ID: 1061485960

View in Genome Browser
Species Human (GRCh38)
Location 9:130920662-130920684
Sequence TTGGCGGCAGGGGAGGCGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 619
Summary {0: 1, 1: 0, 2: 5, 3: 40, 4: 573}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061485960_1061485973 20 Left 1061485960 9:130920662-130920684 CCTGCCGCCTCCCCTGCCGCCAA 0: 1
1: 0
2: 5
3: 40
4: 573
Right 1061485973 9:130920705-130920727 CCAGTAGCACCAAGCCACCGTGG No data
1061485960_1061485968 -3 Left 1061485960 9:130920662-130920684 CCTGCCGCCTCCCCTGCCGCCAA 0: 1
1: 0
2: 5
3: 40
4: 573
Right 1061485968 9:130920682-130920704 CAAACCTCCTTAAACCAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061485960 Original CRISPR TTGGCGGCAGGGGAGGCGGC AGG (reversed) Intronic
900117350 1:1034265-1034287 TGGGCAGCAGGGGTGGCTGCGGG + Intronic
900157352 1:1208621-1208643 ATGGCGTCAGGCGAGGGGGCGGG + Intergenic
900458702 1:2789965-2789987 CTGCTGGCAGGGGACGCGGCGGG - Intronic
900547831 1:3238213-3238235 GTGGGGGCAGGGGATGCGGAGGG + Intronic
900611355 1:3545903-3545925 TTGGGGTCAGGGGAGGTGGGAGG - Intronic
900739555 1:4322405-4322427 CTGGTGGGAGGGGAGGTGGCTGG - Intergenic
900946624 1:5834591-5834613 TGGTCGGCAGGGGCGGGGGCAGG - Intergenic
900958922 1:5907078-5907100 TTGGTGGAAGGCAAGGCGGCAGG + Intronic
901145440 1:7061699-7061721 GTGGCGGCAGAGGAGGGGGTGGG + Intronic
901628972 1:10639027-10639049 GAGGCGGCGGCGGAGGCGGCGGG - Exonic
901656249 1:10771270-10771292 GTGGGGGCGGGGGTGGCGGCAGG + Intronic
901974351 1:12932506-12932528 ATGGCAGCAGGGTAGGGGGCCGG - Intronic
902010823 1:13269262-13269284 ATGGCAGCAGGGTAGGGGGCCGG + Intergenic
902891720 1:19448946-19448968 TTGCAGGCAGGGGAGGCGAGGGG + Intronic
903055494 1:20633504-20633526 GTGGCGGCAGCGGCGGCTGCGGG + Exonic
903278846 1:22238634-22238656 TTGGCGGGAGGGGAGTGGCCAGG + Intergenic
903297140 1:22350947-22350969 GTGGGGGCGGGGGAGGGGGCAGG - Intergenic
903415206 1:23177702-23177724 CGGGCGGCGGGGGAGGGGGCCGG + Exonic
904458956 1:30664119-30664141 TTGTGGTCAGGGGAGGCAGCAGG + Intergenic
904943072 1:34178130-34178152 TTGGCAGCAAGGGAGGAGGGAGG + Intronic
905107689 1:35574023-35574045 TCGGCGGCAGCTGTGGCGGCCGG - Exonic
905282986 1:36860764-36860786 ATGGCGGCAGAGGACGTGGCAGG + Intronic
905340570 1:37274765-37274787 GTGGTGGCAGGGGAGGTGGCAGG - Intergenic
905990692 1:42335006-42335028 TGGGCGGCGGGCGAGGAGGCGGG - Intronic
906027018 1:42682596-42682618 GGGGCGGCGGGGGGGGCGGCGGG - Exonic
907297483 1:53464675-53464697 GTGGCGGCGGCGGCGGCGGCAGG - Exonic
908089845 1:60674427-60674449 GTGGAGGCAGGGGAGGTGGGAGG + Intergenic
909170017 1:72282887-72282909 GCGGCGGCGGGGGAGGAGGCAGG + Intergenic
910277559 1:85465068-85465090 GCGGCGGCGGCGGAGGCGGCCGG + Exonic
910277618 1:85465322-85465344 GTGGGGCCAGGAGAGGCGGCCGG + Intronic
910657435 1:89633073-89633095 TCCGCGGCCGGGGAGGCGGAGGG + Exonic
910759023 1:90717652-90717674 GTGGCGGCGGCGGACGCGGCAGG + Intergenic
911348270 1:96722140-96722162 TTGGCGGCGGGGGATGGGGTGGG + Intronic
911498830 1:98661690-98661712 CTGGCGGCGGCGGTGGCGGCCGG + Intronic
913533196 1:119747720-119747742 GTGGGGGCAGGGGAGGAGGAGGG - Intergenic
914995439 1:152539410-152539432 TTGGCAGCAGGGGAGGCAAGAGG + Intronic
