAGGCGGAGGGAGG + Exonic
1103913837 12:124365913-124365935 GCGGCAGTTGAAGCCGCAGGTGG - Intronic
1103954265 12:124567620-124567642 GCGGCGGCGGCGGCGGCGGGAGG + Intergenic
1103954268 12:124567623-124567645 GCGGCGGCGGCGGCGGGAGGGGG + Intergenic
1104674028 12:130700570-130700592 GAGGCAGAGGTGGGGGCAGGGGG + Intronic
1104775628 12:131388606-131388628 GAGGCAGGGGAGGCAGCAGCTGG - Intergenic
1104919107 12:132281337-132281359 GGGGCAGGCGAGGGGCCAGGAGG + Intronic
1104931493 12:132341615-132341637 GGGGCATGGGAGGCGTCAAGCGG - Intergenic
1104990236 12:132620426-132620448 GCCCCTGAGGAGGCGGCAGGAGG - Exonic
1105557387 13:21459469-21459491 GCGGCCGGGGAGGCGGTGAGGGG + Intergenic
1105629525 13:22148592-22148614 GCGGGAGGGGAGGTGAGAGGAGG - Intergenic
1105943548 13:25171212-25171234 GCGGCGGGGGCGGCGGGGGGCGG - Exonic
1105946289 13:25192643-25192665 GTGGCAGGGGAGGCTGGAGTGGG - Intergenic
1106304901 13:28500823-28500845 GTGGCTGGAGAGGAGGCAGGAGG + Intergenic
1106375500 13:29182912-29182934 GCTGAAGGGGAGGGAGCAGGGGG + Intronic
1106736959 13:32597595-32597617 GCCGAGGGGGGGGCGGCAGGGGG + Intronic
1106849167 13:33770466-33770488 GCTTCAGGGGAGGAGGCTGGGGG - Intergenic
1107145859 13:37059720-37059742 GCGGAAGGGGAGGAGCCGGGAGG + Intergenic
1107495447 13:40921802-40921824 GCGGGACGGGAGGCGACACGCGG + Intergenic
1109241602 13:59896586-59896608 GAGGCGGGGGTGGAGGCAGGGGG + Intronic
1110404048 13:75128736-75128758 AAGGGAGGGGAGGTGGCAGGAGG + Intergenic
1110469250 13:75840453-75840475 GCGGCAGGAGAGGTGGCAGAAGG + Exonic
1110748137 13:79079833-79079855 GCTCCAGTGGAGGTGGCAGGAGG - Intergenic
1111011420 13:82320166-82320188 GGGGCAGGGGCAGGGGCAGGGGG - Intergenic
1111672407 13:91347892-91347914 GCGGGCGGGGAGGCGGGAGCAGG + Intergenic
1112012201 13:95301599-95301621 GCGGGAGGAGACGCGGCGGGAGG + Intergenic
1112041503 13:95552656-95552678 GCGGAGGCGGAGGCGGGAGGCGG + Intronic
1112216255 13:97434107-97434129 GCGGCGGCGGCGGCGGCGGGCGG + Intergenic
1112448716 13:99490408-99490430 GGGGTTGGGGAGGGGGCAGGGGG + Intergenic
1112564939 13:100545013-100545035 GGCGCAGCGGAGGCGGCAGCAGG + Intronic
1113082361 13:106533342-106533364 CCGGCTCGGGAGGCGCCAGGTGG - Intronic
1113346699 13:109485315-109485337 GGGGCAGGGGCGGCGGGCGGGGG - Intergenic
1113378818 13:109785572-109785594 GCGGCGGGCGCGGCGGCGGGGGG + Exonic
1113508322 13:110831991-110832013 GCCCCAGGCGAGGCGGCGGGAGG + Intergenic
1113582742 13:111440452-111440474 GCTGCAGGGGAAGCTGCAGGGGG - Intergenic
1113582749 13:111440476-111440498 GCTGCAGGGGAAGCTGCAGGGGG - Intergenic
1113582756 13:111440500-111440522 GCTGCAGGGGAAGCTGCAGGGGG - Intergenic
1113582763 13:111440524-111440546 GCTGCAGGGGAAGCTGCAGGGGG - Intergenic
1113582770 13:111440548-111440570 GCTGCAGGGGAAGCTGCAGGGGG - Intergenic
1113582777 13:111440572-111440594 GCTGCAGGGGAAGCTGCAGGGGG - Intergenic
1113582784 13:111440596-111440618 GCTGCAGGGGGAGCTGCAGGGGG - Intergenic
1113582788 13:111440608-111440630 GCTGCAGGGGGAGCTGCAGGGGG - Intergenic
1113582792 13:111440620-111440642 GCTGCAGGGGGAGCTGCAGGGGG - Intergenic
1113582796 13:111440632-111440654 GCTGCAGGGGAAGCTGCAGGGGG - Intergenic
1113728987 13:112626187-112626209 GCTGCTGGGGAGGCTGCAGAAGG + Intergenic
1113746316 13:112747331-112747353 GCGGCAGCTGAGTCTGCAGGTGG - Intronic
1113975568 13:114225421-114225443 GAGGAAGGGGAGGGGGGAGGGGG + Intergenic
1114270683 14:21098346-21098368 GCGGCGGCGGCGGCGGCGGGCGG + Exonic
1114316072 14:21511139-21511161 GCTGCAGCGGAGGCGGAAGCAGG - Exonic
1114548955 14:23522459-23522481 GGGGCTGGGGTGGCGGCTGGAGG + Exonic
1114549168 14:23523310-23523332 GAGGCAGGTGTGGTGGCAGGTGG + Exonic
1114826748 14:26090123-26090145 GGGGCAGGGGCAGCGGCAGTGGG - Intergenic
1115528744 14:34306288-34306310 GGGGCGGGGGCGGGGGCAGGGGG + Intronic
1115951455 14:38727013-38727035 GAGGCAGGAGTGGAGGCAGGTGG - Intergenic
1116426603 14:44798925-44798947 GCGGCGGGGGAGCGGGGAGGCGG - Intergenic
1116498925 14:45596809-45596831 GGGTCAGGGGAGGGGGGAGGGGG - Intergenic
1116802634 14:49459129-49459151 GTGGCAGGAGAGGCGGTGGGTGG - Intergenic
1116835749 14:49768011-49768033 GCGGCGGCGGCGGCGGCTGGAGG + Exonic
1117763842 14:59059704-59059726 GGGGCAGGGGCAGGGGCAGGGGG + Intergenic
1117763852 14:59059723-59059745 GGGGCAGGGGCAGGGGCAGGGGG + Intergenic
1118213608 14:63788055-63788077 GAGGCAGCAGAGGCGGCAGAGGG + Intergenic
1118366439 14:65101656-65101678 GCGGCAGAGGAAGCGGAGGGTGG + Intronic
1118575937 14:67241359-67241381 GCGGCGACGGAGGAGGCAGGCGG + Exonic
1118820130 14:69339708-69339730 GTGGCTGGGGAGGTGGCGGGTGG - Intronic
1118836960 14:69484597-69484619 GTGGCAGGTGAGCCGGCGGGAGG - Intergenic
1119326829 14:73764827-73764849 GAGGCTGGGGAGGGGGCAGGTGG - Intronic
1119415610 14:74467437-74467459 GCCCCAGGAGAGGGGGCAGGGGG + Intergenic
1119545704 14:75469915-75469937 GGGGCAGGGCTGGGGGCAGGTGG - Exonic
1119717492 14:76869084-76869106 GGGGCAGGTGAGGAGGCACGGGG - Intronic
1119717498 14:76869103-76869125 GGGGCAGGTGAGGAGGCACGGGG - Intronic
1119717504 14:76869122-76869144 GGGGCAGGTGAGGAGGCACGGGG - Intronic
1119913315 14:78371376-78371398 GCAGAAGGGGAGGTGGAAGGGGG - Intronic
1120011002 14:79414109-79414131 GGGGGAGTGGGGGCGGCAGGGGG + Intronic
1120400283 14:84022685-84022707 GCTCCAGGGGAGGTAGCAGGAGG + Intergenic
1122133068 14:99617337-99617359 GAGGGAGGGGAGGCGGGAGTGGG + Intergenic
1122271164 14:100568987-100569009 GCGGTGGGGGAGGCGGCGTGGGG - Intronic
1122324813 14:100875710-100875732 GAGGAAGGGGAGACGGGAGGTGG - Intergenic
1122366804 14:101199217-101199239 GTGGCTGGGCAGGGGGCAGGGGG + Intergenic
1122374229 14:101247773-101247795 GCGGCTGGGGAGGTGGGCGGAGG - Intergenic
1122448142 14:101782901-101782923 GAGGGAGGGGAGGGGGAAGGGGG - Intronic
1122635336 14:103127082-103127104 GCGGCGGCGGCGGCGGCGGGCGG + Exonic
1122694081 14:103544414-103544436 GCTGCAGGGGAGGGGGCATAGGG - Intergenic
1122889021 14:104724167-104724189 GGGGCAGGGGGCGGGGCAGGGGG - Intronic
1122897729 14:104768806-104768828 GCGGGAGGAGGGGCTGCAGGCGG - Intergenic
1122904821 14:104796770-104796792 GCAGCAGGGGAGGGGGTGGGAGG + Intergenic
1122930772 14:104932216-104932238 GCGTCAGGAAGGGCGGCAGGAGG - Intronic
1123024956 14:105420108-105420130 GCGGCAGCGGCGGCGGGTGGGGG - Intronic
1123063396 14:105604677-105604699 GAGGGTGGGGAGGCGGCAGCAGG - Intergenic
1123067891 14:105627435-105627457 GGGGCAGGTGTGGCTGCAGGGGG - Intergenic
1123068087 14:105628183-105628205 GGGGCAGGTGGGGGGGCAGGAGG - Intergenic
1123071910 14:105646160-105646182 GGGGCAGGTGTGGCTGCAGGGGG - Intergenic
1123087457 14:105723463-105723485 GAGGGTGGGGAGGCGGCAGCAGG - Intergenic
1123091573 14:105744436-105744458 GGGGCAGGTGTGGCTGCAGGGGG - Intergenic
1123097341 14:105772777-105772799 GGGGCAGGTGTGGCTGCAGGGGG - Intergenic
1123663398 15:22586374-22586396 GGGGCAGGTAAGGCTGCAGGTGG - Intergenic
1123684387 15:22786832-22786854 GAGGTAGGGCGGGCGGCAGGCGG + Exonic
1124009889 15:25829986-25830008 GGGGCCGGGGTGGAGGCAGGAGG + Intronic
1124127080 15:26945811-26945833 GCAGCAGGGGTGGGGGCGGGTGG - Intronic
1124259446 15:28175496-28175518 GGGGCAGGTAAGGCTGCAGGTGG - Exonic
1124317228 15:28680806-28680828 GGGGCAGGTAAGGCTGCAGGTGG - Intergenic
1124453612 15:29821773-29821795 GCGGCCGGGGAGGGGGCTGCGGG - Intronic
1124652456 15:31483853-31483875 GCGGCGCGGGCGGCGGCGGGCGG - Exonic
1124922312 15:34038912-34038934 GCGGCGGCGGAGGCGGCGGCGGG - Exonic
1125033066 15:35092455-35092477 TCAGCAGGGGCGGCGGCGGGTGG + Intergenic
1125508278 15:40279870-40279892 GCCCGCGGGGAGGCGGCAGGTGG - Intronic
1125508749 15:40281926-40281948 GCGCCAGGAGAGGCCGCGGGAGG + Exonic
1125723524 15:41856598-41856620 TCTGCGGGGGAGGAGGCAGGAGG + Exonic
1125725104 15:41864158-41864180 GCCGCAGTAGAGGAGGCAGGAGG - Intronic
1125852816 15:42920718-42920740 GAGGCGGCGGCGGCGGCAGGAGG - Intronic
1126030178 15:44489144-44489166 GGGGGAGGGGAGGAGGTAGGTGG - Intronic
1126113271 15:45187698-45187720 GCGGCCGGAGAGGGCGCAGGGGG + Intronic
1126615685 15:50577108-50577130 TTGGCAGGGGAGGGGGCGGGAGG + Intronic
1126852401 15:52805381-52805403 GCGGCGGCGGCGGCGGCGGGGGG + Intergenic
1127221742 15:56887408-56887430 GAGGCAGGGGTGGCGGGAAGTGG + Intronic
1127470106 15:59282879-59282901 GAGGGAGGGGAGGGGGGAGGGGG + Intronic
1128067861 15:64775608-64775630 GCGGCAGCGGCGGCGGGGGGCGG + Intergenic
1128149736 15:65355487-65355509 GCGGCAGGGGCGGCGGGCGAGGG + Intronic
1128711125 15:69872727-69872749 GCAGCACGGGAGGGGGCAGCGGG - Intergenic
1128842066 15:70858686-70858708 GAGGCAGGAGTGGAGGCAGGCGG - Intronic
1128862205 15:71083339-71083361 GGGGCAGGGGAGGGGGGAAGTGG + Intergenic
1129159569 15:73739895-73739917 GGGGCCGGGGAGGGGGCCGGGGG - Exonic
1129165601 15:73775420-73775442 GCGGCAGGGGAGGGGGGGGGAGG + Intergenic
1129273874 15:74433214-74433236 GGGGCGGGGGCGGGGGCAGGCGG + Intronic
1129288769 15:74547157-74547179 TCGGCGGGGGAGGGGGAAGGCGG - Intronic
1129296480 15:74602961-74602983 GCACCAGGGGAGGGGGCAAGAGG + Intronic
1129709143 15:77811417-77811439 GAGGCAGGGGAGGGGAGAGGTGG - Intronic
1129936142 15:79451642-79451664 GCGGCAGGGAAGCTGGCAGGAGG - Intronic
1130259222 15:82342846-82342868 GGTACAGGAGAGGCGGCAGGAGG - Exonic
1130269454 15:82436319-82436341 GGTACAGGAGAGGCGGCAGGAGG + Exonic
1130282045 15:82526337-82526359 GGTACAGGAGAGGCGGCAGGAGG + Intergenic
1130473412 15:84242500-84242522 GGTACAGGAGAGGCGGCAGGAGG + Exonic
1130480826 15:84356564-84356586 GGTACAGGAGAGGCGGCAGGAGG + Intergenic
1130490886 15:84431195-84431217 GGTACAGGAGAGGCGGCAGGAGG - Intergenic
1130502470 15:84509994-84510016 GGTACAGGAGAGGCGGCAGGAGG - Intergenic
1130545961 15:84857845-84857867 GAGGCCGGTGAGGCGGCGGGAGG - Exonic
1130595691 15:85247078-85247100 GGTACAGGAGAGGCGGCAGGAGG + Intergenic
1130655933 15:85792236-85792258 GGTGCAGGGGAGGAGGGAGGAGG - Intronic
1130957695 15:88639098-88639120 GCAGCTGGGGAGGCAGCGGGAGG + Intronic
1131095000 15:89649183-89649205 GGGGCGGGGTAGGCGGCTGGGGG + Exonic
1131353585 15:91723888-91723910 GAGGCAGGGAAGAGGGCAGGGGG + Intergenic
1131367627 15:91853599-91853621 GAGGCAGCGGCGGCGGCGGGCGG + Intergenic
1131436852 15:92429840-92429862 GGGGCAGGGGAGGATCCAGGAGG + Intronic
1131972143 15:97903631-97903653 GGGGCGGGGAAGGAGGCAGGGGG + Intergenic
1132071097 15:98777142-98777164 GCGGCAGGGGGCCAGGCAGGAGG + Intronic
1132303246 15:100789433-100789455 GTGGCAGGGTAGGGGGCGGGTGG - Intergenic
1132513822 16:356886-356908 CAGGCAGGGGAGGCCGCTGGAGG + Intergenic
1132554799 16:567755-567777 GCGGCAGGGCAGGAGGCAGATGG - Exonic
1132566419 16:625589-625611 GCCACAGGAGGGGCGGCAGGCGG - Intronic
1132569354 16:637285-637307 GCGGCAGGGGCGGCAGAGGGCGG + Intronic
1132663560 16:1071929-1071951 GAGTCAGGGGAGGGGGCTGGGGG + Intergenic
1132727751 16:1346092-1346114 TGGGGAGGGGAGCCGGCAGGAGG + Intronic
1132794495 16:1712750-1712772 GAGGGAGGGGTGGGGGCAGGTGG - Intronic