915312997 1:155013737-155013759 TTGGCAGTGGGGGAGGGGGCGGG + Intronic
915345016 1:155193005-155193027 TAGGAGGTAGGGGAGGGGGCGGG - Intergenic
915748515 1:158183075-158183097 GTGGTGGCTGGGGAGGCAGCTGG + Exonic
915762506 1:158329429-158329451 GTGGCAGATGGGGAGGCGGCTGG - Exonic
915765294 1:158356024-158356046 GTGGCGGCTGGGGAGGCAGCTGG + Exonic
918248922 1:182684587-182684609 TGAGCGGCAGGGGAGGGGGTGGG + Intergenic
918683620 1:187387553-187387575 TTGGCTGCTGGGGAGGCCTCAGG + Intergenic
918897834 1:190370633-190370655 TTGGCGGCAGTGGGAGAGGCTGG + Intronic
920095394 1:203483355-203483377 CTGGAGGGAGGGGAGGAGGCAGG - Exonic
920144004 1:203842231-203842253 TGGGAGGCAAGGCAGGCGGCTGG + Intronic
920246597 1:204592410-204592432 ATGGCATCAGGGGAGGCAGCAGG - Intergenic
921046165 1:211479329-211479351 TGGGCGGGAGGGGAGGGCGCTGG + Intronic
921138615 1:212285270-212285292 GCGGCGGCGGGGGAGGGGGCGGG - Intergenic
921577655 1:216855694-216855716 TGGGGAGCAGGGGAGGGGGCAGG - Intronic
921830595 1:219724073-219724095 TTGGTGGCAGTGGAGGCTGGTGG - Intronic
922471354 1:225879306-225879328 TTGGCAGCTTGGGAGGTGGCTGG - Exonic
923554466 1:234989902-234989924 CTTGGGGCAGGGGAGGAGGCAGG + Intergenic
923592217 1:235328780-235328802 TGAGCGGCAGTGGCGGCGGCTGG + Intronic
923843167 1:237696650-237696672 TGGGAGGAAGGGGATGCGGCGGG - Intronic
1062892420 10:1074234-1074256 ATGCCAGCAGGGGAGGCTGCAGG - Intronic
1066477866 10:35765217-35765239 GCGGCGGGAGGGCAGGCGGCGGG - Intergenic
1067713800 10:48671671-48671693 TGGGCGTCAGCGGAGGCCGCAGG + Intergenic
1068660748 10:59621002-59621024 TTGCCGGCAGGGGAGGAGTGGGG - Intergenic
1069424681 10:68279038-68279060 GTGGCGGCAGCAGCGGCGGCGGG + Intergenic
1069456972 10:68561014-68561036 TTGGGGGCAGCGGGGGCGCCTGG + Intronic
1069755410 10:70771787-70771809 TGGGGGGCAGGGGTGGCAGCAGG - Intronic
1069885057 10:71618430-71618452 GTGAGGGCAGGGGAGGAGGCAGG - Intronic
1070255967 10:74813540-74813562 CAGGAGGCAGGGGAGGCGGGCGG - Intergenic
1070311471 10:75276556-75276578 GTGGGGGCAGGGCAGGCCGCAGG - Intergenic
1070598549 10:77849622-77849644 TTGGCAGCAGGGGCGGGGGTGGG - Intronic
1071156103 10:82691410-82691432 GGGGTGGCAGGGGAGGCAGCTGG - Intronic
1071277530 10:84069297-84069319 TTGGAGGCAGTGGAGGCCCCTGG + Intergenic
1071306464 10:84303164-84303186 GTGGCGGCGGGGGGGGGGGCGGG + Intergenic
1072521859 10:96236390-96236412 GAGGCTGCAGGGGAGGCGGTGGG + Intronic
1072806632 10:98427575-98427597 TTGGGGGCAAGGGAGGGGGGAGG - Intronic
1073249394 10:102112591-102112613 TTGGGGGCGGGGGTGGGGGCTGG - Intronic
1073460384 10:103662337-103662359 TTGGCGGGGGGGGGGGCGGGGGG + Intronic
1073470876 10:103721377-103721399 TTGGCTGTTGGGGAGGCAGCAGG - Intronic
1074964052 10:118473239-118473261 GTGGAGGCAGGGGAAGGGGCTGG - Intergenic
1075010552 10:118866140-118866162 TTGGTAGCAGGGGAATCGGCAGG - Intergenic
1075032095 10:119030300-119030322 GTGGCGGCGGCGGCGGCGGCGGG - Exonic
1075071631 10:119323842-119323864 TTGGGGGAAGGGGAGGAGGGAGG - Intronic
1075401391 10:122163766-122163788 GTGGCGGCGGGAGCGGCGGCAGG - Intronic
1075463130 10:122632002-122632024 TGGCCGGCAGGGGAGGGGACAGG - Intronic
1076370558 10:129950045-129950067 GCGGAGGCAGGGGCGGCGGCTGG + Intronic
1076521262 10:131082696-131082718 GGGGCGGCAGGTGGGGCGGCAGG + Intergenic
1076717517 10:132374039-132374061 ATGGGGGCGGGGGAGGCTGCAGG + Intronic
1076805772 10:132858236-132858258 TTGGGGGCAGGGCAGTGGGCAGG + Intronic
1076905090 10:133357538-133357560 CTGGCCCCTGGGGAGGCGGCCGG - Intronic
1077009444 11:373678-373700 GTGGAGGCAGGGAAGGGGGCAGG - Intronic
1077388992 11:2290621-2290643 CTGGCAGCAGGGCAGGCAGCTGG + Intergenic
1077453025 11:2662375-2662397 TGGGGGGCAGGGGAGGGGGCTGG - Intronic
1077500958 11:2909562-2909584 TGGGCGGCTGGGGACGGGGCGGG - Exonic
1078599763 11:12719573-12719595 TTGGGGGGAGGGGGGGCGGGGGG + Intronic
1079237103 11:18698866-18698888 ATGGCGGCGGCGGCGGCGGCTGG - Exonic
1079508292 11:21180064-21180086 TTGGGGGCAGGGTGGGCGGGGGG + Intronic
1080037276 11:27722559-27722581 GGGACGGGAGGGGAGGCGGCAGG + Intergenic
1080458335 11:32434539-32434561 GCGGCGGCTGGGGAGGAGGCCGG - Intronic
1081704964 11:45177349-45177371 TTGGGGGAAGGGGGGTCGGCAGG - Intronic
1082838448 11:57668457-57668479 GGGGCGGAAGGGGCGGCGGCTGG - Intronic
1083809631 11:65096377-65096399 CTCTCGGAAGGGGAGGCGGCGGG + Exonic
1083862828 11:65433855-65433877 GAGGCGGCAGGGGAGGCGGGTGG - Intergenic
1083925195 11:65801759-65801781 ATGGAGGCAGCGGAGGCGGCAGG + Intergenic
1084126087 11:67099941-67099963 TTGGAGGCAGAGGAGGCGGCAGG + Intergenic
1084264828 11:67999486-67999508 TGGGCAGCAGGGCAGGAGGCTGG - Intronic
1084375844 11:68776977-68776999 CTGTCGGCTGGCGAGGCGGCGGG + Intronic
1084611137 11:70203703-70203725 TTCGAGGCGGGGGCGGCGGCCGG + Exonic
1085108565 11:73867435-73867457 CTCGGGGCAGGGGAGGCGGGGGG - Intergenic
1085726919 11:78962274-78962296 TTGGCCGGAGGGGAGGGGGGCGG + Intronic
1086413846 11:86569383-86569405 TTGGAAGCAGGGGAGGAGGAAGG - Intronic
1088389929 11:109302915-109302937 CTTGCAGCAGGGGAGGGGGCAGG - Intergenic
1088654469 11:111986324-111986346 TTGGGTGCAGGGGAGGGGGTGGG - Intronic
1088677253 11:112206304-112206326 GGGGCGGCAGGGGCGGCAGCTGG + Intronic
1088847123 11:113677981-113678003 TTGGAGTGAGGGGAGGTGGCTGG - Intergenic
1088883103 11:113987007-113987029 TTGGTGGCTTGGGAGGTGGCTGG - Exonic
1088903929 11:114139830-114139852 TGGGCGGCTGTGGAGGAGGCCGG + Intronic
1089494871 11:118902818-118902840 GCGGCGGCAGTGGAGGTGGCTGG + Exonic
1089596701 11:119585193-119585215 CTGGAGGCAGGTGAGGCTGCCGG - Intergenic
1089753085 11:120665794-120665816 TTGGTGGCAGGGGAGGAGCAAGG - Intronic
1090022289 11:123138606-123138628 ATGGTGGCAGGGGAGGGGGAGGG - Intronic
1090710058 11:129375913-129375935 CCGGCAGCTGGGGAGGCGGCGGG - Intergenic
1091238408 11:134036849-134036871 TTGGCGGTGGGGGTGGGGGCGGG - Intergenic
1091839234 12:3607572-3607594 GTGGCAGCTGGGGAGGCCGCGGG + Intronic
1091934296 12:4423167-4423189 GTGGCGGCTGGGGAGGCTGAGGG - Intergenic
1092080418 12:5711401-5711423 TTGGCCGCTGGGGAGGCCTCAGG - Intronic
1092246551 12:6867392-6867414 GCGGCGGCCGGGGCGGCGGCAGG + Exonic
1092507955 12:9124265-9124287 TTGGCTGCAGTGGAGCCGGTGGG + Intergenic
1094841188 12:34343326-34343348 TGCGCGGCAGGGGAGGCGGGGGG - Intergenic
1096298061 12:50400869-50400891 CTGACGGCAGGGGAGGAGCCGGG + Intronic
1096870301 12:54588519-54588541 GCGGCGGGAGGGAAGGCGGCGGG + Exonic
1098998677 12:77150882-77150904 GTGGGGGCTGGGGAGGCTGCAGG + Intergenic