1132843808 16:1990794-1990816 CCGGCAGGGGAGGTGGCAGTTGG + Intronic
1132939362 16:2499283-2499305 GGGCCAGCGGAGGCTGCAGGAGG + Intronic
1132983851 16:2753205-2753227 GGGGAAGGGGCGGCGGCGGGGGG + Intronic
1132999578 16:2842168-2842190 GTGGGAAGGGAGGCGGGAGGTGG - Intergenic
1133035251 16:3030698-3030720 GCGGCTGGAGAGTCTGCAGGGGG - Exonic
1133148522 16:3808609-3808631 GCAGCAGTGGAGGCAGCAGAGGG + Intronic
1133156449 16:3880134-3880156 GCGGCGGCGGCGGCGGCCGGGGG - Exonic
1133490671 16:6264990-6265012 GCGGCATGGGAGGCAGGACGAGG - Intronic
1133740426 16:8647072-8647094 GCTGCAAGGGAGGCGGAAAGGGG - Exonic
1133981697 16:10637432-10637454 GAGGGAGGGGAGGAGGAAGGAGG + Intronic
1134066767 16:11233345-11233367 GAGGCAGCGGAGGAGGAAGGGGG - Intergenic
1134093142 16:11402123-11402145 GCGGCAGGGGGAGGGGCAGCGGG + Exonic
1134628786 16:15741858-15741880 GCTGCAGGTGACACGGCAGGAGG - Exonic
1135420598 16:22303255-22303277 GAGGCACGGGAGGGTGCAGGAGG - Intronic
1135712504 16:24729702-24729724 GCGGCGGCGGCGGCGGCAGCGGG + Exonic
1136289836 16:29264880-29264902 GCTGCTGGGAAGGAGGCAGGAGG + Intergenic
1136377908 16:29876442-29876464 GCCGCAGAGGAGGGGTCAGGAGG + Intronic
1136411612 16:30080968-30080990 GCGGAAGAGGGAGCGGCAGGGGG + Intronic
1136957426 16:34802923-34802945 GCGGCAGCGGAGTGGGCGGGGGG - Intergenic
1138558685 16:57787457-57787479 GCGGCAGGGCAGTGGGAAGGGGG + Intronic
1138708523 16:58942422-58942444 GCGGCAGGGGGCGGGGGAGGCGG - Intergenic
1139215512 16:65122132-65122154 GGGGCGGGGGGGGCGGGAGGAGG + Exonic
1139304309 16:65970276-65970298 GGGGCAGGGGTGGGGGTAGGGGG - Intergenic
1139334699 16:66223600-66223622 ATGTCAGGGGAGGCTGCAGGGGG - Intergenic
1139430965 16:66910861-66910883 AGGGCCGGGGAGGTGGCAGGAGG - Intronic
1139451169 16:67029125-67029147 GCGGCGGCGGCGGCGGCCGGGGG + Intronic
1139603549 16:68001576-68001598 GAGGGTGGGGAGGAGGCAGGAGG + Intronic
1139749479 16:69100589-69100611 TGAGCAGGGGAGGCGGGAGGAGG - Intergenic
1139750362 16:69106205-69106227 TCGGCTGGGCAGGCGGCAGTCGG + Intronic
1139957851 16:70701604-70701626 GGGGCAGGAGAAGCAGCAGGAGG - Intronic
1140698904 16:77563115-77563137 GCTACATGGGAGGAGGCAGGAGG + Intergenic
1140892247 16:79295087-79295109 GGGGTGGGGGAGGGGGCAGGGGG + Intergenic
1141054590 16:80803946-80803968 GCGCCGCGGGAGGCGGCGGGCGG + Intronic
1141054610 16:80804006-80804028 GCGGCGGCGGCGGCGGCCGGAGG - Intronic
1141132468 16:81445215-81445237 GCGCCGGGGGAGGGGGCTGGGGG - Exonic
1141538554 16:84700260-84700282 GCGGGCGCGGAGGCGGCGGGTGG - Intronic
1141589958 16:85061826-85061848 GCGGAAGGGGTTGCAGCAGGAGG + Intronic
1141625416 16:85258886-85258908 GCGGCAGGGCAGCTGGCGGGGGG - Intergenic
1141666277 16:85467086-85467108 GGGGCAGGGTAGGCGGTAGATGG + Intergenic
1141696732 16:85623802-85623824 GCAGCAGGGGAGGTGGCGCGGGG - Intronic
1141727554 16:85799746-85799768 GCGGCAGGTGAGACAGGAGGTGG + Exonic
1141781514 16:86165024-86165046 GCGACAGTGGTGGGGGCAGGGGG + Intergenic
1141864441 16:86740517-86740539 GTGGGAGGGGAGGCGGGAGAAGG + Intergenic
1141869491 16:86775085-86775107 CCGGCAGGCCAGGCGGCGGGTGG + Intergenic
1141953299 16:87353202-87353224 GAGGCAGGAGAGGCTGCATGCGG - Intronic
1142095720 16:88238356-88238378 GCTGCTGGGAAGGAGGCAGGAGG + Intergenic
1142156283 16:88534143-88534165 GCGGCGGGAGAGGGGGCCGGGGG - Exonic
1142175260 16:88642339-88642361 GCAGAGCGGGAGGCGGCAGGTGG + Intergenic
1142185300 16:88692067-88692089 GGGGCAGGGGTGGGGGCCGGGGG - Intergenic
1142287873 16:89178833-89178855 GCGGCAGGGGAGGTGCCTGCAGG - Intronic
1142409337 16:89908122-89908144 GTGGCAGGGGAGGTGAGAGGAGG - Intronic
1142429731 16:90019532-90019554 GCGGCTGGGGGGGCGCCGGGAGG - Intronic
1142467391 17:144070-144092 GCGGCGGGCGGGGCGGCGGGCGG + Intergenic
1142467397 17:144082-144104 GCGGCGGGCGGGGCGGCGGGCGG + Intergenic
1142471899 17:169344-169366 GGGCCAGGGGAGGAGGAAGGGGG + Intronic
1142509366 17:384833-384855 GCTGGAGGGGAGGGGGCAGCAGG + Intronic
1142581985 17:948877-948899 GGGGGAGAGGAGGAGGCAGGGGG - Intronic
1142581993 17:948896-948918 GGGGGAGAGGAGGAGGCAGGGGG - Intronic
1142582001 17:948915-948937 GGGGGAGAGGAGGAGGCAGGGGG - Intronic
1142582009 17:948934-948956 GGGGGAGAGGAGGAGGCAGGGGG - Intronic
1142582050 17:949029-949051 GGGGGAGAGGAGGAGGCAGGGGG - Intronic
1142622507 17:1173809-1173831 GGGGCAGGGAATGTGGCAGGAGG - Intronic
1142759517 17:2034736-2034758 GGAGCAGGGGAGGGGGAAGGGGG - Intronic
1142759527 17:2034751-2034773 GCAGCAGGGGAGGGGGGAGCAGG - Intronic
1142795535 17:2303962-2303984 GCGGCCGGGGAGGCGCGCGGAGG + Exonic
1143018456 17:3904178-3904200 GGAGGAGGGGAGACGGCAGGAGG + Intronic
1143213648 17:5208064-5208086 GAGGCAGGGGAGCAGTCAGGGGG + Intergenic
1143494979 17:7307668-7307690 GCGGCGGCGGCGGCGGCAGCGGG + Intronic
1143514190 17:7411257-7411279 GGGGCAGGGGAGGCAGCGGCTGG + Intronic
1143527221 17:7479596-7479618 GCGGCGGCGGCGGCGGCAGCGGG - Intronic
1143548582 17:7614799-7614821 GCAGCGGGGGCGGCGGCGGGCGG - Exonic
1143590783 17:7885058-7885080 GCGGCGGGGGCGGCGGCGGCGGG - Exonic
1143632891 17:8148873-8148895 GACGCTGGGGAGGGGGCAGGAGG + Intronic
1143764673 17:9129749-9129771 GCAGAAGGGGAGACGGCAGCCGG - Intronic
1144575972 17:16429723-16429745 GTGGCTGGGGAGATGGCAGGAGG + Intronic
1144586694 17:16491774-16491796 GCGCCAGGGCCGGCGGGAGGAGG - Exonic
1144595683 17:16568705-16568727 CGGGAAGGGGAGGCGACAGGAGG - Intronic
1145124249 17:20287018-20287040 GAGGCAGGGGAGGCTGCTGACGG - Intronic
1145259107 17:21344127-21344149 GCGGCAGGTGAGGCTGCAAGGGG - Intergenic
1145317511 17:21743876-21743898 GCGGCAGGTGAGGCTGCAAGGGG + Intergenic
1145747063 17:27328245-27328267 GCAGCAGGGCAGGGGGCAGGTGG + Intergenic
1145792728 17:27637961-27637983 GAGGCAGTGGAGGCTGCAGCAGG - Intronic
1145807597 17:27745830-27745852 GAGGCAGTGGAGGCTGCAGCAGG - Intergenic
1145925650 17:28644944-28644966 GCGGCGGCGGCGGCGGCGGGAGG - Intronic
1145937997 17:28726307-28726329 GCGGACGGGGCGGGGGCAGGCGG - Intronic
1145994458 17:29097424-29097446 GGGGCAGGGGGAGCAGCAGGTGG + Intronic
1146255885 17:31391532-31391554 GCGGCGGGGGCGGCGGCGGCGGG - Intergenic
1146258650 17:31406458-31406480 GAGGCAGGGGAGACAGAAGGAGG - Intronic
1146492384 17:33292273-33292295 GCGGCAGCGGCGGCGCCGGGCGG - Exonic
1146505540 17:33401438-33401460 GCAGGAGGGGAGCCAGCAGGTGG - Intronic
1146646365 17:34579773-34579795 GCGGCCAGGGAAGCGGCAGCTGG - Intergenic
1146896591 17:36545663-36545685 GCGGCGGCGGCGGCGGCAGCTGG + Exonic
1146911913 17:36653761-36653783 GCGGCAGGGGAGGGGGGAGTGGG + Intergenic
1147161765 17:38572765-38572787 GCGGCTGCGGAGGCGGCCGGGGG - Intronic
1147341392 17:39754864-39754886 GCGGCGTGGGCGGCGGGAGGAGG + Intergenic
1147508703 17:41046926-41046948 GCCGCAGGGGGGCCGGCAGCAGG + Exonic
1147510543 17:41065504-41065526 GCCGCAGGGGGGCCGGCAGCAGG + Exonic
1147512639 17:41084526-41084548 GCAGCTGGGGCGGCAGCAGGTGG - Exonic
1147512644 17:41084541-41084563 GCAGCAGGGGCGGCAGCAGCTGG - Exonic
1147513860 17:41097638-41097660 GCAGCAGGGGCGGCAGCAGCTGG + Exonic
1147514370 17:41101886-41101908 GCAGCTGGGGTGGCAGCAGGTGG + Exonic
1147514392 17:41102006-41102028 GCAGCTGGGGCGGCAGCAGGTGG + Exonic
1147514838 17:41105888-41105910 GCAGCAGGGGCGGCAGCAGCTGG - Exonic
1147515955 17:41117839-41117861 GCAGCAGGGGCGGCAGCAGCTGG + Exonic
1147515966 17:41117899-41117921 GCAGCTGGGGTGGCAGCAGGTGG + Exonic
1147516579 17:41123628-41123650 GCAGCAGGGGCGGCAGCAGCTGG + Exonic
1147516589 17:41123688-41123710 GCAGCTGGGGCGGCAGCAGGTGG + Exonic
1147516610 17:41123808-41123830 GCAGCTGGGGCGGCAGCAGGTGG + Exonic
1147516623 17:41123883-41123905 GCAGCTGGGGCGGCAGCAGGTGG + Exonic
1147516632 17:41123928-41123950 GCAGCTGGGGCGGCAGCAGGTGG + Exonic
1147516645 17:41124003-41124025 GCAGCTGGGGCGGCAGCAGGTGG + Exonic
1147518006 17:41140368-41140390 GCAGCTGGGGCGGCAGCAGGTGG + Exonic
1147518881 17:41149333-41149355 GCAGCAGGGGCGGCAGCAGCTGG + Exonic
1147518914 17:41149528-41149550 GCAGCAGGGGCGGCAGCAGCTGG + Exonic
1147518936 17:41149648-41149670 GCAGCTGGGGCGGCAGCAGGTGG + Exonic
1147519824 17:41160242-41160264 GCAGCTGGGGCGGCAGCAGGTGG + Exonic
1147519849 17:41160377-41160399 GCAGCTGGGGCGGCAGCAGGTGG + Exonic
1147519870 17:41160497-41160519 GCAGCTGGGGTGGCAGCAGGTGG + Exonic
1147519884 17:41160572-41160594 GCAGCTGGGGCGGCAGCAGGTGG + Exonic
1147520493 17:41167771-41167793 GCAGCTGGGGCGGCAGCAGGTGG + Exonic
1147520505 17:41167861-41167883 GCAGCTGGGGCGGCAGCAGGTGG + Exonic
1147520519 17:41167951-41167973 GCAGCTGGGGCGGCAGCAGGTGG + Exonic
1147520533 17:41168041-41168063 GCAGCTGGGGCGGCAGCAGGTGG + Exonic
1147521546 17:41178045-41178067 GCAGCTGGGGCGGCAGCAGGTGG + Exonic
1147577797 17:41612614-41612636 GCGGCATCGGAGGCGGCATCGGG - Exonic
1147579975 17:41622721-41622743 GAAGGAGGGGAGGCGGGAGGCGG - Intronic
1147599785 17:41738670-41738692 AGGCCAGGGGAGGGGGCAGGAGG - Intergenic
1147600774 17:41743930-41743952 GCTACAGGGCAGGGGGCAGGTGG - Intergenic
1147671868 17:42181045-42181067 GAGGGAGGGGAGGAGGCAGGAGG - Exonic
1147793079 17:43025280-43025302 GGGGCGGGGGAGGCGGCGGCGGG + Exonic
1147872691 17:43598682-43598704 GAGGCAGGGAAGGGGGCAGGAGG - Intergenic
1148078740 17:44955705-44955727 GCATCAGAGGAGGAGGCAGGAGG - Intergenic
1148102189 17:45099046-45099068 GCAGAAGGGGAGGAGGGAGGAGG + Intronic
1148878535 17:50707606-50707628 GCAGCAGGAGAGGCTGCGGGAGG - Exonic
1148910272 17:50938883-50938905 GTGGCAGGGGAGGGAGCAAGGGG - Intergenic
1149314012 17:55421930-55421952 GGAGCCGGGGAGGCGGGAGGCGG - Exonic
1149410288 17:56397976-56397998 GTGACAGGGGAGGTGGCAGTAGG + Intronic
1149774758 17:59348475-59348497 TTGGCCGGGGAGGCGGCATGGGG + Intronic
1150060584 17:62065370-62065392 GCGGCGGCGGCGGCGGCGGGGGG - Intergenic
1150210521 17:63438838-63438860 ATGGGAGGAGAGGCGGCAGGAGG + Intronic
1150484872 17:65536839-65536861 GCGGCCGCGGCGGCGGCAAGCGG + Intronic
1150561921 17:66302327-66302349 GCGGCGGCGGCGGCGGCCGGGGG - Intergenic
1150654834 17:67032947-67032969 GCGGGAGGGGAGGTGGCGGATGG - Exonic
1151258608 17:72899241-72899263 GTGGCAGGGGAGGGGCAAGGTGG - Intronic
1151506492 17:74531251-74531273 GGGGCAGGGCAGGAGGCAGAGGG - Intronic
1151544527 17:74784618-74784640 TTGGCAGGGGAGGAGGCTGGGGG + Intronic
1151579713 17:74971287-74971309 GTGGCAGGGAAGGTGGCAAGTGG - Intronic
1151604607 17:75128612-75128634 CGGGCAGGGGAGGTGGGAGGAGG + Intronic
1151717815 17:75840379-75840401 GGGGCAGCGGAGGCGACAGGAGG + Intronic
1151748580 17:76024350-76024372 GGTGCTGGGGAGGGGGCAGGCGG + Intronic
1151919175 17:77140963-77140985 GGGGCCGGGGAGGCGGGAGGGGG - Intronic
1151946304 17:77321788-77321810 GGGCCAGGGGAGACGGCAGAAGG + Intronic
1151957164 17:77386223-77386245 GCAGGAGGGGTGGGGGCAGGAGG - Intronic
1151965254 17:77427803-77427825 CCGGCAGGGGAGCCGAGAGGGGG + Intronic
1151975222 17:77480625-77480647 ACAGCACGGGAGGCTGCAGGGGG - Intronic
1152097125 17:78278802-78278824 GTGGGAGGGGTGGGGGCAGGTGG - Intergenic