1101371894 12:104138044-104138066 TTGGCGGCGGGGACGGCGCCGGG + Intronic
1101948376 12:109155125-109155147 TTGGCGGGAGGGGAGGAAGGAGG + Intronic
1102029621 12:109732452-109732474 TGGGCTGCTGGGCAGGCGGCCGG - Intronic
1102033578 12:109758631-109758653 GTGGGGGCAGGGACGGCGGCTGG - Intronic
1102201007 12:111057634-111057656 CTGGCAGAAGGGGAGGCTGCTGG - Intronic
1102345823 12:112160793-112160815 GTGGCCGCTGGGGAGGCAGCGGG + Exonic
1102644652 12:114396237-114396259 CTATCGGCCGGGGAGGCGGCCGG - Intronic
1103462204 12:121113954-121113976 ATGGGGGCAGGGATGGCGGCGGG - Intergenic
1103480361 12:121246668-121246690 AAGGCCACAGGGGAGGCGGCAGG - Intronic
1103595425 12:122022204-122022226 GGGGCGGCCGGGGAGGCGGCTGG - Intronic
1103642552 12:122363643-122363665 TGGGCGTCTGGGGAGGGGGCGGG - Intronic
1103835910 12:123820885-123820907 TTGGCCGCAGGGAAGGGGGATGG + Intronic
1103851070 12:123934092-123934114 TCAGTGGCAGGGGAGGTGGCAGG + Exonic
1103942320 12:124507842-124507864 TTGGAGGCAGGGAAGTCGGTGGG - Intronic
1103969135 12:124658807-124658829 CTGGAGCCAGGGGAGGCAGCGGG + Intergenic
1104347989 12:128020034-128020056 TTGTCAGCAGGGGAGGCGGGGGG + Intergenic
1104691252 12:130828020-130828042 TGGGCTGCTGGGGAGGAGGCTGG - Intronic
1104876656 12:132039555-132039577 TTGGGGGCAGGGCAGGAGACTGG - Intronic
1104950877 12:132439379-132439401 TTGGCGGCAGGGATGGTGGTAGG - Intergenic
1105349449 13:19602257-19602279 CGGGCGGCGGGGGAAGCGGCCGG + Intergenic
1106248723 13:27968546-27968568 TCGGCGGCAGCGGTGGCGGCGGG + Exonic
1108024344 13:46162711-46162733 TTCCCGGAAGGGGTGGCGGCTGG - Intronic
1110558512 13:76886258-76886280 GTGGCGGCGGCGGCGGCGGCGGG - Exonic
1112340580 13:98549656-98549678 TTGGCTGCTGGGGAGGCCTCAGG - Intronic
1112501963 13:99949882-99949904 GTGGCAGGAGGGGAGGAGGCTGG + Intergenic
1112507132 13:99981889-99981911 CAGGCGGCGGCGGAGGCGGCGGG + Exonic
1113460646 13:110479694-110479716 TTGGAGTCGGGGGAGGCGGGAGG + Intronic
1113967898 13:114164887-114164909 CTGGCAGCAGGGCAGGCGGCAGG - Intergenic
1114487540 14:23071780-23071802 CAGGGGGCAGGGGAGGGGGCTGG + Intronic
1117941592 14:60972465-60972487 ATGGCGGCGGCGGCGGCGGCGGG + Exonic
1118366787 14:65102828-65102850 GAGGCGGCAGAGGAGGCTGCTGG + Intergenic
1118610035 14:67532993-67533015 GGGGCGGCAGGGAGGGCGGCGGG - Intronic
1122293545 14:100692660-100692682 TTGGCTGCAGGAGATGGGGCTGG - Intergenic
1122491029 14:102116453-102116475 GTGGCGGCAGGGGCAGCTGCGGG + Intronic
1122635335 14:103127079-103127101 CTGGCGGCGGCGGCGGCGGCGGG + Exonic
1122853459 14:104548733-104548755 GTGGGGGCAGGGCAGGGGGCTGG - Intronic
1122853477 14:104548775-104548797 GTGGGGGCAGGGCAGGGGGCTGG - Intronic
1122853497 14:104548817-104548839 GTGGGGGCAGGGCAGGGGGCTGG - Intronic
1122904820 14:104796767-104796789 CTGGCAGCAGGGGAGGGGGTGGG + Intergenic
1123019651 14:105391684-105391706 TTGGCCGCAGGAGATGCGGACGG - Exonic
1123412560 15:20072680-20072702 TTAGCCCCTGGGGAGGCGGCAGG - Intergenic
1123521902 15:21079793-21079815 TTAGCCCCTGGGGAGGCGGCAGG - Intergenic
1123898062 15:24848230-24848252 GTGGGGGCGGGGGCGGCGGCGGG + Intronic
1124237762 15:28004420-28004442 TGGGCTGCAGGGGAGCCTGCGGG + Intronic
1124469272 15:29968791-29968813 GCGGCGGCGGCGGAGGCGGCGGG - Intronic
1124971127 15:34490501-34490523 GGGGCGGCGGGGGCGGCGGCGGG - Intergenic
1125622387 15:41075454-41075476 TTGGCGGCGGGGGAGGCGGGGGG + Intronic
1126746434 15:51830121-51830143 TCAGCGGGAGGGGAGGGGGCCGG - Intronic
1127117692 15:55743493-55743515 ATTGGGGAAGGGGAGGCGGCCGG + Intergenic
1129201759 15:74006751-74006773 TTGGCCTCAGGTGAGGCTGCAGG + Intronic
1129273942 15:74433441-74433463 CGGGCGCCAGGGGAGGGGGCGGG - Intronic
1129727502 15:77909107-77909129 TCCGTGGCAGGGGAGGCGGGTGG - Intergenic
1130517035 15:84633572-84633594 GTGGCGGCAGCCGAGGGGGCCGG + Intergenic
1130559441 15:84946834-84946856 ATGGGAGCAGGGCAGGCGGCAGG - Intergenic
1131263898 15:90904408-90904430 GGGGTGGGAGGGGAGGCGGCGGG - Intronic
1132055717 15:98649169-98649191 CTGGCCGCGCGGGAGGCGGCCGG - Exonic
1132143587 15:99413755-99413777 TTGGCGGCAGGAGGGGTGGGGGG + Intergenic
1132390923 15:101437526-101437548 ATGGCTGCAGGGGAGGCAGTGGG - Intronic
1132611351 16:817830-817852 TCGGCTGCTGGGGAGGCTGCGGG - Intergenic
1132679782 16:1134970-1134992 ACGGCGGCCAGGGAGGCGGCGGG - Intergenic
1132699207 16:1215135-1215157 CTGGGGGCAGGTGAGGCCGCAGG + Intronic
1132779422 16:1614471-1614493 GGGGCGGCAGGGGCCGCGGCGGG + Intronic
1132874439 16:2130028-2130050 TTGCCGGCAGGGGTGGGGGAAGG - Intronic
1132886649 16:2185156-2185178 TTAGCGGCATGGCTGGCGGCCGG - Exonic
1132889385 16:2196510-2196532 GAGGCGGCGGGGGAGGCGGCCGG - Exonic
1132889390 16:2196522-2196544 GAGGCGGCGGGGGAGGCGGCGGG - Exonic
1133219816 16:4315409-4315431 CGGGCGGCGGGGAAGGCGGCAGG - Exonic
1133304283 16:4800102-4800124 GAGGGGGCAGGGGAGGAGGCTGG + Intronic
1133365673 16:5207208-5207230 TTCTCGGAAGGGGAGGCGGCGGG + Intergenic
1134553384 16:15148861-15148883 TTGCCGGCAGGGGTGGGGGAAGG - Intergenic
1135341101 16:21648686-21648708 TTTGCGGCAGGGGAGGCCATAGG + Intronic
1136021427 16:27442857-27442879 ATGGAGGCAGGGGTGGGGGCAGG + Intronic
1136110709 16:28062603-28062625 TCTGCGGCAGGAGGGGCGGCTGG + Intronic
1138229614 16:55327474-55327496 ATGGCGGCAGGGGAGAGGGAGGG + Intronic
1138491997 16:57382403-57382425 GTGGCGGCAGTGGAGACGGGAGG - Exonic
1139287856 16:65831590-65831612 TTGGAGGCAGTGGAGGAGGGGGG - Intergenic
1139355337 16:66364240-66364262 TTGGGAGCAAGGAAGGCGGCTGG - Intergenic
1139484707 16:67248992-67249014 AGGGCGGCTGGGCAGGCGGCAGG + Exonic
1140221561 16:73047968-73047990 GTGGCGGCAGGGCTGGCGGTCGG + Exonic
1140892244 16:79295084-79295106 TTGGGGGTGGGGGAGGGGGCAGG + Intergenic
1140927580 16:79599192-79599214 GCGGCGGCGGCGGAGGCGGCGGG - Exonic
1141315552 16:82959319-82959341 TTTTTGGCAGGGGAGGGGGCTGG + Intronic
1141440809 16:84028673-84028695 GGGGGGGCAGGGGAGGTGGCGGG - Intronic
1141499367 16:84432992-84433014 TTGGAGGCAGGGGTGGCGGCAGG + Intronic
1141606918 16:85159051-85159073 GTGGGGGCAGGCGAGGAGGCTGG - Intergenic
1141697315 16:85626211-85626233 GTGGAGGCAAGGGAGGGGGCGGG - Intronic
1141784931 16:86193207-86193229 TCCGTGGCAGGGCAGGCGGCCGG + Intergenic
1141849917 16:86638050-86638072 TGGGGGTCAGGGGAGGCTGCTGG + Intergenic
1141926650 16:87174337-87174359 GTGGAGGCAGGGGATGGGGCCGG - Intronic
1142133701 16:88442304-88442326 CTGGCGGGTGGGGAGGCGGTGGG - Intergenic
1142239720 16:88939767-88939789 TTCGCGGCAGGGGAGGAGGCAGG - Exonic