1152149491 17:78590035-78590057 GCGGATGGGGAGATGGCAGGAGG - Intergenic
1152154373 17:78623091-78623113 GAGGCAGGGAAGATGGCAGGCGG + Intergenic
1152225369 17:79090324-79090346 GACGCAGGGGACGCGACAGGAGG + Intronic
1152241921 17:79165434-79165456 GTGCCTGGGGAGGCCGCAGGAGG + Intronic
1152280057 17:79379919-79379941 GCGGGAGAGGCCGCGGCAGGAGG - Intronic
1152363678 17:79843645-79843667 GCGGCGGCGGCGGCGGCGGGCGG - Intergenic
1152461505 17:80444612-80444634 GCGGCAGGGGAGGGCGTGGGGGG + Intergenic
1152470209 17:80487018-80487040 GCAGCAAGGGAGGTGGAAGGAGG - Intergenic
1152519095 17:80845109-80845131 GCTGCAGGGGAGGCTGCCGTTGG - Intronic
1152552392 17:81036083-81036105 GCGGCAGGGGAGGCTTCCAGCGG - Intronic
1152587893 17:81197184-81197206 GCCGGAGGGCAGGTGGCAGGCGG + Intronic
1152625808 17:81387462-81387484 CCGTCTGGGGAGGCGGCCGGAGG - Intergenic
1152638538 17:81440020-81440042 GCTGCAGGGGAGCAGGCATGGGG + Intronic
1152640760 17:81448285-81448307 GGCCCAGGGGAGGGGGCAGGAGG + Intronic
1152681449 17:81670452-81670474 GCGTGAGTGGAGGCGGGAGGGGG + Exonic
1152704971 17:81838752-81838774 GGGGCAGGGGAGGGGACAGGGGG - Intergenic
1152730690 17:81968141-81968163 GCGGCGGCGGGGGCGGCCGGCGG + Intergenic
1152867953 17:82735514-82735536 GCGGGAGGGGCGGCCTCAGGCGG - Intergenic
1152921389 17:83068218-83068240 GCGACAGCGGGGGCGGCAGCGGG + Intergenic
1152921552 17:83068660-83068682 GCGACAGCGGGGGCGGCAGCGGG + Intergenic
1153164332 18:2244704-2244726 GCTCCAGTGGAGGTGGCAGGGGG - Intergenic
1153262482 18:3237975-3237997 GGGGCAGGGGTGGCGGTCGGGGG + Intergenic
1153285382 18:3450965-3450987 GCGGCGGGGGCGGGGGCGGGGGG - Intronic
1153286629 18:3462062-3462084 GCAGCAGGGGAGACGCCAGTGGG - Intergenic
1153583638 18:6599821-6599843 GGGGCGGGGGAGGGGGTAGGGGG - Intergenic
1153675821 18:7454964-7454986 GCTGCAGTGGACGCGTCAGGGGG + Intergenic
1153855093 18:9137221-9137243 CCGGGAGGGGCGGCGGCGGGCGG - Intronic
1154274582 18:12948059-12948081 GCGGCAGCGGCGGCGGCGCGTGG - Exonic
1155064773 18:22258832-22258854 GCGGCAGGGGCGGGGGGTGGGGG - Intergenic
1155160233 18:23189624-23189646 ACTGCAGGGCAGGCGGCAGCAGG + Intronic
1155392723 18:25352310-25352332 GCGGCGGCGGCGGCGGCGGGCGG - Intergenic
1155928713 18:31684762-31684784 GCGGGAGGAGGGGCTGCAGGTGG + Intronic
1156028350 18:32683623-32683645 GGGGCAGGGGAGGCTGAAGGAGG - Intronic
1156099662 18:33578455-33578477 GCGGCGGCGGCGGCGGCGGGTGG - Intergenic
1156292403 18:35759452-35759474 GAGGCTGGGGAGGGGGGAGGGGG + Intergenic
1156716840 18:40022428-40022450 GAGGCAGGGCAGGCTGCATGAGG + Intergenic
1157493417 18:48139173-48139195 GCGGGAGTGGAGGCAGGAGGGGG + Intronic
1157687033 18:49650948-49650970 CCGGCAGGTGCGGCGGCTGGGGG + Intergenic
1157742495 18:50106061-50106083 GAGGCAGGGAAGGGAGCAGGCGG - Intronic
1158718212 18:59899659-59899681 GCGGCAGTGGTGGCGGGAGCTGG - Intergenic
1158954137 18:62523550-62523572 GCGGCGGCGGCGGCGGCGGGGGG - Exonic
1158954156 18:62523592-62523614 GCGGCGGCGGCGGCGGCAGAGGG - Exonic
1159313786 18:66744092-66744114 GCAGCAGGGGAGGTGAGAGGTGG - Intergenic
1159798181 18:72868050-72868072 GCGGCCGGGGGGGGGGCCGGGGG + Intronic
1160204711 18:76822898-76822920 GCGGCGGCTGAGGCGGGAGGCGG + Intronic
1160313615 18:77820704-77820726 GCGGGAAGGTAGGCGACAGGCGG + Intergenic
1160517150 18:79484865-79484887 GCTGCAGGGGAGGCCGCACGTGG + Intronic
1160536816 18:79598982-79599004 GGGGCGGGGGCGGGGGCAGGTGG - Intergenic
1160659548 19:291614-291636 GGGGGAGGGGAGGAGGGAGGGGG + Intergenic
1160706312 19:531800-531822 GGCGCAGAGGAGGAGGCAGGCGG + Exonic
1160725992 19:618053-618075 GCGGCAGGGGTGGGGCGAGGAGG - Intronic
1160745337 19:708801-708823 GCGGCGGCGCAGCCGGCAGGAGG + Intergenic
1160800299 19:964523-964545 GCTGCAGAGGAGGGGGCAGTGGG + Intronic
1160867065 19:1260674-1260696 GCGGGCGGAGGGGCGGCAGGCGG + Intronic
1160919688 19:1513685-1513707 CCGGCAGGGAGGGCGGGAGGCGG - Intergenic
1160984601 19:1832484-1832506 GCTGCAGAGGAGGTGGGAGGAGG + Intronic
1160990053 19:1856804-1856826 ACAGGCGGGGAGGCGGCAGGAGG + Intronic
1161041589 19:2113355-2113377 GGGGCGGGGGCGGGGGCAGGCGG + Exonic
1161078600 19:2299216-2299238 GCTGCCGGGGAGGCAGGAGGGGG + Intronic
1161087111 19:2340372-2340394 GCGCCAGGGGTGGCGGGGGGAGG + Intronic
1161210392 19:3062529-3062551 GGGGCACGGGCGGCGGCAGGTGG - Intronic
1161252147 19:3285985-3286007 GCAGGAGGGGCGGCGGCTGGGGG - Exonic
1161454422 19:4362992-4363014 GAGGCAGGGGATGCGACTGGGGG - Intronic
1161471140 19:4457355-4457377 GCGGCGGGGGAGGCGAGGGGAGG - Intronic
1161473332 19:4472271-4472293 GCGGCGGCGGCGGCGGCAGCGGG - Exonic
1161537531 19:4829393-4829415 TGGGCAGGGGAGGCGGGCGGGGG - Intronic
1161681324 19:5681155-5681177 GCGGTCGGGGACCCGGCAGGAGG + Exonic
1161706580 19:5824991-5825013 GCAGCAGGGGGGGCGGTGGGAGG + Intronic
1161849593 19:6731568-6731590 GAGGGAGGGGAGGGGGCTGGGGG + Intronic
1162033057 19:7925635-7925657 GCGGCGGCGGCGGCGGCAGGAGG - Intronic
1162070444 19:8149363-8149385 GGGGCGGGGGGGCCGGCAGGGGG - Intronic
1162346079 19:10118945-10118967 GCGGCAGTGGAGCTGGCAGAAGG + Exonic
1162372930 19:10289866-10289888 GCGGCGGCAGAGGCGGCGGGGGG - Intergenic
1162490361 19:10987749-10987771 GCGGCGGGTGGGACGGCAGGGGG - Exonic
1162568460 19:11457263-11457285 GCGGGCGGGGAGCAGGCAGGCGG - Intronic
1162740246 19:12769979-12770001 GCGGCAGGTGCGGCAGCTGGAGG - Exonic
1162778920 19:12996513-12996535 GGGGCAGGGGAGGGGAGAGGGGG + Intronic
1162934157 19:13972866-13972888 GCGGCGGGGGAGGCGGTGGCGGG - Exonic
1162937017 19:13986405-13986427 GCGCCAGGGGATGCGCCACGAGG + Intronic
1162967545 19:14163186-14163208 GCGGTTGGGCAGGCGGTAGGTGG + Exonic
1163034270 19:14562372-14562394 GTGGCAGGGCTGGTGGCAGGCGG + Intronic
1163121942 19:15223543-15223565 GCGGCCGCGGAGGCGGAAGAAGG + Intergenic
1163312264 19:16521591-16521613 GCGGCATGGGGGGTGGGAGGCGG + Exonic
1163424957 19:17236098-17236120 GCGGGAGGGGAGGCGGGGGGGGG + Intronic
1163441735 19:17325329-17325351 GCAGCAGCGCAGGCGGCGGGAGG - Exonic
1163442074 19:17327406-17327428 GCGACAGGGGCGGGGGCAGCTGG - Intronic
1163516269 19:17765773-17765795 GCAGAAGTGGAGGCAGCAGGAGG + Intronic
1163556888 19:17998298-17998320 GAGGCAGGGGAGGCGGGGGTGGG - Exonic
1163563181 19:18033077-18033099 GAGGCAGGGGACGAGGAAGGAGG - Intergenic
1163581981 19:18144616-18144638 GTGGCAGTGGTGGCGGCAGTGGG + Exonic
1163607094 19:18281481-18281503 GCGGCGGGGGAGGCGGAGGATGG - Exonic
1163608933 19:18291401-18291423 GAGGCAAGGCAGGCGGCAGGGGG + Intergenic
1163674149 19:18646958-18646980 GGGGCAGGGGCGGCGGGGGGTGG + Intronic
1163773660 19:19205567-19205589 GCAGCAGGGGTGGGGGCTGGCGG + Intergenic
1163785829 19:19274500-19274522 CCCGCAGGGCAGGCGTCAGGTGG - Intergenic
1164309570 19:24033922-24033944 GTGGCAGGAGCTGCGGCAGGTGG + Intronic
1164604838 19:29590365-29590387 GGGGCAAGGGAGGCGGCAGGAGG - Intergenic
1165057511 19:33187404-33187426 GCGGGGGGGCAGGGGGCAGGAGG - Intronic
1165061442 19:33207058-33207080 GCGGCCGAGGCGGCGGCGGGAGG - Exonic
1165105857 19:33469371-33469393 GCTGCAGGGGAACCCGCAGGAGG + Intronic
1165204511 19:34172429-34172451 GCGGCAGCGGCGGCGGCGCGGGG - Intergenic
1165349656 19:35269021-35269043 GAGGGAGGGGAGGGGGCGGGCGG - Intronic
1165420018 19:35717981-35718003 GGGGCCGGGGAGGCGGGGGGAGG - Intergenic
1165463617 19:35959199-35959221 GCTGCAGGGCTCGCGGCAGGCGG + Intergenic
1165482752 19:36074543-36074565 TCGGCAGGGGCTGCGGCAGGGGG + Intronic
1165792927 19:38502788-38502810 GGGGCAGGGGCAGGGGCAGGGGG + Intronic
1165924943 19:39320950-39320972 GCGGCGGCGGTGGCGGCGGGCGG - Intergenic
1166218763 19:41352656-41352678 GGGGCAGGGGAGCCGGGAGGGGG - Intronic
1166298139 19:41898556-41898578 GAGCCAGGTGAAGCGGCAGGAGG + Exonic
1166300078 19:41908216-41908238 CCGGCAGCTGAGCCGGCAGGGGG - Intronic
1166301514 19:41914183-41914205 GGGACAGGGGAGGCTCCAGGAGG - Intronic
1166307043 19:41940877-41940899 GCGGCGGCGGCGGCGACAGGCGG - Intergenic
1166327995 19:42062892-42062914 GGGGAAGGAGAGGAGGCAGGGGG - Intronic
1166329561 19:42070160-42070182 GCGGCAGGCGGGCAGGCAGGCGG - Intronic
1166361080 19:42253348-42253370 GCGGCAGGCCAGGAGGCAGACGG + Intronic
1166367444 19:42284563-42284585 GCGGCGGGGGGGGGGGCATGCGG + Intronic
1166373116 19:42313406-42313428 GCAGCAGCGGCGGCAGCAGGCGG - Exonic
1166373167 19:42313577-42313599 CCGCCAGGAGGGGCGGCAGGGGG - Intronic
1166534378 19:43563111-43563133 GAGGCAGGGGAGTCAGCAGGAGG - Intronic
1166547182 19:43640396-43640418 GGGACAGGGGAGGCTGCAGCTGG + Intergenic
1166719294 19:44988231-44988253 GAGGGAGGGGAGGAGGAAGGGGG - Intronic
1166843360 19:45712207-45712229 GTGGCCGGGGAGTCGGCCGGGGG + Exonic
1166880658 19:45927985-45928007 GCGGCGGTGGAGCCGGCTGGCGG + Intergenic
1166887977 19:45973224-45973246 GGGGCGGGGGAGCGGGCAGGGGG - Intronic
1167152920 19:47719820-47719842 AGGGCAGGGGTGCCGGCAGGGGG + Intronic
1167293656 19:48637385-48637407 GGGGCGGAGGAGGGGGCAGGAGG + Exonic
1167465854 19:49650948-49650970 GATGCAGAGGAGGGGGCAGGGGG - Exonic
1167466021 19:49651523-49651545 GCGGCAGCAGGGGCGGCGGGAGG - Exonic
1167533162 19:50031616-50031638 GCTACAGTGGAGGCAGCAGGGGG - Intronic
1167578496 19:50328971-50328993 GCGGCAGCGGTGGCGGCGGCGGG + Exonic
1167586992 19:50380867-50380889 CAGGCAGGGGTGGAGGCAGGCGG - Intronic
1167593559 19:50416588-50416610 CCTGCAGGAGAGGAGGCAGGTGG - Exonic
1167638404 19:50667819-50667841 GGGGCCTGGGAGGCGGCTGGGGG + Exonic
1167697381 19:51023263-51023285 GCATTAGGGGAGGTGGCAGGGGG - Intronic
1167738677 19:51311706-51311728 GCGGCGGGGGCGGGGGGAGGGGG - Intergenic
1168072000 19:53958577-53958599 GGGGCTGGGGACGCGGGAGGGGG + Intergenic
1168076351 19:53982605-53982627 GCGGCGGCGGAGGCGGCGGCGGG + Exonic
1168100349 19:54138122-54138144 GCTGCAGAGGCGGCGGCAGGGGG - Intronic
1168151108 19:54449320-54449342 GCGGCAGGCGAGCAGGCGGGCGG + Intronic
1168277106 19:55284393-55284415 GCCGCAGGGGGGGCGGCCGGGGG + Exonic
1168307496 19:55443310-55443332 AGGGCAGGGGAGGCAGCTGGAGG + Intergenic
1168309355 19:55452712-55452734 GCGGCGTGGGGGGCGGCCGGAGG + Intergenic
1168316856 19:55488376-55488398 GGGGGAGGGGGGGCGGGAGGGGG - Intergenic
1168337673 19:55605620-55605642 GCTGCCGGGGAGGGGGGAGGGGG + Intronic
1168339123 19:55613807-55613829 GCGGCGGGGGCTGCGGCGGGGGG - Exonic
1168558317 19:57362262-57362284 GGGGCAGGGGGCGCGGCGGGAGG - Intergenic
925020627 2:564943-564965 GCCGCTGGGGAGGCTGCAGAGGG + Intergenic
925058305 2:872058-872080 GCAGCAGGGGTGGCAGAAGGAGG + Intergenic
925096578 2:1209048-1209070 GAGGCAGAGGAGGCTGCATGCGG - Intronic
925098240 2:1224449-1224471 GCAGCAGAGGAGGCGAGAGGGGG - Intronic
925518175 2:4708399-4708421 GGGGAAGAGGAGGGGGCAGGAGG - Intergenic
925714689 2:6773172-6773194 GCGGCAGGAGACGCTGCAGAGGG + Intergenic
925755361 2:7128035-7128057 GAGGAAGGGGAGGGGGGAGGGGG - Intergenic
925907125 2:8546174-8546196 CCGGCAGGGCGGGCGGCAGGAGG - Intergenic