1142299295 16:89247315-89247337 GTGGGGGCAGGGAGGGCGGCGGG + Intergenic
1142348349 16:89568456-89568478 GCGGCCGCAGGGGAGGCGGAAGG + Intergenic
1142403516 16:89873519-89873541 TTGGCGCGAGGGGTGGGGGCAGG - Intergenic
1142759430 17:2034544-2034566 GTGGCAGCAGGGGAGGGGGATGG - Intronic
1142866687 17:2795584-2795606 TTGGCGGCGGGGGTGGGGGGCGG + Intronic
1143176910 17:4960638-4960660 TTGGAGGCTGGGGAGGGTGCTGG - Intronic
1143400795 17:6640702-6640724 ATGGCGACTGGGCAGGCGGCCGG - Exonic
1143543939 17:7585594-7585616 TTGGGGGGAGGAGAGGCGGAGGG - Intronic
1144116340 17:12096074-12096096 TTGGCGGCGGGGGGGGGGGGGGG - Intronic
1144775144 17:17781565-17781587 TTGGCCGCAGGGGAAGGGGCTGG + Intronic
1145939461 17:28735064-28735086 TTAGGGGGAGGGGAGGAGGCAGG - Intronic
1145964343 17:28906375-28906397 TTGGGGGCAGTGGGGCCGGCTGG - Exonic
1146362004 17:32184742-32184764 TTGGAGGCAGAGGTGGAGGCGGG - Intronic
1146928469 17:36761653-36761675 GTGGGGGAAGGGGAGGAGGCAGG - Intergenic
1147187479 17:38720509-38720531 TTGGCGGCAGGCAGGGCAGCAGG - Exonic
1147253149 17:39165563-39165585 ACGGGGGCAGGGGAGGCCGCGGG + Intronic
1147341114 17:39753886-39753908 GTGGCGGAAGGGCGGGCGGCGGG - Intergenic
1147610569 17:41799535-41799557 CTGGCATCAGGGGAGGCGGGAGG + Intergenic
1147644969 17:42028000-42028022 TTGGAGCCAGGGGAGGGGGTTGG - Intronic
1147683920 17:42276044-42276066 TTGGCTGCCGGGGAGGCTGAGGG - Intronic
1148032103 17:44628528-44628550 TGGGAGGCAGGGGCAGCGGCAGG + Intergenic
1148205773 17:45778978-45779000 GGGGCTGCAGGGGAGGGGGCTGG - Intergenic
1148782751 17:50130648-50130670 TGGGCGGCGGGGTGGGCGGCTGG - Intergenic
1150291133 17:63983087-63983109 TTGGCAAGAGGGGAGGTGGCTGG - Intergenic
1150407975 17:64919168-64919190 TGGGCGGCGGCGGCGGCGGCGGG + Intronic
1150778720 17:68101881-68101903 CTGGCGGCTGGGGCGGCGGGCGG - Intergenic
1151221708 17:72617754-72617776 TCGGAGGCAGGGAAGGAGGCAGG - Intergenic
1151268299 17:72973463-72973485 TGGGCTGCAGGGGAGGCTGTAGG + Intronic
1151365074 17:73611813-73611835 TTGGCTGCAGGGGCAGGGGCCGG - Intronic
1151755287 17:76072231-76072253 CTGGGGGCGGGAGAGGCGGCGGG - Intronic
1151787016 17:76280002-76280024 TGGGAGGCAGGGGAGGAGGCTGG - Intronic
1152205830 17:78973974-78973996 CGGGGGCCAGGGGAGGCGGCGGG - Intronic
1153979424 18:10296581-10296603 TTGGGGGCGGGGGCGGAGGCGGG + Intergenic
1154312599 18:13278928-13278950 TTGGCAGCAGAGGAGGCACCTGG + Intronic
1154452627 18:14489544-14489566 CTGGCGGGAGCAGAGGCGGCGGG + Intergenic
1155064776 18:22258835-22258857 TGGGCGGCAGGGGCGGGGGGTGG - Intergenic
1155229057 18:23756433-23756455 GTGGGGGCGGGGGAAGCGGCGGG - Intronic
1155631907 18:27904297-27904319 TTGGTGGCAGTGGAGTAGGCGGG + Intergenic
1156028351 18:32683626-32683648 GTGGGGGCAGGGGAGGCTGAAGG - Intronic
1157553519 18:48597643-48597665 TTGGCTGCTGGGGAGGCTTCAGG - Intronic
1157687029 18:49650945-49650967 CTGCCGGCAGGTGCGGCGGCTGG + Intergenic
1158436006 18:57435853-57435875 GGGGCGGCGGGGGCGGCGGCGGG + Exonic
1158952488 18:62507061-62507083 TTGGGGGCAGGGGCGGGGGTGGG + Intergenic
1160204507 18:76822304-76822326 GTGGGGGCGGGGGCGGCGGCGGG - Intergenic
1160238124 18:77101835-77101857 TTGGCTGCTGGGGAGGTGGTGGG - Intronic
1160402069 18:78618558-78618580 TTGGCAGCAGGTCAGGCTGCGGG - Intergenic