925929296 2:8694175-8694197 GGGGCAGGGGAGGGGGCTGGGGG + Intergenic
925948917 2:8893066-8893088 GGGGTGGGGGAGGAGGCAGGGGG + Intronic
925975673 2:9140251-9140273 GAGGGAGGGGAGGCTCCAGGGGG + Intergenic
925980025 2:9169149-9169171 GCAGCTGGGGAGGAGGCGGGAGG + Intergenic
926010003 2:9400192-9400214 GCAGGAGGGGAGGGGGCAGGAGG - Intronic
926010011 2:9400207-9400229 GCAGGAGGGGAGGGGGCAGGAGG - Intronic
926010019 2:9400222-9400244 GCAGGAGGGGAGGGGGCAGGAGG - Intronic
926045832 2:9708969-9708991 AGGCCAGGGGAGGGGGCAGGAGG - Intergenic
926217107 2:10912368-10912390 GCGGCGGCGGCGGCTGCAGGGGG + Exonic
926320318 2:11744749-11744771 GTGGGAGGGGAGGGTGCAGGAGG + Intronic
926320645 2:11746567-11746589 GGGGCAGGGGCGGGGGCAGAGGG - Intronic
926633857 2:15160587-15160609 GGGGGAGGGGGGGGGGCAGGAGG + Intergenic
926647660 2:15307033-15307055 CCGGGAGGGGAGGCAGAAGGAGG - Intronic
926683549 2:15681090-15681112 GGGGGAGGGGAGGGGGGAGGGGG + Intergenic
927141158 2:20131786-20131808 GGGGAAGGGGAGGGGACAGGAGG - Intergenic
927215834 2:20667370-20667392 GCGGCGGCGGCGGCGGCGGGCGG + Exonic
927417847 2:22897535-22897557 GCGGCAGGTGCAGCAGCAGGAGG + Intergenic
927622658 2:24678026-24678048 GGGGCAGGGGTGGCAGGAGGGGG - Intronic
927652396 2:24920336-24920358 GCGGCGAGGGAGGCGCCGGGCGG + Intergenic
927682920 2:25151942-25151964 GCGTGAGCGGCGGCGGCAGGTGG + Exonic
927708834 2:25312964-25312986 GGGGAAGGGGAGCAGGCAGGGGG + Intronic
927843983 2:26462004-26462026 GGGGCAGGAGAGGAGGCAGAGGG - Intronic
927881418 2:26692609-26692631 GCGGGAGGGCTGGCGGGAGGAGG + Intergenic
927904750 2:26848376-26848398 GCCGCAGGGGACGCGGCGGGAGG + Intronic
927920788 2:26970755-26970777 GCGGAGGGGGAGGGGACAGGTGG - Exonic
927964735 2:27262099-27262121 GCGGCAGGCGCGGGGGCCGGCGG + Intronic
928085840 2:28345835-28345857 GAGGAGGGGGAGGCGGCAGGTGG - Intergenic
928379962 2:30809296-30809318 GTGGCAGGGGAGGCCCCAGTGGG - Intronic
928410178 2:31048593-31048615 GAGGCAGGGGAGGCAGGAGTGGG - Intronic
928443181 2:31310949-31310971 GCTCCAGTGGAGGTGGCAGGGGG + Intergenic
928582179 2:32719863-32719885 GGGGGATGGGAGGTGGCAGGTGG - Intronic
929539654 2:42810164-42810186 CAGGCCGGGGAAGCGGCAGGCGG - Intergenic
929564285 2:42975062-42975084 GCTGGAGGAGAGGAGGCAGGGGG + Intergenic
929588605 2:43131235-43131257 GGGGCTGGGGAGGAGGAAGGGGG + Intergenic
929699201 2:44147332-44147354 GTGTCAGGGGAGGCAGCTGGTGG + Intergenic
929857673 2:45650605-45650627 GCGGTGGGGGAGGGGGAAGGGGG - Intergenic
929897763 2:45976469-45976491 GCGGCCGAGGAAGCGGCAGGGGG + Exonic
930011423 2:46941036-46941058 GCGGCGGGGGCGGCGGCGGGGGG + Intronic
930771919 2:55137866-55137888 GCGGCAGGGGGGTCAGTAGGGGG - Intergenic
930808879 2:55520014-55520036 GCGACAGGGGTGGAGACAGGGGG - Intronic
930872593 2:56184048-56184070 GGCGCAGCGAAGGCGGCAGGAGG + Intergenic
930886383 2:56331930-56331952 GGGGGCGGGGAGGGGGCAGGGGG - Intronic
931136939 2:59413955-59413977 GCTCCAGTGGAGGTGGCAGGGGG + Intergenic
931242102 2:60462497-60462519 GGGGCAGGGAAGGCTGGAGGTGG - Intronic
931253675 2:60553297-60553319 GCGGCGGCGGCGGCGGCGGGCGG + Exonic
931355847 2:61537497-61537519 GCGGCCGGGCGGGCGGGAGGAGG - Intronic
931748774 2:65313298-65313320 GCTGCAGTGTGGGCGGCAGGGGG + Exonic
932487087 2:72090778-72090800 GAGGCAGAGGAAGGGGCAGGAGG - Intergenic
932496597 2:72148659-72148681 GCGGCGGCGGCGGCGGCAGCGGG + Intergenic
932544069 2:72688536-72688558 GGGGCAGGGGCAGGGGCAGGGGG + Intronic
932780230 2:74554694-74554716 GCGGGAGGCGGGGCGGGAGGCGG - Exonic
933684716 2:85133710-85133732 GCGGCGGCGGCGGCGGCAGCGGG + Exonic
934079117 2:88452459-88452481 GCGGCGGCGGTGGCGGCGGGCGG + Exonic
934177027 2:89585244-89585266 CCGGCAGGGGAGGCTGCAGACGG - Intergenic
934287335 2:91659603-91659625 CCGGCAGGGGAGGCTGCAGACGG - Intergenic
934476350 2:94596115-94596137 GCGGCATGGGCAGCGGCAGATGG + Intronic
934559732 2:95306950-95306972 GCTGCTGGGGAGGCGGGAGGAGG - Intronic
934638348 2:96010707-96010729 GCGGCGGCGGCGGCGGCAGCCGG - Intergenic
934795307 2:97094704-97094726 GCGGCGGCGGCGGCGGCAGCCGG + Exonic
935356181 2:102202097-102202119 GAGGCAGGGGAGGCCTCAGCTGG - Intronic
935443101 2:103124935-103124957 GTGGCAGTGGAGGTGGCAGATGG + Intergenic
936126705 2:109794592-109794614 GCGGCGGCGGCGGCGGCGGGGGG + Intronic
936278524 2:111119905-111119927 GCGGGAGGGGAGGAGGGACGGGG + Intronic
936396940 2:112138510-112138532 GGGGCAGGGGGGGAGGCGGGAGG - Exonic
936463811 2:112729676-112729698 GTTGCAGGAGAGGAGGCAGGAGG - Exonic
936514665 2:113174136-113174158 GTGGCAGGGGCTGGGGCAGGTGG + Intronic
936954972 2:118014101-118014123 GCGGCGGCGGCGGCGGCAGAGGG - Exonic
936972030 2:118185557-118185579 ACGGCGGGGGAGGGGGGAGGAGG + Intergenic
936973002 2:118192524-118192546 GCGGCAGTGGTGGTGGTAGGTGG + Intergenic
937044965 2:118846469-118846491 GCGGCAGTGGAGGCGGCGCGGGG - Exonic
937132523 2:119524196-119524218 GCTGCAGCGGCGGCGACAGGTGG + Exonic
937132618 2:119524505-119524527 CTGGCAGGGGAGGAGGCAGAGGG + Intergenic
937228898 2:120385359-120385381 GCGGTGGGGGAGGAGGCTGGAGG + Intergenic
937276055 2:120685063-120685085 GCTGGAGGAGAGGCTGCAGGGGG + Intergenic
937365348 2:121257265-121257287 GCTGTAGGGGAGGCAGGAGGGGG - Intronic
937431936 2:121846219-121846241 GCAGCAGGGCAGGCGGTTGGGGG - Intergenic
937907451 2:127059096-127059118 GCGGCAGGGGAGCCATCTGGAGG + Exonic
937926887 2:127174498-127174520 GCAGCATGAGAGGCGGCAGGTGG + Intergenic
938067944 2:128292068-128292090 CCGGCAGGGGAGGCGGCACAGGG + Intronic
938380059 2:130831585-130831607 GAGGCAGGGGAAGAGGCAGGAGG - Intergenic
938416122 2:131105208-131105230 ACGGGACGGAAGGCGGCAGGGGG - Exonic
938937580 2:136140584-136140606 GAGCCAAGGGAGGAGGCAGGGGG - Intergenic
939398863 2:141665961-141665983 GGGGCAGGGGTGGTGGCAGTGGG + Intronic
939865646 2:147469579-147469601 GCAGCAGGGGAGGAGGCAGTGGG - Intergenic
940106477 2:150106524-150106546 GCGGCAAGGGATGTAGCAGGGGG + Intergenic
940462780 2:153988324-153988346 GCGGCTGGGCAGGTGGCAGCAGG - Intronic
940901665 2:159131511-159131533 GGGGCAGGGGAAGGGGCGGGGGG - Intronic
941038186 2:160590502-160590524 GGGGGAGGGGAGGGGGGAGGGGG - Intergenic
941702158 2:168614975-168614997 GCTCCAGAGGAGGTGGCAGGGGG - Intronic
942268245 2:174248689-174248711 CCGGCCGGGGAGGCGGGAGTAGG + Exonic
942947155 2:181683727-181683749 GCGGGAAGGGGGGCGGGAGGAGG + Intergenic
943016049 2:182511898-182511920 GTGGTAGGGGAAGCGGCAGATGG - Intronic
943782321 2:191838037-191838059 GTTGCAGGAGAGGTGGCAGGGGG - Intronic
943890248 2:193277257-193277279 GAGGAAGGGGAGGGGGGAGGAGG - Intergenic
944221669 2:197310273-197310295 GGGGCTGGGGAGGGGGCCGGGGG - Intronic
944287792 2:197971529-197971551 GCGGCAGGGGAGGTGACACAGGG + Intronic
945699418 2:213151726-213151748 GCGGCGGCGGCGGCGGCGGGCGG + Intronic
946019795 2:216633351-216633373 GGGGGAGGGGAGAAGGCAGGGGG + Intronic
946031520 2:216708718-216708740 GCTGCCGGGGTGGTGGCAGGAGG - Intergenic
946333144 2:219021733-219021755 GGGCCAGGGGAGGTGGGAGGAGG - Intronic
946501849 2:220257360-220257382 GCGGAGGGGGAGGGGGGAGGAGG + Intergenic
946680012 2:222203633-222203655 GAGGCAGGTGAGGCGGGGGGCGG + Intronic
946692599 2:222320236-222320258 GGGGACGGGGAGGCGGGAGGGGG - Intergenic
947523862 2:230866739-230866761 GGGGCAGGGATGGGGGCAGGAGG + Intronic
947625205 2:231614483-231614505 GGGGCAGGGGAGGCTGGGGGCGG - Intergenic
948091869 2:235302001-235302023 GAGGAGGGGGAGGAGGCAGGAGG - Intergenic
948115858 2:235494068-235494090 CCGGCCGGGCAGGCGGCGGGCGG + Intronic
948239001 2:236413057-236413079 GTGGCAGGGGAGGCTTCATGAGG - Intronic
948248671 2:236507600-236507622 GGGGGGGGGGAGGGGGCAGGCGG - Intergenic
948513222 2:238487253-238487275 GGGGCTGAGGAGGCTGCAGGGGG - Intergenic
948581054 2:238987330-238987352 GCGGGAGGGGAGGATGCAAGGGG - Intergenic
948598875 2:239096936-239096958 GGAGCAGGGCAGGAGGCAGGAGG + Intronic
948718485 2:239881401-239881423 GGGGCAGGGCAGTGGGCAGGAGG - Intergenic
948805931 2:240453449-240453471 GCGGCAGGCGATGCGGGAGCGGG - Intronic
948993099 2:241564533-241564555 GGGGCTGGGGAGTGGGCAGGTGG + Intronic
949051929 2:241902312-241902334 GGCGGAGGGGAGGCGGCAGGCGG - Intronic
1168788118 20:557193-557215 GGGGCAGGGGAGGCAGTGGGTGG + Intergenic
1168842243 20:916913-916935 GAGGGAGGGGAGGAGGCAGAGGG + Intergenic
1168878217 20:1185429-1185451 GCCGCTGGGGAGGCGGGGGGGGG + Intronic
1168878819 20:1188990-1189012 GGGGCGGGGGCGGGGGCAGGTGG + Intronic
1168883250 20:1225634-1225656 GCGGCGGCGGCGGCGGCTGGGGG - Intergenic
1168901173 20:1366242-1366264 GAGGCAGGGGTGGGGGCAGTGGG - Intronic
1169074543 20:2752692-2752714 GCGGCAGGGGAGGTCCCAGGCGG - Intronic
1169178620 20:3542552-3542574 GGGGAAGGGGAGGTGGAAGGGGG - Intronic
1170039163 20:12022321-12022343 GAGGCAGGGGAGGAGGGTGGGGG - Intergenic
1170041649 20:12045372-12045394 AGGGGAGGGGAGGGGGCAGGAGG - Intergenic
1170041689 20:12045457-12045479 AGGGGAGGGGAGGGGGCAGGAGG - Intergenic
1170445771 20:16425972-16425994 GAGACAGGAGAGGGGGCAGGAGG + Intronic
1170756882 20:19212762-19212784 GCGGCGGGGACAGCGGCAGGAGG - Exonic
1170764148 20:19275646-19275668 GCGGTAGGGGAGGAGGAGGGAGG + Intronic
1170914925 20:20613605-20613627 GTGAGAGGGGAGGAGGCAGGGGG - Intronic
1171249636 20:23638087-23638109 GAGGCAGGGGAGGCGGGGAGAGG - Intronic
1171394468 20:24822891-24822913 GTGGCAGGGGAGGCGGGACTGGG + Intergenic
1171869565 20:30514238-30514260 GCTGCAGGGGAGGGGGGAGGAGG + Intergenic
1171974826 20:31587840-31587862 GGGGCCGGTGAGGCGGCAGATGG - Intergenic
1172444135 20:34984448-34984470 GGGGCAGAGGAGGCTGCAGGTGG + Intronic
1172479748 20:35264019-35264041 GGGGCAGGGGACGAGGGAGGGGG + Intronic
1172841054 20:37903044-37903066 GAGGGAGGGGAGGAGGGAGGCGG + Intergenic
1173002046 20:39111643-39111665 GAGGAAGGGGAGGAGGAAGGGGG + Intergenic
1173029625 20:39342725-39342747 GGGGCAGGGGAGAGAGCAGGGGG + Intergenic
1173210605 20:41029022-41029044 GCGGCAGGCGAGGCGGCGTGGGG - Exonic
1173210750 20:41029494-41029516 GGCGCGGGGGAGGCGGCCGGCGG - Intronic
1173503719 20:43571286-43571308 GGGGCAGGGGTGGAGCCAGGTGG + Intronic
1173648762 20:44650182-44650204 GAGGCAGGGGTGGGGGTAGGAGG + Intronic
1173649103 20:44651741-44651763 GCGGCGGGCGGGGCGGGAGGCGG - Exonic
1173659696 20:44724804-44724826 GCGGCAGCGGATGCTGCAGTGGG - Exonic
1173672878 20:44810303-44810325 GCGGCGGCGGCGGCGGCGGGCGG + Intronic
1173865079 20:46308143-46308165 GCGGCCGGGCAGGCGGCGCGGGG - Intronic
1174000113 20:47368481-47368503 GAGGCAGTGGTGGCAGCAGGAGG - Intergenic
1174053932 20:47785510-47785532 GGGGGCGGGGAGGAGGCAGGAGG - Intronic
1174488140 20:50874066-50874088 GCGACAGTGGAGACAGCAGGAGG - Intronic
1174736669 20:52972104-52972126 GCGGAAGGGGCGGGGGCGGGAGG - Intergenic
1175224834 20:57439130-57439152 GGGGCAGGGCAGGAGGCTGGGGG - Intergenic
1175516997 20:59576451-59576473 GCTGCCAGGGAGGAGGCAGGTGG + Intergenic
1175605905 20:60312007-60312029 CAGGAAGGGGAGGCAGCAGGAGG + Intergenic
1175831006 20:61965636-61965658 GAGGCTGGGGAGGCGGGACGCGG - Intronic
1175945926 20:62558749-62558771 GCGGCAGGAGAGGGGGTAGAAGG + Intronic
1176100254 20:63361400-63361422 GGAGCAGGGGAGGGGGGAGGAGG + Intronic
1176115506 20:63430255-63430277 GAGGCTGGGGAGGAGGCAGCCGG + Intronic
1176120372 20:63451850-63451872 GCTGCTGGGGAGTCGGAAGGTGG - Intronic
1176168967 20:63688638-63688660 GAGGCAGGGGAGGCACGAGGGGG - Intronic
1176185322 20:63775301-63775323 GCGACAGAGGGGCCGGCAGGGGG + Intronic
1176207105 20:63895189-63895211 GCGGCGGCGGCGGCGGCAGAGGG - Exonic
1176235863 20:64053207-64053229 AGGGCAGGTGGGGCGGCAGGAGG + Intronic
1176241158 20:64076557-64076579 GCAGCAGGGGTTGCGGCTGGGGG + Exonic
1176368587 21:6049023-6049045 GCGGGAGGGCAGGTGGCAGGTGG - Intergenic
1176380746 21:6111156-6111178 GCAGCAGCGGCGGCGGCAGCCGG + Exonic
1176418972 21:6499176-6499198 ACGGCAGCGGCGGCGGCGGGTGG - Intergenic
1176569094 21:8400399-8400421 GCGGCGGCGGCGGCGGCAGGCGG + Intergenic
1178404057 21:32310342-32310364 GGGGGAGGGGAGGAGGGAGGTGG + Intronic
1178453582 21:32727489-32727511 CCGGCTGGGGGGACGGCAGGCGG + Intronic
1178487403 21:33027680-33027702 GGGGCGGGGGCGGCGGCAGTGGG + Exonic
1178551521 21:33543317-33543339 GCGGCTGGGGGGGCGGTTGGGGG - Intronic
1178583816 21:33856872-33856894 GGGGCAGGGGGCACGGCAGGGGG + Intronic
1178797180 21:35755689-35755711 GCGGCAGGCAAGGAGGCAGCAGG + Intronic
1178884508 21:36474858-36474880 ACGGGAGGGGAGGCGGGAGCAGG + Intronic
1179213732 21:39349115-39349137 GCGGCCGGGGACGCGGGGGGAGG - Exonic
1179375464 21:40846776-40846798 GCGGCGGCGGCGGCGGCGGGCGG - Exonic
1179411754 21:41168075-41168097 GCGGGAGGGGAGGAGGCTCGCGG - Exonic
1179457315 21:41508258-41508280 GGGGCGGGGGCGGCGGGAGGAGG + Intronic
1179626817 21:42653718-42653740 GGAGCAGGGGAGGGGGCGGGCGG - Intronic
1179674906 21:42974748-42974770 GCGGCAGCGGCGGCGGCGGGCGG - Intronic
1179694465 21:43107498-43107520 ACGGCAGCGGCGGCGGCGGGTGG - Exonic
1179726469 21:43343988-43344010 GCAGCGGGGGAGGCAGCCGGAGG - Intergenic
1179742726 21:43427084-43427106 GCAGCAGCGGCGGCGGCAGCCGG - Exonic
1179754932 21:43489519-43489541 GCGGGAGGGCAGGTGGCAGGTGG + Intergenic
1179878047 21:44281454-44281476 GTAGGAGGGGAGGGGGCAGGGGG + Intergenic
1179891637 21:44338687-44338709 GAGGGAGGGGAGGAGGCCGGGGG - Intronic
1179909139 21:44438743-44438765 GCGCCAGGGGAGCGGGAAGGGGG + Intronic
1179947215 21:44686504-44686526 GCGGCAGGCCAGCTGGCAGGAGG - Intronic
1180034068 21:45234261-45234283 GCGGCGGCAGAAGCGGCAGGCGG + Intergenic
1180035874 21:45248939-45248961 ACAGCAGGAGAGGGGGCAGGAGG + Intergenic
1180095928 21:45555302-45555324 GCGGCGGGGGCGGCGGGGGGCGG + Intergenic
1180109698 21:45642382-45642404 GCGGCAGGGCAGGAGGTGGGGGG - Intergenic
1180618026 22:17141261-17141283 GCTGCAGGGCAGATGGCAGGCGG + Intronic
1180782434 22:18528725-18528747 GAGGCAGGGCGGGCGGAAGGGGG + Intronic
1180938582 22:19641962-19641984 GAGGTGGGGGAGGGGGCAGGGGG + Intergenic
1180972567 22:19823009-19823031 GCGGCATGGGGGAGGGCAGGAGG + Intronic
1181029419 22:20142704-20142726 GCTGCAGGCGGGGTGGCAGGTGG + Intronic
1181125988 22:20702752-20702774 GGGGCAGGGCGGGCGGAAGGGGG + Intergenic
1181171640 22:21013231-21013253 AGGGCAGGGGAGGAGGCAGGTGG - Intronic
1181236866 22:21452595-21452617 GCTACATGGGAGGCGGCAGTAGG - Intergenic
1181239325 22:21468060-21468082 GGGGCAGGGCGGGCGGAAGGGGG + Intergenic
1181278614 22:21703033-21703055 GAGGCCGAGGAGGCTGCAGGGGG - Intronic
1181387730 22:22557927-22557949 GGGGAAGGGGGGGCGGGAGGAGG + Intronic
1181402728 22:22661110-22661132 GCCGCAGGGCAGGGGGCTGGTGG + Intergenic
1181485755 22:23230817-23230839 GCGGCTGGGGAGCAGGCTGGTGG - Intronic
1181514406 22:23402780-23402802 GCTGCAGGCCAGGCAGCAGGAGG + Intergenic
1182023664 22:27101026-27101048 GCTGCAGGGGCGGGGGGAGGAGG + Intergenic
1182237016 22:28883853-28883875 GCGGCGGCGGCGGCGGCAGGCGG - Exonic
1182458530 22:30468453-30468475 GGGGCAGGTGAGGCTGCCGGGGG - Intronic
1182552438 22:31107478-31107500 GCGCCAGCGGAGGCAACAGGAGG + Exonic
1183187721 22:36301632-36301654 GCTGCAGGTGAGCCGGCAGGAGG - Exonic
1183247228 22:36703278-36703300 GCGGCGGCGGCGGCGGCAGCAGG + Exonic
1183306670 22:37086468-37086490 GTGGCAGGGAGGGCGGCAGGCGG + Intronic
1183368593 22:37419915-37419937 CCGGCAGGGGCGGGGGCTGGCGG - Intronic
1183466701 22:37983789-37983811 GCGGCGGCGGCGGCGGCCGGGGG - Exonic
1183481033 22:38065684-38065706 GCGGCAGGGGTGGGGGAAAGCGG - Intronic
1183577419 22:38700835-38700857 GCGGCCGGGGGCGCGGCGGGAGG - Intronic
1183737811 22:39653576-39653598 CCTGCAGGGGAGGCAGCATGGGG + Intronic
1183864411 22:40692851-40692873 GTGGCAGTGGAGGCGGCGAGAGG + Intergenic
1184046735 22:41976789-41976811 GTGGCAGCGGCGGCGGCTGGCGG + Exonic
1184236909 22:43187430-43187452 GGGGCAGGGGAGGGGTCGGGGGG - Intergenic
1184245597 22:43234451-43234473 GGGGCAGGGGATGGGGCTGGGGG - Intronic
1184251604 22:43263517-43263539 GCGGCAGTGAAGGCTGCAGACGG + Intronic
1184561214 22:45263934-45263956 GAGGCAGGGGTGGCCGCAGGAGG - Intergenic
1184671367 22:46013758-46013780 GCGCCTGGGAAGGCGGCCGGGGG - Intergenic
1184673491 22:46027845-46027867 GCGGCAGGGGAAGCTGGGGGAGG - Intergenic
1184723241 22:46328256-46328278 GCAGCAGGGGAGGGGGCATCTGG + Intronic
1184785345 22:46668867-46668889 GCGGTAGGGGAAGAAGCAGGAGG - Exonic
1184855659 22:47145137-47145159 GGGGCAGGTGAGGTGCCAGGAGG + Intronic
1184988991 22:48154771-48154793 GGGGCTGGGGAGGGGGCTGGAGG + Intergenic
1184993588 22:48186464-48186486 GCGGAAGGTGAGGGGGCAGTTGG + Intergenic
1185133248 22:49052441-49052463 ACGGGAGGGAGGGCGGCAGGCGG + Intergenic
1185173419 22:49306177-49306199 GAGGCAGCAGGGGCGGCAGGAGG + Intergenic
1185173429 22:49306217-49306239 GAGGCAGCAGGGGCGGCAGGAGG + Intergenic
1185214465 22:49590529-49590551 GAGGCTGGGGAGGCTGCAGGTGG + Intronic
1185292228 22:50032868-50032890 GGCGCAGGGGAGGCGGCCTGTGG - Intronic
1185330268 22:50249203-50249225 GGGGCAGGGGAGGGGCCCGGGGG + Intronic
1185397544 22:50600645-50600667 GCGGCGGGGGAGGCGGGGGAGGG - Intronic
1203255061 22_KI270733v1_random:133699-133721 GCGGCGGCGGCGGCGGCGGGCGG + Intergenic
1203263117 22_KI270733v1_random:178778-178800 GCGGCGGCGGCGGCGGCGGGCGG + Intergenic
949823320 3:8138677-8138699 GGGGAAGGGGAGGGGACAGGAGG + Intergenic
949929509 3:9067640-9067662 CTGTCAGGGGAGGCGGCGGGAGG + Intronic
950530280 3:13549061-13549083 GAGTCAGGGGAGGGGGCCGGGGG + Intergenic
950764184 3:15261105-15261127 TCTGCAGGGGAGGCAGGAGGTGG - Intronic
950829407 3:15859577-15859599 GCGGCGGCGGCGGCGGCGGGCGG - Exonic
950940326 3:16884923-16884945 GCGGCCGAGGCGGCGGCGGGAGG + Intronic
951080366 3:18444932-18444954 GCGGCGGCGGGGGCGGGAGGGGG + Intronic
951908018 3:27722426-27722448 GCGGCCCGCGAGTCGGCAGGTGG - Intronic
951923908 3:27886498-27886520 ATGGCAGGGGTGGGGGCAGGAGG - Intergenic
952252984 3:31672357-31672379 GGGGCGGGGGGGGGGGCAGGAGG + Intronic
952611717 3:35217154-35217176 GAGGCAGGAGTGGAGGCAGGCGG + Intergenic
952865587 3:37853148-37853170 GTGGCAGGGGAGGGGGAAGTGGG + Intergenic
953124438 3:40077867-40077889 GCTGCAGGTGGGGCTGCAGGTGG + Intronic
953345230 3:42170076-42170098 GTGGCAGGGGACGAGGCGGGAGG + Intronic
953404624 3:42654335-42654357 GCGGCAGGGCGGGCTGCACGGGG + Intronic
953406988 3:42664526-42664548 GCGGAGGCGGGGGCGGCAGGTGG - Exonic
953447680 3:42981354-42981376 GCAGCATGGGAGGAGACAGGGGG + Intronic
953545084 3:43858369-43858391 GGGGCTGCGGAGGCAGCAGGGGG - Intergenic
953614439 3:44477619-44477641 GCGGCTGCGGTGGCGGCGGGTGG - Intronic
953910913 3:46892678-46892700 GAGGCAGGGGAGGAAGAAGGCGG - Intronic
953912189 3:46898831-46898853 CCGGCAGCGGCGGTGGCAGGCGG - Exonic
954331978 3:49895987-49896009 GCTGCAGGGATGGGGGCAGGGGG + Exonic
954364659 3:50139532-50139554 GCGGTAGGGGTGCCGTCAGGGGG - Intergenic
954411561 3:50373477-50373499 GAGGCAGGGGAGGAAGGAGGGGG + Intronic
954411708 3:50373986-50374008 GGGGGAGGGGAGGGGGGAGGAGG + Intronic
954439513 3:50514092-50514114 GGGGCAGGGGAGGCAGGAAGGGG - Intergenic
954673382 3:52302667-52302689 GCTGCAGGGGAGGATGCAGAAGG - Intergenic
954699782 3:52445203-52445225 GTGGAAGGAGAAGCGGCAGGTGG - Intergenic
954739508 3:52737046-52737068 GCGGCAGGGGAGGCTGAGGCAGG - Intronic
954757515 3:52849563-52849585 ATGGCAGGGAAGGTGGCAGGAGG - Intronic
955081780 3:55664511-55664533 GCTGCAGAGGAGACGCCAGGCGG + Intronic
955387607 3:58492054-58492076 GCGGCGGCGGCGGCGGCAGAGGG - Intergenic
955395888 3:58556905-58556927 CCGGCAGGGAAGGAGGAAGGGGG + Intergenic
955515922 3:59726289-59726311 GAGGCTGTGGAGGCTGCAGGTGG - Intergenic
955972996 3:64454415-64454437 GAGGCAGGGGAGGGGGCGAGAGG + Intergenic
956642821 3:71430815-71430837 GGGGGAGGGGAGGCGGCGGGGGG + Intronic
958925728 3:100155187-100155209 TTGGCAGGGGAGGCAGCAGTTGG - Intronic
959056655 3:101574189-101574211 GCTGCAGGGGAGGCCGCGGCGGG + Exonic
959085817 3:101849746-101849768 GCGCCCGGGGCGGCGGCGGGCGG - Exonic
959539399 3:107523231-107523253 GCGGCGGCGGCGGCGGCAGCCGG + Intronic
959920983 3:111868106-111868128 GAGGCAGAGGTGGAGGCAGGGGG - Intronic
960047418 3:113211624-113211646 GCCGCGGGGGCGGCAGCAGGAGG - Exonic
960047419 3:113211627-113211649 GCGGCCGCGGGGGCGGCAGCAGG - Exonic
960057732 3:113287149-113287171 GTGGCAGGCGAGGCTGCAGGAGG + Exonic
960512907 3:118571970-118571992 GCGGCAGGGTCGGGGGCGGGGGG - Intergenic
961369153 3:126419042-126419064 GCGGCGGGGGAGGAGGGATGGGG - Intronic
961427306 3:126858291-126858313 GTGGCAGGGGCGGGGGCGGGGGG + Intronic
961536265 3:127572880-127572902 GGGGCAGGGGCAGCGGCAGCTGG + Intergenic
961655386 3:128438887-128438909 CCAGCAGGGGCAGCGGCAGGTGG + Intergenic
961816993 3:129556178-129556200 ACGGCTGGGGCGGGGGCAGGAGG - Exonic
962259868 3:133895536-133895558 GGGCGAGGGGAGGCGGCCGGCGG + Exonic
962259951 3:133895849-133895871 GCGCCGGCGGAGGAGGCAGGCGG - Intergenic
962272979 3:133991722-133991744 CTGGGAGGGGAGGCTGCAGGGGG + Intronic
962793994 3:138835017-138835039 GCGGCGGCGGCGGCGGCAGTTGG + Intergenic
963055008 3:141179136-141179158 TGAGCAGGGGAGGGGGCAGGAGG + Intergenic
963742986 3:149097975-149097997 GGGGGAGGGGAGGGGGTAGGGGG + Intergenic
963870191 3:150408300-150408322 TCGGCAGCGGCGGCGGCAGCGGG + Intergenic
964669467 3:159209349-159209371 GCAGAAGGGGAGCCGGAAGGGGG - Intronic
964716361 3:159726717-159726739 GAGACAGGAGAGGCTGCAGGGGG - Intronic
964817750 3:160735120-160735142 GAGGCAGGGCAGGCTCCAGGTGG + Intergenic
965757215 3:172039625-172039647 GCGGCGGCGGCGGCGGCTGGAGG + Intronic
966226906 3:177607609-177607631 GAGGGAGAGGAGGTGGCAGGGGG + Intergenic
966669353 3:182509364-182509386 GCAGCAGGGAAGGGGGCAAGTGG + Intergenic
966762199 3:183428379-183428401 GGTGCAGGGGAGGCGGCAGGTGG + Intronic
966849405 3:184155449-184155471 GCGGCCGCGGCGGCGGCGGGCGG + Exonic
966919390 3:184602066-184602088 GCGGGAGGGGAGGCTGGGGGCGG + Intronic
967316237 3:188154182-188154204 GCGGCGGCGGCGGCGGCTGGAGG - Intronic