1161591635 19:5131629-5131651 CTGGTGGCGGGGGAGGGGGCAGG + Intronic
1161627682 19:5336783-5336805 TTGGAGGGTGGGGCGGCGGCGGG + Intronic
1161628828 19:5341075-5341097 GTGGCGGCTGCGGCGGCGGCGGG + Intergenic
1161840548 19:6677771-6677793 TGAGCTGCAGGTGAGGCGGCTGG + Exonic
1161849590 19:6731565-6731587 TGGGAGGGAGGGGAGGGGGCTGG + Intronic
1161903197 19:7135165-7135187 CTGGTGGCAGGGGTGGGGGCAGG + Intronic
1162423272 19:10578331-10578353 ATGGAGGCAGGCGTGGCGGCAGG + Intronic
1162555776 19:11384440-11384462 TTGGGGGCAGGGGAGGGAGTTGG + Intronic
1162575291 19:11495637-11495659 TTGGCAGCTGGGGCGGGGGCAGG - Intronic
1162779933 19:13001805-13001827 ATGGCGGCCGGGCAAGCGGCTGG + Intronic
1162967596 19:14163417-14163439 TGGGCGGGAGGGGAGGAGGTAGG + Intronic
1163012176 19:14433272-14433294 TCGGCGCCCGGGGAGGGGGCGGG - Intronic
1163424954 19:17236095-17236117 GGGGCGGGAGGGGAGGCGGGGGG + Intronic
1163608930 19:18291398-18291420 CTGGAGGCAAGGCAGGCGGCAGG + Intergenic
1163851018 19:19663644-19663666 ATGGCGGCAGCGGCGGCGGTGGG - Exonic
1164604839 19:29590368-29590390 TGAGGGGCAAGGGAGGCGGCAGG - Intergenic
1166214667 19:41327494-41327516 TTGGGGGCGGGGGAGGGGGCAGG + Intronic
1166358672 19:42242515-42242537 GCGGCGGCAGCGGCGGCGGCTGG - Exonic
1166534379 19:43563114-43563136 GTGGAGGCAGGGGAGTCAGCAGG - Intronic
1166754072 19:45179732-45179754 CTGGCGGCAGCCCAGGCGGCGGG + Exonic
1166881735 19:45934264-45934286 TGGGGGACAGGGGAGGCTGCAGG - Exonic
1166883009 19:45940368-45940390 TTGGCGGCGGCGGCGGCTGCTGG + Exonic
1167052966 19:47090883-47090905 CTGGAGGCAGGGAAGGGGGCAGG + Intronic
1167119897 19:47510621-47510643 TTGGGGACAGGGGAGGTGGCTGG + Intronic
1167158957 19:47755452-47755474 GCGGCGGCAGAGGCGGCGGCAGG + Exonic
1167174133 19:47853725-47853747 GTGGGGGCTGGGGAGGAGGCTGG + Intergenic
1167272127 19:48511607-48511629 GTGGCGGCTGGGGAGGAGGGGGG + Exonic
1167355961 19:49004301-49004323 CTGGCGGCACGGCGGGCGGCTGG + Exonic
1167412130 19:49350824-49350846 TTGGGGGCGGGGGAGCCGGGAGG - Intronic
1167567803 19:50267810-50267832 TGGGAGGCTGGGGAGGAGGCTGG + Intronic
1167638401 19:50667816-50667838 ATGGGGGCCTGGGAGGCGGCTGG + Exonic
1168102482 19:54148452-54148474 GCGGCGGCAGCGGAGGCGGAGGG + Exonic
1168277103 19:55284390-55284412 ACGGCCGCAGGGGGGGCGGCCGG + Exonic
1168309354 19:55452709-55452731 GTGGCGGCGTGGGGGGCGGCCGG + Intergenic
1168501505 19:56897122-56897144 ATGGCTGCAGGGGAGGCCACAGG + Intergenic
1168558318 19:57362265-57362287 TGGGGGGCAGGGGGCGCGGCGGG - Intergenic
1168719089 19:58545037-58545059 TTGGCGGCGGCGGGGGCCGCGGG - Exonic
925905210 2:8536114-8536136 TTGGGGGAAGGTGAGGCTGCAGG - Intergenic
925929293 2:8694172-8694194 TGGGGGGCAGGGGAGGGGGCTGG + Intergenic
925944395 2:8847172-8847194 TTGGAGGCAGGGGTGGTGGATGG + Intergenic
925959805 2:9003883-9003905 TCGGGGGCGGGGGATGCGGCTGG - Intergenic
925969259 2:9095687-9095709 GTGGTGGCAGGGGTGGTGGCAGG - Intergenic
925969264 2:9095699-9095721 GTGGTGGCAGGGGTGGTGGCAGG - Intergenic
926095826 2:10080230-10080252 TCGGCGGTCCGGGAGGCGGCGGG - Exonic
927510795 2:23642690-23642712 CTGGCGGCGGTGGAGGCAGCAGG - Exonic
927622661 2:24678029-24678051 TTGGGGGCAGGGGTGGCAGGAGG - Intronic