967859684 3:194141546-194141568 GCGGCGGCGGCGGCGGCGGGAGG + Intergenic
967945047 3:194797615-194797637 GCAGCAGTGGAGGCTGCAGGTGG + Intergenic
968434074 4:576103-576125 GCGGCGGGGGCGGCGGCGGGCGG - Intergenic
968434118 4:576226-576248 GCGGCGGCGGCGGCGGGAGGCGG - Intergenic
968434119 4:576229-576251 GCGGCGGCGGCGGCGGCGGGAGG - Intergenic
968454213 4:688967-688989 GGGGCAGGGGCGGGGACAGGTGG - Intronic
968503527 4:961734-961756 GCTGCAGGTGGAGCGGCAGGAGG - Exonic
968514377 4:1010151-1010173 CCGGCCGGGAGGGCGGCAGGTGG + Exonic
968516593 4:1018119-1018141 GGGGAAGGGCAGGCCGCAGGGGG + Intronic
968600307 4:1505579-1505601 GTGACAGGGCAGGGGGCAGGTGG - Intergenic
968659650 4:1793725-1793747 GCGGCGGGCGGGGCGGCTGGGGG + Intronic
968673008 4:1862509-1862531 GGGGCTGCGGGGGCGGCAGGAGG + Intergenic
968741728 4:2334741-2334763 GGGGAAGGGGAGGGGGAAGGGGG - Intronic
968748269 4:2372365-2372387 GCGGGAGCGGTGGTGGCAGGAGG - Intronic
968870970 4:3242059-3242081 CCTGCGGGGGAGGCGGGAGGCGG - Exonic
968889227 4:3359044-3359066 GGGGGAGGGGAGGAGGGAGGAGG - Intronic
969131365 4:4993324-4993346 GCTGAAGAGGAGGTGGCAGGTGG - Intergenic
969154137 4:5195325-5195347 GAGGAAGGGGAGGAGGCAGCAGG - Intronic
969305233 4:6322500-6322522 GCGGCAGGGAGGGCTGCAGAGGG + Exonic
969413347 4:7043448-7043470 GCGGCAGCCGCGGCGGCGGGCGG + Exonic
969436592 4:7192613-7192635 GCGGCAGCGGAGCCGGCGGCGGG - Exonic
969467559 4:7366615-7366637 GCTGCATGGGAGGCTGGAGGAGG - Intronic
969619088 4:8269945-8269967 GCGGCAGGGCCGGCGGCGGGTGG - Exonic
969647470 4:8440900-8440922 GTGGCTGGAGAGGCCGCAGGTGG + Exonic
969715833 4:8867739-8867761 GCGGCCGGGAAGGCGGCCAGCGG + Exonic
971041942 4:22763563-22763585 GCGGCAGGGGTGGGGGGACGGGG + Intergenic
971279799 4:25233914-25233936 GCGGCGGCGGCGGCGGCAGCGGG - Intronic
971351932 4:25862971-25862993 GCGGCAGTGGCGGCGGCGGCGGG - Intronic
971635138 4:29047797-29047819 ACGGCGGGGGCGGCGGCTGGGGG - Intergenic
971756983 4:30719111-30719133 GGGGCAGGGGCGGCGGTGGGTGG - Intergenic
972318517 4:37950558-37950580 GCGGGAGGGGAGGGGGCAGGTGG - Intronic
972543383 4:40057599-40057621 GGGGCAGGGGAGGCGGGACGAGG - Intronic
972725825 4:41745967-41745989 GCGGCAGCGGCGGCAGCTGGAGG - Exonic
972765810 4:42151767-42151789 GCGGCGGGGGACGCGGGCGGCGG + Exonic
973230829 4:47837479-47837501 GCGGCAGGGGAGGCTGCAGGTGG - Intronic
973981880 4:56314525-56314547 GGAGGAGCGGAGGCGGCAGGAGG + Exonic
974260514 4:59518903-59518925 GCTGCAGGAGGGGCTGCAGGAGG - Intergenic
974260536 4:59518967-59518989 GCTGCAGGAGGGGCTGCAGGAGG - Intergenic
974260558 4:59519031-59519053 GCTGCAGGAGGGGCTGCAGGAGG - Intergenic
974260580 4:59519095-59519117 GCTGCAGGAGGGGCTGCAGGAGG - Intergenic
974260584 4:59519107-59519129 GCTGCAGGAGGGGCTGCAGGAGG - Intergenic
974260588 4:59519119-59519141 GCTGCAGGAGGGGCTGCAGGAGG - Intergenic
974260601 4:59519157-59519179 GCTGCAGGAGGGGCTGCAGGAGG - Intergenic
974260614 4:59519195-59519217 GCTGCAGGAGGGGCTGCAGGAGG - Intergenic
974260627 4:59519233-59519255 GCTGCAGGAGGGGCTGCAGGAGG - Intergenic
974260631 4:59519245-59519267 GCTGCAGGAGGGGCTGCAGGAGG - Intergenic
974260635 4:59519257-59519279 GCTGCAGGAGGGGCTGCAGGAGG - Intergenic
974260648 4:59519295-59519317 GCTGCAGGAGGGGCTGCAGGAGG - Intergenic
974260661 4:59519333-59519355 GCTGCAGGAGGGGCTGCAGGAGG - Intergenic
974260674 4:59519371-59519393 GCTGCAGGAGGGGCTGCAGGAGG - Intergenic
974260678 4:59519383-59519405 GCTGCAGGAGGGGCTGCAGGAGG - Intergenic
974260682 4:59519395-59519417 GCTGCAGGAGGGGCTGCAGGAGG - Intergenic
974260695 4:59519433-59519455 GCTGCAGGAGGGGCTGCAGGAGG - Intergenic
974260699 4:59519445-59519467 GCTGCAGGAGGGGCTGCAGGAGG - Intergenic
974260703 4:59519457-59519479 GCTGCAGGAGGGGCTGCAGGAGG - Intergenic
974260707 4:59519469-59519491 GCTGCAGGAGGGGCTGCAGGAGG - Intergenic
974854664 4:67446072-67446094 GCGGTAGCGGCGGCGGCAGCGGG - Intergenic
975689452 4:76949728-76949750 GCGGGAGGGGCGGCGGCGTGGGG + Exonic
975778839 4:77819163-77819185 GCGGGCGGGGAGGCGGCCCGAGG - Intronic
976177973 4:82373617-82373639 GCGGCAACGGCGGCGGTAGGCGG - Exonic
976475257 4:85475623-85475645 GCGCCAGGGGAGGGGGCTGCGGG + Intronic
976830380 4:89308030-89308052 GCAGCAGCGGCGGCAGCAGGAGG + Intergenic
977257684 4:94758382-94758404 GGGGCAGCGGCGGCGGCGGGCGG + Intronic
977694207 4:99949213-99949235 GGGGGCGGGGAGGCGGCAAGAGG - Intronic
978072530 4:104491302-104491324 GCGGCGGCGGCGGCGGCAGCAGG - Exonic
978072586 4:104491455-104491477 GGGGCGGGGGCGGCGGCGGGGGG - Exonic
979515901 4:121609657-121609679 GGGGCAGGGGCAGGGGCAGGTGG + Intergenic
979832041 4:125315657-125315679 GCGGCGGCGGCGGCTGCAGGAGG + Intergenic
981034400 4:140154213-140154235 ACGGCAGCGGCGGCGGCTGGAGG + Intergenic
981067236 4:140498093-140498115 GCGGGAAAGGAGGCGGGAGGAGG + Intronic
981086645 4:140690281-140690303 GCAGCAGAGGAGGCAACAGGTGG - Intronic
981504107 4:145481722-145481744 GCGGCAGCGGCGGCGGCGCGCGG + Intronic
981516883 4:145619364-145619386 GCGGAAGGGGCGGGGTCAGGTGG + Exonic
981550600 4:145937740-145937762 GCGGCAGCGGCGGCGGCGGCTGG - Intronic
982422109 4:155209677-155209699 GGGGCAGGGGAGGGGGAAGAAGG - Intronic
982793434 4:159618242-159618264 GTGGCAGGGGTGGGGGTAGGGGG + Intergenic
984908300 4:184649517-184649539 GCCGCAGCGGAGGCGGCGCGAGG - Intergenic
984949448 4:184995986-184996008 GGGGCAGGGCAGGAGGCAGTGGG + Intergenic
985087323 4:186326213-186326235 TCGGGAGGGGTGGGGGCAGGTGG - Intergenic
985472249 5:53534-53556 GCGGCATCGGCGGCGGGAGGAGG + Intergenic
985510477 5:310532-310554 AGGGAAGGGAAGGCGGCAGGCGG + Intronic
985559328 5:574569-574591 GGGGCTGGGGAGGTGGGAGGAGG - Intergenic
985648458 5:1096261-1096283 GGGGCAGGGCAGGAGGCAGGAGG + Intronic
985701858 5:1378282-1378304 CTGGGAGGGGAGGCGGCAGTAGG - Intergenic
985898071 5:2762235-2762257 GATGGAGGGGAGGCAGCAGGAGG + Intergenic
986330580 5:6713839-6713861 GCGGCGGCGGCGGCGGCGGGCGG - Intergenic
986795104 5:11202635-11202657 GGGAGAGGGGAGGCTGCAGGGGG - Intronic
986813641 5:11385090-11385112 GCGGCGGCGGCGGCGGCGGGCGG + Exonic
987082222 5:14436059-14436081 GGGGCAGGGGAGGATGGAGGAGG - Intronic
987087977 5:14487506-14487528 GCGGCGGCGGCGGCGGCAGCGGG + Exonic
987132380 5:14871723-14871745 GCGGCGGCGGCGGCGGCAGAAGG + Exonic
987185101 5:15409219-15409241 GAGGCAGGAGAATCGGCAGGAGG + Intergenic
987557171 5:19468028-19468050 GAGGCAGGGGAAACTGCAGGAGG - Intergenic
988718540 5:33853009-33853031 ACGGCAGGGGTAGGGGCAGGAGG - Intronic
990499904 5:56385743-56385765 GAGGAAGAGGAGGGGGCAGGAGG - Intergenic
990825435 5:59893364-59893386 GCGGCGGGGGCGGCGGCAGGGGG + Exonic
990900649 5:60744973-60744995 GAGGCAGGAGTGGAGGCAGGTGG + Intergenic
990937114 5:61162642-61162664 GCGGCAGGTGAGGCCGCGCGGGG + Intergenic
991967478 5:72107383-72107405 GCGGAGGGGGAGGCGGCGCGCGG + Exonic
992077177 5:73202244-73202266 GAGGGAGGGAGGGCGGCAGGAGG + Intergenic
992485315 5:77189152-77189174 GCAGCAGGGGAGGACACAGGCGG + Intergenic
992590915 5:78294852-78294874 GCGGAAGGGGAGGCAGCGGGTGG + Intergenic
992910723 5:81393922-81393944 GCGGGAGCGGCGGCGGCTGGGGG - Intronic
992950367 5:81852011-81852033 GCGGCAGCCGCGGCGGGAGGCGG - Intergenic
992950438 5:81852366-81852388 GGGGCAGCGGAGGCGGCAGGCGG + Intergenic
995048216 5:107672710-107672732 GGGGCGGGGGAGGGGGTAGGAGG - Intergenic
996433092 5:123402347-123402369 GAGGCAGGAGTGGAGGCAGGCGG + Intronic
997013340 5:129904390-129904412 GCGGCGGGGGGAGCGGGAGGCGG + Intergenic
997284304 5:132667531-132667553 GAGGCAGGGGAGAGGGCAGGCGG - Intergenic
997373021 5:133374127-133374149 AAGCCAGGGGAGGGGGCAGGAGG - Intronic
997485166 5:134225482-134225504 GCGCCAGACGAGGTGGCAGGGGG - Intronic
997975418 5:138439120-138439142 GCGGCGGCGGCGGCGGCAGCAGG - Exonic
997980968 5:138467155-138467177 GCGGCAGGGTAGGCAGGAGGCGG - Exonic
997990833 5:138543256-138543278 GCGGAGTGGAAGGCGGCAGGCGG + Exonic
998018806 5:138753287-138753309 GCGGGCGGGGCGGCGGCGGGAGG + Intronic
998163126 5:139824822-139824844 GTGGGAGGGGAGGAGGCAAGGGG - Intronic
998200434 5:140114131-140114153 GCGGCGGGCGGAGCGGCAGGCGG + Exonic
998887336 5:146707603-146707625 GAGGCAGGAGTGGAGGCAGGCGG + Intronic
999206070 5:149848843-149848865 GGGGCAGGGGAGCCAGGAGGAGG + Exonic
999727232 5:154446644-154446666 GCGGCAGCTGGGGCGGCGGGGGG - Exonic
999926984 5:156389561-156389583 GAGGCAGGGGAGGCTGGGGGTGG + Intronic
1001296722 5:170503982-170504004 GCGGCGGAGGGGGCGGCGGGCGG - Intronic
1001620013 5:173075830-173075852 GAGGCAGGGAAGTAGGCAGGAGG - Intronic
1002190154 5:177473656-177473678 GGGGGAGGGGAGCCGGCCGGCGG + Intronic
1002541200 5:179907633-179907655 GCGGCGGGGCTGGCGGCGGGCGG - Intronic
1002580865 5:180208923-180208945 GCGGCGGGGTCGGCGGGAGGCGG - Intronic
1002580928 5:180209107-180209129 GCGGCGGCGGCGGCGGCGGGCGG - Intronic
1002622044 5:180494728-180494750 GCGGCAGCGGCGGAGGAAGGCGG + Exonic
1002637743 5:180616493-180616515 GGGTGCGGGGAGGCGGCAGGGGG + Intronic
1002888745 6:1316947-1316969 GCTGGAGGGGGGGCGGGAGGGGG - Intergenic
1002888794 6:1317034-1317056 GCTGGGGGGGAGGCGGGAGGAGG - Intergenic
1002897858 6:1389747-1389769 GCGGCGGCGGCGGCGGCGGGCGG - Intergenic
1002897954 6:1390038-1390060 GCGGCGGCGGCGGCGGCGGGCGG - Exonic
1002917723 6:1542205-1542227 GAGGCAGGGAAGGAGGGAGGAGG + Intergenic
1003101639 6:3180407-3180429 CCAGCAGGGGAGGCAGCAGCGGG - Intergenic
1003272913 6:4623226-4623248 CAGGAAGGGGAAGCGGCAGGGGG + Intergenic
1003310519 6:4965950-4965972 GCTGCAGGGGTGGCAGAAGGTGG - Intergenic
1003487041 6:6588784-6588806 GCTGCAGTGGAGGCGGCGGTGGG + Exonic
1004640792 6:17513642-17513664 TCCTGAGGGGAGGCGGCAGGTGG - Intronic
1004690345 6:17987690-17987712 GCGGCGGCGGCGGCGGCGGGCGG + Intergenic
1005012529 6:21349400-21349422 GGGCCAGGGGAGGGGGAAGGAGG + Intergenic
1006076407 6:31535307-31535329 GAGGAAGGGGAGGAGGCAGCGGG + Intronic
1006228064 6:32557699-32557721 GTGGGAGGGGAGGCAGGAGGGGG - Intronic
1006230655 6:32583848-32583870 GTGGGAGGGGAGGCAGGAGGGGG - Intronic
1006302348 6:33200310-33200332 GCGGCGGCGGCGGTGGCAGGCGG - Exonic
1006404702 6:33838168-33838190 CAGACAGGGAAGGCGGCAGGAGG + Intergenic
1006472511 6:34236747-34236769 GCGGCAGCGGCGGCGGCGGCTGG + Intergenic
1006626432 6:35401286-35401308 CTGGCAAGGGAGTCGGCAGGAGG - Intronic
1006638651 6:35477323-35477345 GCGGCAGGGGCGGCTGGATGGGG + Exonic
1006639981 6:35484865-35484887 GCTGCAGGGTAGGAGGAAGGAGG + Intronic
1006645395 6:35511780-35511802 GCGGACGGGGAGGCCGCGGGAGG - Exonic
1006725796 6:36197896-36197918 GCAGCCGAGGAGGTGGCAGGTGG + Intronic
1006748997 6:36364910-36364932 CCGGCAGGGGGGCAGGCAGGTGG - Intronic
1006860584 6:37169767-37169789 GCGTGAGGGGAGGCGGGAGCTGG - Intergenic
1006950814 6:37819896-37819918 GCGGCAGCGGTGGCGGCGGCTGG - Exonic
1007287111 6:40755571-40755593 GCGGCAGGTGAAGGGGGAGGAGG - Intergenic
1007444536 6:41895073-41895095 GCGGGAGGAGCGGCGGCAGGGGG - Intronic
1007722166 6:43891521-43891543 GGGGTGGGGGGGGCGGCAGGAGG + Intergenic
1007739639 6:44002776-44002798 GCGGCGGCGGCGGCGGCGGGAGG + Exonic
1007764440 6:44152518-44152540 GGGGCAGGGAAGGAGGGAGGGGG - Intronic
1007961409 6:45963263-45963285 GTGGCAAGGGAGGCTGCAGATGG - Intronic
1008453151 6:51676041-51676063 GTGGCAGAGGAGGAGGAAGGAGG + Intronic
1008528565 6:52433565-52433587 GCTCCAGTGGAGGTGGCAGGGGG + Intronic
1008604855 6:53130438-53130460 GAGGGCGGGGAGGGGGCAGGCGG + Intronic
1009441752 6:63688267-63688289 GGGGAAGGGGAGGGGGGAGGAGG - Intronic
1009491727 6:64300264-64300286 CCGACAGGGGCCGCGGCAGGGGG + Intronic
1012170910 6:96015928-96015950 GGGGGAGGGGAGGAGGCACGCGG - Intergenic
1012201419 6:96411095-96411117 GCGGAAGGTGATGCGGGAGGAGG + Intergenic
1012400117 6:98835581-98835603 GCGGCGGGGGCGGCGGCTGCTGG - Exonic
1012939655 6:105403134-105403156 GCGGCGGCGGCGGCGGCAAGAGG + Intergenic
1012981076 6:105831079-105831101 GGGGAAGGGGAGGCTGGAGGAGG + Intergenic
1013155822 6:107490332-107490354 GCGGCGGCGGCGGCGGCAGCAGG + Exonic
1013177600 6:107690703-107690725 GCGGGAGTGGAGGAGGCAAGAGG + Intergenic
1013306162 6:108848647-108848669 GCTGCCGGGGCGGCGGCGGGAGG + Intronic
1013366455 6:109441317-109441339 GGGGCAGGGGAGGCGACTGCTGG - Intronic
1013575932 6:111483385-111483407 GCGGCGAGGGAGGCGGCCGGCGG + Intronic
1015539402 6:134298701-134298723 GAGGCAGGAGTGGAGGCAGGCGG + Intronic
1015880285 6:137865308-137865330 GGGGCAGTGGAAGCTGCAGGAGG + Intergenic
1016010748 6:139135499-139135521 GCGGCGGGAGCGGCGGCCGGGGG + Exonic
1016393334 6:143597003-143597025 GCAGGAGGGAAGGAGGCAGGAGG - Intronic
1016882150 6:148921838-148921860 GGGGCATGGGTGGCGGCAGTGGG - Intronic
1017189419 6:151636063-151636085 GAGGGAGGGGAGGGGACAGGAGG - Intergenic
1017291748 6:152745349-152745371 GCGGCATGGGAGGCTGAAGCAGG + Intergenic
1017672422 6:156779304-156779326 GCGGCGGGGGCGGCGGCGGGCGG + Exonic
1018180432 6:161218224-161218246 GTGGCAGGGGAGGCAGTAGGTGG + Intronic
1018400324 6:163414598-163414620 GCAGCAGCGGCGGCGGCGGGGGG - Intronic
1018400497 6:163415149-163415171 GCGGCGGCGGCGGCGGCGGGCGG + Exonic
1018595422 6:165475049-165475071 GCAGCAGGGGAGTGGGCAGGTGG - Intronic
1018613096 6:165662342-165662364 GCGGCGGCGGCGGCGGGAGGAGG - Intronic
1018613097 6:165662345-165662367 GCGGCGGCGGCGGCGGCGGGAGG - Intronic
1018746356 6:166765066-166765088 GCTCCAGGGCAGGTGGCAGGAGG + Intronic
1018813798 6:167316517-167316539 GGGGCAGGGAAGGCGGTTGGCGG - Intergenic
1018876571 6:167827015-167827037 GCGGAGGCGGAGGCGGCCGGCGG + Exonic
1019070932 6:169344300-169344322 TGGGCAGGGCAGGAGGCAGGAGG + Intergenic
1019111917 6:169723981-169724003 GCGGCAGCGGCGGCGGCGGCCGG - Exonic
1019279511 7:192892-192914 GCGGCTGGGGCCGCAGCAGGGGG - Intergenic
1019279669 7:193407-193429 GCGGCGGAGGAGGCGGCCGGGGG - Exonic
1019315072 7:380533-380555 GAGGGAGGGGAGGGGGCAGGGGG + Intergenic
1019315086 7:380563-380585 GAGGCAGGGGAGGGGGCAGGGGG + Intergenic
1019315101 7:380593-380615 GAGGGAGGGGAGGGGGCAGGGGG + Intergenic
1019315116 7:380623-380645 GAGGGAGGGGAGGGGGCAGGGGG + Intergenic
1019315129 7:380653-380675 GAGGGAGGGGAGGGGGCAGGAGG + Intergenic
1019421746 7:954128-954150 GGGGGAGGGGAGGCGGCGGCAGG + Intronic
1019448032 7:1081486-1081508 GGCGCAGGGGTGGCGGCAAGGGG + Intronic
1019472757 7:1229982-1230004 GCGGCTGCGGGGGCGGCGGGTGG + Intergenic
1019473234 7:1232259-1232281 GCGGCGGGAGAGGAGGAAGGAGG - Intergenic
1019519754 7:1455274-1455296 GAGGGAGGTGAGGCGGGAGGTGG + Intronic
1019521640 7:1463387-1463409 GAGGGAGGGGAGGAGACAGGAGG + Intergenic
1019551786 7:1606798-1606820 GTGGGAGGGGAGGAGGGAGGGGG - Intergenic
1019609511 7:1929807-1929829 GGGGCAGGGGACGTGGCAGTGGG - Intronic
1019705497 7:2495453-2495475 GAGGCAGGGGTGGAGGCAGGGGG + Intergenic
1019812776 7:3176649-3176671 GCAACAGGGGATGAGGCAGGTGG + Intergenic
1021313274 7:19117493-19117515 GCGGGGAGGGAGGCGGGAGGGGG + Exonic
1021600216 7:22356972-22356994 GCGGCGGTGGTGGCGGCAGACGG - Intronic
1021680031 7:23120971-23120993 AGGGAAGGGGAGGCGGAAGGAGG - Intronic
1021827920 7:24573280-24573302 GCGGCGGCGGCGGCGGCTGGAGG + Intronic
1021953184 7:25796191-25796213 TCTGCAGGGGAGGCCACAGGGGG + Intergenic
1022091010 7:27108234-27108256 GCGGCAGGGGCGGGCGCAGGGGG - Exonic
1022091418 7:27110288-27110310 GCGGCAGGGGTAGGTGCAGGGGG + Exonic
1022094477 7:27130298-27130320 GCTGCAGGGGCGGCGGCAGCTGG + Exonic
1022098390 7:27154967-27154989 GCAGCAGTGGCGGCGGCAGAGGG + Exonic
1022207638 7:28179859-28179881 GCGGCGGCGGCGGCGGGAGGAGG + Intronic
1023115877 7:36862037-36862059 GTGGCGGGCGAGGAGGCAGGCGG - Intronic
1023435266 7:40135073-40135095 CCGGCCGGGGCGGCGGGAGGGGG + Exonic
1023868946 7:44252460-44252482 GGGGCAGGGGAGAGGGCTGGAGG + Intronic
1023897806 7:44448731-44448753 GGGAGAGTGGAGGCGGCAGGTGG - Intronic
1023939199 7:44759359-44759381 TAGGAAGGGGAGGGGGCAGGGGG - Exonic
1023940868 7:44767755-44767777 GGGGCAGGGCTGGCGGCAGAAGG - Exonic
1025069691 7:55887625-55887647 GCGGCGGCGGCGGCGTCAGGGGG + Intronic
1025069791 7:55887870-55887892 GCGGCGGCGGCGGCGGCGGGCGG + Intronic
1025069798 7:55887889-55887911 GCGGCGGCGGCGGCGGGAGGCGG + Intronic
1025087234 7:56033252-56033274 GAGGCAGAGGTGGAGGCAGGTGG + Intronic
1025230956 7:57203172-57203194 GAGGCGGAGGAGGCGGGAGGAGG - Intergenic
1026308741 7:69166087-69166109 GGGGGAGGGGAGGGGGGAGGGGG + Intergenic
1026662821 7:72317169-72317191 GAGGGAGGGAAGGAGGCAGGAGG + Intronic
1026888111 7:73966561-73966583 GTGGCCAGGGAGGCCGCAGGAGG - Intergenic
1026973970 7:74485190-74485212 GCCCCAGGGGAGGCAGCAGTGGG + Intronic
1027138219 7:75639250-75639272 GGGGGAGGGGAGGCGGCGAGGGG + Intronic
1027479238 7:78673695-78673717 GCGGCGGGGAGGGGGGCAGGCGG + Intronic
1027539889 7:79453613-79453635 GCGGCGGCGGCGGCGGCAGCCGG + Intergenic
1029458708 7:100683647-100683669 GGGGCAGAGGCGGCTGCAGGTGG + Intronic
1029704399 7:102268452-102268474 GAGGCAGGGGAGACAGCAGGAGG - Intronic
1029954131 7:104619852-104619874 GGGGCAGGTGGGGCAGCAGGGGG + Intronic
1030121249 7:106112417-106112439 GCGGCTGGGGAGGCGAGGGGCGG + Intronic
1031334479 7:120510859-120510881 GGGGCAGGGGAGGTGGCCAGGGG - Intronic
1032306223 7:130734159-130734181 GCGGCGGCGGCGGCAGCAGGCGG - Intergenic
1032306224 7:130734162-130734184 GCGGCGGCGGCGGCGGCAGCAGG - Intergenic
1033328480 7:140398477-140398499 GCGGCGGGGGAGGCGGGCAGCGG - Exonic
1033367568 7:140683400-140683422 GAGGCAGGGGAGTCAGAAGGTGG + Intronic
1034410813 7:150941188-150941210 GAGGCAGGCGGGGAGGCAGGCGG + Intergenic
1034435049 7:151059531-151059553 GCGGGTGGGGAGGCGGGAGCGGG - Intronic
1034469719 7:151248751-151248773 GCGGCGGCGGCGGCGGCGGGCGG - Exonic
1034469792 7:151248994-151249016 ACGCCAGGGGAGGCGGCGGGGGG + Intronic
1034470514 7:151252037-151252059 GCGGCCGGGGAGGCGGCGGAGGG + Intronic
1034653719 7:152712752-152712774 GGGGGAGGGGAGGGGGGAGGAGG - Intergenic
1034995038 7:155571732-155571754 CCTGCAGGGGAGGTGGCCGGGGG - Intergenic
1035153852 7:156896516-156896538 GTGGCAGGGGAGGCGGGAGAGGG + Intergenic
1035201922 7:157273180-157273202 GTGGCAGGGGAGGTGGCACTGGG - Intergenic
1035372119 7:158386344-158386366 GGGGCACGGGAGGAGGGAGGAGG - Intronic
1035404224 7:158587703-158587725 GCCGCGCGGGAGGCGGCGGGAGG + Intronic
1035553017 8:544660-544682 GCGGCGGCGGCGGCGGCCGGTGG + Exonic
1035584319 8:760235-760257 GCAGCAAGGGAGGAGACAGGAGG - Intergenic
1035754922 8:2023851-2023873 GCTGCAGGGGAGGAAGCAGCAGG + Intergenic
1036578824 8:10054393-10054415 GCGGCAGGGGCGCGGGCGGGCGG - Exonic
1036768535 8:11563878-11563900 GCGGCAGAGGAGACCGCAAGCGG - Intronic
1037281434 8:17246752-17246774 GCGGTAGCGGCGGCGGCAGCGGG + Exonic
1037893207 8:22635044-22635066 GATGCAGGAGAGGCAGCAGGAGG - Intronic
1038008735 8:23457381-23457403 GCGGCAGGGGAGGCGGGAACCGG + Intronic
1038268245 8:26052233-26052255 GCGGCAGTGGTGGCGGGGGGAGG + Intergenic
1038731262 8:30129871-30129893 GCGGAAGGTGAAGAGGCAGGAGG + Intronic
1038828547 8:31033177-31033199 GCGGCGGGGGAGGAGGCGGGGGG - Exonic
1039028314 8:33282418-33282440 GAGGCAAGGGTGGAGGCAGGAGG - Intergenic
1039467850 8:37796897-37796919 GCGGCGGCGGCGGCGGCAGCAGG + Intronic
1039476506 8:37841780-37841802 GAGGCGGGGGCGGCGGCCGGCGG + Exonic
1039971105 8:42322443-42322465 GCTGCAGGAGAAGCGGCAGAAGG + Exonic
1041162418 8:55059026-55059048 GCGGCGGGGCGGGGGGCAGGTGG + Intergenic
1041170884 8:55141253-55141275 GAGGCAGAGGAGGAGGGAGGCGG - Intronic
1041280930 8:56211006-56211028 GGAGCAGCGGCGGCGGCAGGAGG - Intronic
1041673678 8:60517084-60517106 GCAGCAGCGGCGGCGGCGGGCGG + Exonic
1041780969 8:61578193-61578215 GAGGCAGGAGTGGAGGCAGGCGG - Intronic
1042785133 8:72537527-72537549 GTGGCTGTGGCGGCGGCAGGGGG + Exonic
1042926867 8:73976039-73976061 GCGGCCGGGAAGGCGGCAGGCGG + Intronic
1043484200 8:80682723-80682745 GCGGTGGGGGAGGGGGGAGGAGG + Intronic
1043745512 8:83869419-83869441 GAGGGAGGCGACGCGGCAGGGGG - Intergenic
1044099952 8:88122903-88122925 GAGGCAGGGGTGGGGGGAGGAGG - Intronic
1045245202 8:100436501-100436523 GAGGCAGGGGAGGAGGAAGGAGG - Intergenic
1045951307 8:107854510-107854532 GGAGCAGGGGAGGGGGCAGGAGG + Intergenic
1046822058 8:118644478-118644500 GAGGCTGGAGAGGCTGCAGGAGG - Intergenic
1046936149 8:119887431-119887453 ACGGGAGGGGAGGGGGGAGGGGG - Intronic
1046962395 8:120125041-120125063 GTGGCCGCGGAGGCGGGAGGTGG - Intronic
1047306076 8:123654100-123654122 GCCACAGTGGAGGTGGCAGGTGG + Intergenic
1047329262 8:123871454-123871476 GGGGGAGGGGAGTGGGCAGGGGG - Intronic
1047785856 8:128153369-128153391 CCGGCTGGGGAGACAGCAGGAGG - Intergenic
1048471989 8:134712412-134712434 GCGGCCGGGAAGCCTGCAGGAGG + Intronic
1048633603 8:136271537-136271559 GGGGGGGGGGGGGCGGCAGGGGG - Intergenic
1048833306 8:138496766-138496788 GCGGCGGCGGCGGCGGCGGGCGG + Exonic
1049064103 8:140299286-140299308 GCGGGAGGGGTGTGGGCAGGGGG + Intronic
1049101300 8:140580682-140580704 GGGTCATGGGAGGAGGCAGGAGG + Intronic
1049109795 8:140635645-140635667 GCGGCCGGGGCGGCGGGCGGAGG + Intergenic
1049177900 8:141205691-141205713 GCGCCAGGTGAGGCGGGCGGGGG + Intergenic
1049194499 8:141308058-141308080 GCGGCGGGGCAGGCGGCTGCGGG + Intronic
1049219555 8:141422624-141422646 GAGGCAGGGGGTGAGGCAGGGGG + Intronic
1049289096 8:141792077-141792099 GCAGCCGGGGAGGAGGCAGAGGG - Intergenic
1049406436 8:142453660-142453682 GGAGCAGGGCAGGGGGCAGGGGG + Intronic
1049451543 8:142664710-142664732 GCGGGAAGGGAGGCAGAAGGGGG - Exonic
1049509832 8:143021932-143021954 GAGGCAGGGGCTGGGGCAGGTGG - Exonic
1049532123 8:143160007-143160029 GCGGCAGGGGCGGGAGCGGGTGG + Intronic
1049541487 8:143211144-143211166 TGTGGAGGGGAGGCGGCAGGTGG + Intergenic
1049551932 8:143264044-143264066 GAGGGAGGGGAGGCAGCAGAAGG - Intronic
1049585632 8:143431182-143431204 GCGGCGGCGGCGGCGGCAGCGGG + Intergenic
1049681786 8:143922068-143922090 GCAGCAGCGGCGGCAGCAGGAGG - Exonic
1049690036 8:143954296-143954318 GGGGCCGGGGAGGTGGGAGGTGG - Intronic
1049693212 8:143971792-143971814 GAGGCTGGTGAGGGGGCAGGGGG - Intronic
1049725190 8:144142492-144142514 GGGAGAGGGGAGGCGGGAGGTGG + Intergenic
1049746958 8:144267084-144267106 GCGGCGGGGGCGGCGGCGGGGGG - Exonic
1049762272 8:144336901-144336923 GCGGCGGCGGCGGCGGCGGGCGG + Intergenic
1049793129 8:144482070-144482092 GCGGCGGCGGCGGCGGCAGCCGG - Intronic
1050343318 9:4662464-4662486 GCGGCGGTGGCGGCGGCAGCAGG + Exonic
1051340026 9:16102494-16102516 GGGGCGGGGGTGGGGGCAGGGGG + Intergenic
1052624858 9:30962119-30962141 GCTCCAGTGGAGGTGGCAGGGGG + Intergenic
1052840623 9:33289117-33289139 GTGGCAGGCCAGGAGGCAGGGGG - Intergenic
1052862880 9:33447558-33447580 CGGGCAGGGGTGGCGGGAGGCGG + Exonic
1052918137 9:33939806-33939828 GAGGAAGGGGAGGAGGAAGGGGG + Intronic
1052941494 9:34134739-34134761 GCGGCGGCGGCGGCGGCGGGCGG - Intergenic
1053148321 9:35727075-35727097 GAGGCACTGGAGGCAGCAGGTGG + Intronic
1053569514 9:39289081-39289103 GAGGGAGGGGCGGAGGCAGGGGG + Intergenic
1053586543 9:39464483-39464505 CCGGGAGGGCAGACGGCAGGAGG + Intergenic
1053681711 9:40489961-40489983 GCGGCATGGGCAGCGGCAGATGG - Intergenic
1053697507 9:40651094-40651116 GCGGCGGCGGCGGCGGCGGGGGG + Intergenic
1053786355 9:41655264-41655286 GCGGGAGGGGAGGCGGAGGCGGG + Intergenic
1053833404 9:42108606-42108628 GCTGCATGGAAGGTGGCAGGTGG - Intronic
1053931705 9:43118291-43118313 GCGGCATGGGCAGCGGCAGATGG - Intergenic
1054091145 9:60848066-60848088 GAGGGAGGGGCGGAGGCAGGGGG + Intergenic
1054127632 9:61329928-61329950 GAGGGAGGGGCGGAGGCAGGGGG - Intergenic
1054145083 9:61556177-61556199 GAGGAGGGGCAGGCGGCAGGGGG + Intergenic
1054175076 9:61869220-61869242 GCGGGAGGGGAGGCGGAGGCGGG + Intergenic
1054282003 9:63134973-63134995 GCGGCATGGGCAGCGGCAGATGG + Intergenic
1054294803 9:63325478-63325500 GCGGCATGGGCAGCGGCAGATGG - Intergenic
1054308799 9:63450503-63450525 GCGGCGGCGGCGGCGGCGGGGGG + Intergenic
1054392823 9:64629965-64629987 GCGGCATGGGCAGCGGCAGATGG - Intergenic
1054407657 9:64774850-64774872 GCGGCTGCGGCGGCGGCGGGGGG + Intergenic
1054427473 9:65135174-65135196 GCGGCATGGGCAGCGGCAGATGG - Intergenic
1054502904 9:65886366-65886388 GCGGCATGGGCAGCGGCAGATGG + Intronic
1054579764 9:66900750-66900772 CCGGGAGGGCAGACGGCAGGAGG - Exonic
1054597146 9:67078805-67078827 GCTGCATGGAAGGTGGCAGGTGG + Intergenic
1054662461 9:67711573-67711595 GCGGGAGGGGAGGCGGAGGCGGG - Intergenic
1054798557 9:69325141-69325163 GCGGCAGCGGCGGCAGCAAGTGG + Intronic
1054905917 9:70413612-70413634 GGGGCAGGGGCGGCGGCTAGAGG - Exonic
1056154049 9:83817558-83817580 GCGGGAGAGGCGGCGGCGGGGGG - Exonic
1056341747 9:85641577-85641599 GTGGCAGGGAAGGCTGCAGAAGG + Intronic
1056356448 9:85805535-85805557 GCGGGAGAGGCGGCGGCGGGGGG + Intergenic
1056733176 9:89183135-89183157 AAAGCAGGGGAGGCTGCAGGAGG + Intergenic
1056780284 9:89544021-89544043 GCTGCAGAGGAGACAGCAGGCGG + Intergenic
1057245540 9:93451700-93451722 GCGGCAGCGGCGGCGGCGGCAGG + Exonic
1057596395 9:96418706-96418728 GCGGCGGGGAGGGCGGCAAGAGG + Intergenic
1057613471 9:96567308-96567330 GCGGCGGGGGAGGCGCCAGGAGG - Intronic
1057759568 9:97861310-97861332 GGAGCAGGGGAGGAAGCAGGGGG - Intergenic
1057885743 9:98828235-98828257 GTGGCAGGGCAGGGGGCAGCTGG - Intronic
1058418301 9:104810932-104810954 CAGGCAGTGGAGGGGGCAGGGGG + Intronic
1058847484 9:108975326-108975348 GGGGCAGGGGTGGGGGTAGGGGG + Intronic
1058885936 9:109321003-109321025 GCGGCGGCGGCGGCGGCTGGAGG - Intergenic
1058997691 9:110315833-110315855 GCGGCAGGGGAGGGGGTTGAGGG + Intronic
1059072417 9:111152799-111152821 GAGGCAGAGGAGGAGGAAGGAGG + Intergenic
1059237142 9:112770603-112770625 GAGGCAAGGGAGTGGGCAGGGGG - Intronic
1059445008 9:114332603-114332625 GGGGCTGGGGATGGGGCAGGAGG - Intronic
1059447994 9:114350925-114350947 GCGGCAGGGGCGGGGGCTGGGGG + Exonic
1060147883 9:121268062-121268084 GCGGCCGGGCAGGCGGGTGGGGG - Intronic
1060149027 9:121275603-121275625 GTGGGAGGGGAGGTGGGAGGGGG - Intronic
1060153012 9:121300634-121300656 GGGGCCGGGGAGGGTGCAGGAGG - Intronic
1060223460 9:121776335-121776357 GCGGCTGCGGCGGCAGCAGGAGG + Exonic
1060278102 9:122197514-122197536 GGCGCAGGGGAGGCGGAGGGAGG + Intronic
1060301128 9:122375200-122375222 GTGGCGGGGGAGGCGGGAGGGGG + Intronic
1060389445 9:123267014-123267036 GCGGTTGGGGAGGAGGAAGGTGG - Intronic
1060481372 9:124018423-124018445 GCGGCGGGGGAGGCAGCCGTGGG - Intronic
1060540877 9:124429281-124429303 TCGACAGGGGAAGCGGCAGGAGG + Intergenic
1060554953 9:124503465-124503487 GCGGCTGGGGCGGCGGCCGCGGG - Intronic
1060555322 9:124504865-124504887 GGGGGCGGGGAGGCGGGAGGGGG - Intronic
1060811684 9:126614094-126614116 GCGGTGGCGGCGGCGGCAGGCGG - Intergenic
1060934026 9:127505658-127505680 GCAGCAGGGGAGGGGGCCTGGGG + Exonic
1060968349 9:127724088-127724110 GGGGCGTGGGAGACGGCAGGAGG - Intronic
1061283501 9:129610177-129610199 GCCACAGGGGAGGGGGGAGGAGG + Intronic
1061285492 9:129620256-129620278 ACAGCAGGGGAGGCGGCAGCAGG + Exonic
1061287330 9:129631536-129631558 GCGGCGGTGGAGATGGCAGGGGG - Intronic
1061295698 9:129675601-129675623 GAGGCGGGGGTGGGGGCAGGAGG - Intronic
1061365890 9:130172350-130172372 AGCGCAGGGGCGGCGGCAGGCGG + Intergenic
1061371014 9:130197607-130197629 GCGGGAGGGCTGGGGGCAGGTGG + Intronic
1061405848 9:130392646-130392668 GCAGCAGGGGTGGAGGCAGCTGG + Intronic
1061485959 9:130920659-130920681 GCGGCAGGGGAGGCGGCAGGTGG - Intronic
1061506045 9:131032344-131032366 GATGCAGGGGACCCGGCAGGAGG - Intronic
1061517087 9:131096387-131096409 GCGGGAGGGGAGGGGAGAGGCGG + Intergenic
1061517096 9:131096406-131096428 GCGGGAGGGGAGGGGAGAGGCGG + Intergenic
1061517105 9:131096425-131096447 GCGGGAGGGGAGGGGCGAGGCGG + Intergenic
1061541083 9:131278044-131278066 GCGGCGGCGGCGGCGGCGGGCGG + Intergenic
1061559575 9:131394029-131394051 GAGGCGGGGGCGGCGGCAGGCGG + Intergenic
1061590049 9:131592273-131592295 GAGGCAGGGGAGATGGCACGGGG + Intronic
1061824885 9:133251963-133251985 GCTGCAGGGGAGGAAGCGGGTGG + Intronic
1061835241 9:133324273-133324295 GTGGCGGGGGAGGCAGCAGCAGG + Intergenic
1062345824 9:136114735-136114757 GTGGGACGGGAGGCGGGAGGGGG - Exonic
1062370325 9:136235429-136235451 GCAGAAGGGGAGGCGGCCGCGGG + Intronic
1062373890 9:136253502-136253524 GCAGCAGGGGATGAGGCCGGAGG - Intergenic
1062390661 9:136332420-136332442 GCTGGAAGGGAGGCGGGAGGTGG + Intronic
1062542112 9:137046076-137046098 GCAGCGGGGGAGGACGCAGGAGG + Exonic
1062562622 9:137148431-137148453 GAGGCAGGCGCGGCTGCAGGAGG + Intronic
1062574567 9:137200222-137200244 GCGGCGGCGGCGGCGGCGGGGGG + Exonic
1062630770 9:137462139-137462161 GCGGCGGCGGAGGCGGGCGGAGG - Intronic
1062637574 9:137499685-137499707 GGGGCAGGGGTGGGGGCAGCGGG - Intronic
1062659113 9:137619122-137619144 CCGGGCGGGGCGGCGGCAGGCGG + Intronic
1062659128 9:137619170-137619192 GCGGCGGCGGCGGCGGCGGGGGG - Intronic
1062697898 9:137884772-137884794 GGGCCAGGAGAGGAGGCAGGAGG + Intronic
1202779855 9_KI270717v1_random:24391-24413 GCGGCGGCGGCGGCGGCGGGGGG + Intergenic
1203471459 Un_GL000220v1:116836-116858 GCGGCGGCGGCGGCGGCAGGCGG + Intergenic
1203479280 Un_GL000220v1:160808-160830 GCGGCGGCGGCGGCGGCAGGCGG + Intergenic
1185464358 X:346073-346095 GTGGGAGGGGAGGAGGGAGGGGG + Intronic
1185735849 X:2495656-2495678 GCTGCAAGGGAGGAGGAAGGAGG - Intronic
1185893227 X:3838073-3838095 GCGGCAGGGGTGGGGGCTGAGGG + Intronic
1185898339 X:3876495-3876517 GCGGCAGGGGTGGGGGCTGAGGG + Intergenic
1185903454 X:3914924-3914946 GCGGCAGGGGTGGGGGCTGAGGG + Intergenic
1186107837 X:6226461-6226483 GCGGCGGGGGCGGGAGCAGGGGG - Intronic
1186124706 X:6400903-6400925 GAGGAAGGGGAGGGGGCAGGGGG - Intergenic
1186426067 X:9465123-9465145 GCGGCGGCGGCGGCGGCAGCGGG - Exonic
1186480985 X:9895862-9895884 GCAGCAGGGGAGGCGGAGGATGG + Exonic
1187181444 X:16946895-16946917 GCGGCAGCGGCAGCGGCGGGCGG + Exonic
1187388880 X:18873007-18873029 GCGGCAGGGGAAACAGAAGGAGG - Intergenic
1187464433 X:19515122-19515144 GCGGCGGAGGGCGCGGCAGGCGG - Exonic
1187914746 X:24142722-24142744 GCGGCGGGGGAGGGGGGGGGGGG + Intergenic
1187916099 X:24153358-24153380 GCCGCAGGGGAGGTTGCAGGAGG + Intronic
1189137117 X:38561507-38561529 GCGGCGGCGGCGGCGGCAGGCGG - Exonic
1189309274 X:40008629-40008651 GCGGCGGGGGAGGGGGGAGCGGG + Intergenic
1189322791 X:40096707-40096729 GCGGCGGTGGCGGCGGCTGGGGG + Intronic
1189323151 X:40098068-40098090 GGGGGAGGGGAGGCGGCTGTTGG - Intronic
1189333138 X:40155056-40155078 GCGGGAGGGGAGGGGGTCGGGGG + Intronic
1189363297 X:40369633-40369655 GGGGCAGGGGAGTGGGGAGGGGG + Intergenic
1190009183 X:46768689-46768711 GACGGAGGGGAGGTGGCAGGGGG - Intergenic
1190301773 X:49061132-49061154 GGGGCAGAGAAGGAGGCAGGAGG + Intronic
1190325527 X:49204901-49204923 GCGTCAGGGAAGGAGGGAGGAGG - Intergenic
1190328224 X:49219598-49219620 GTGGCAGGGGGTGAGGCAGGAGG - Intronic
1190332088 X:49242311-49242333 GCTACAGGGCAGGGGGCAGGGGG + Intronic
1192033906 X:67544087-67544109 GAGGCAGAGGAGGCGACAGAGGG + Intronic
1192125605 X:68498576-68498598 GGGGCAGGGGCGGCGGCGGAGGG + Exonic
1192125607 X:68498585-68498607 GCGGCGGCGGAGGGAGCAGGAGG + Exonic
1192141041 X:68647477-68647499 CTGGCAGGGGAGCCGGCAGGAGG + Intergenic
1192557368 X:72101324-72101346 GCAGAATGGGAGGAGGCAGGTGG + Intergenic
1192624766 X:72715359-72715381 GCGGCGGGGGAAGCGGGGGGGGG - Intergenic
1193136353 X:77975229-77975251 CGGGCAGGGGTGGTGGCAGGGGG - Intronic
1193282365 X:79668549-79668571 GCGGAAGGGGAAGCTGGAGGAGG + Intergenic
1194667314 X:96689553-96689575 GAGGCAAGGGAGGTGGCAGAAGG - Intronic
1195144556 X:102000228-102000250 GCAGCAGTGGTGGTGGCAGGGGG - Intergenic
1195231922 X:102859136-102859158 GCTCCAGTGGAGGTGGCAGGGGG + Intergenic
1195292626 X:103443930-103443952 GAAGCAGGGTGGGCGGCAGGGGG - Intergenic
1195668342 X:107449893-107449915 GCGGCGGCGGCGGCGGCAGCGGG - Intergenic
1196657346 X:118232232-118232254 GAGGAAGGGGAGGGGGGAGGAGG + Intergenic
1196808027 X:119605915-119605937 GCGGCAGCGGCGGCGGCGGGAGG + Intergenic
1196861012 X:120026816-120026838 GTGTCAGGGGAGGGGGCAAGAGG + Intergenic
1196865205 X:120065078-120065100 GGGGCAGAGGAGGAAGCAGGGGG + Intergenic
1196877888 X:120171202-120171224 GGGGCAGAGGAGGAAGCAGGGGG - Intergenic
1197873549 X:131082393-131082415 GGCGCGGGGGCGGCGGCAGGAGG + Intronic
1198820467 X:140642305-140642327 GAGGCAGAGAAGGAGGCAGGAGG - Intergenic
1199635200 X:149806914-149806936 GAGGAAGGGCAGGCGCCAGGAGG + Intergenic
1199770756 X:150973775-150973797 GTGGCGGGGGAGGGGGGAGGTGG + Intergenic
1199846049 X:151693990-151694012 GTTGGAGGGGAGGCGGCCGGTGG + Intergenic
1199881163 X:151974914-151974936 GGGGCGGGGGAGGCGGAGGGAGG + Intergenic
1199927089 X:152479550-152479572 GAGGCAGGAGTGGAGGCAGGTGG - Intergenic
1200231078 X:154444200-154444222 GCGGCGGCGGCGGCGGCGGGCGG - Exonic
1202147662 Y:21816922-21816944 GAAGCAGAGGAGACGGCAGGTGG - Intergenic