927904749 2:26848373-26848395 CCGGCCGCAGGGGACGCGGCGGG + Intronic
927929160 2:27033092-27033114 CCGGCGGCCGAGGAGGCGGCAGG + Exonic
927964734 2:27262096-27262118 GTGGCGGCAGGCGCGGGGGCCGG + Intronic
928292950 2:30056012-30056034 GTGGAGGCAGGAGAGGCGGCAGG - Intergenic
929430226 2:41880089-41880111 TTGGTGGCAGGGAAGCTGGCTGG - Intergenic
929822966 2:45288166-45288188 TTGGTGGCAGGGGAGGTGAGTGG - Intergenic
930011419 2:46941033-46941055 TCCGCGGCGGGGGCGGCGGCGGG + Intronic
930096964 2:47572233-47572255 TGGGCGGTAGGGCAGGGGGCAGG - Intergenic
930154597 2:48093206-48093228 TTGGGGGAAGAGGAGGAGGCTGG + Intergenic
930170606 2:48247518-48247540 TTGGCGGGTGGGGGGGGGGCGGG + Intergenic
931847491 2:66219667-66219689 TTGTCGGGAGGGGAGTGGGCTGG - Intergenic
932740976 2:74290952-74290974 TTGGTGGCAGGTGAGCTGGCTGG + Intronic
932827930 2:74958680-74958702 ATGGCGGCGGCGGCGGCGGCAGG + Exonic
933248440 2:80001721-80001743 TTGGAGAAAGAGGAGGCGGCCGG + Intronic
934067136 2:88350724-88350746 AAGGCGGCGGGGGAGGCGGCTGG - Intergenic
935463036 2:103361849-103361871 GTGGCGGCGGGGGAGGGGGAGGG - Intergenic
935592557 2:104855611-104855633 GTGGCGGCGGCGGCGGCGGCGGG + Exonic
937083335 2:119155985-119156007 TTGGGAGGAGGGGAGGAGGCGGG - Intergenic
937362516 2:121238948-121238970 CTGGCAGCAGGGGTGGAGGCAGG - Intronic
937907450 2:127059093-127059115 GTGGCGGCAGGGGAGCCATCTGG + Exonic
938296606 2:130182815-130182837 GTGGCGGGCGGGGAGGGGGCAGG + Intronic
938460142 2:131491814-131491836 GTGGCGGGCGGGGAGGGGGCAGG - Intronic
940901668 2:159131514-159131536 GTGGGGGCAGGGGAAGGGGCGGG - Intronic
941906046 2:170716690-170716712 GTGGCGGCGGCGGAGGCAGCAGG - Exonic
942450999 2:176107940-176107962 GTGGCGGCGCGGGTGGCGGCGGG - Exonic
942656609 2:178220295-178220317 TGGGGGGCTGGGGAGGCGGGTGG + Intronic
942970832 2:181956046-181956068 CTGTGGGCAGGGGTGGCGGCGGG - Intronic
943046415 2:182866731-182866753 TGGGCGGCAGGGGCGGTGGCTGG - Exonic
943362903 2:186943533-186943555 TTGGAGGCAGGGCAGGGGGCAGG + Intergenic
943820609 2:192315485-192315507 GTGGCTGCAGGGGCGGCTGCAGG - Intergenic
944414237 2:199467383-199467405 TTGGGGGGAGGGGAGGCTGTTGG - Intronic
945907840 2:215614861-215614883 TCCACGGCTGGGGAGGCGGCAGG - Intergenic
946322244 2:218960850-218960872 CTGGCGGCCGAGGAGGCGGCGGG - Exonic
946325286 2:218981764-218981786 GCGGCGGCAGCGGTGGCGGCGGG + Exonic
946367048 2:219254642-219254664 CTGGCAGCAGGGGAGTGGGCAGG - Intronic
946396216 2:219444960-219444982 TGGGCTGCCCGGGAGGCGGCGGG - Exonic
946863787 2:224024744-224024766 TTGGCAGCAGGGCAGCAGGCGGG - Intronic
947741723 2:232487820-232487842 GCGGCGGCAGAGGAGGCGGCGGG - Exonic
947860458 2:233354386-233354408 TGGCCGGCAGGGGGCGCGGCGGG + Intergenic
948150369 2:235739882-235739904 TGGGCGGCAGTGGAGCTGGCAGG + Intronic
948179500 2:235968530-235968552 TTGGCGTGAGGGGAGGGGGGCGG - Exonic
948393502 2:237628104-237628126 TGTGCGGCATGGGAGGAGGCGGG + Intronic
948805070 2:240450356-240450378 TTGGAGTCAGGGCAGGCTGCAGG + Intronic
949042347 2:241855173-241855195 GTGGAGGCAGGGGAGGCCGAGGG - Intronic
1168788117 20:557190-557212 GTGGGGGCAGGGGAGGCAGTGGG + Intergenic
1169646218 20:7812754-7812776 TTGGGGGAAGGGGAGGCTGTGGG - Intergenic
1170039166 20:12022324-12022346 TGGGAGGCAGGGGAGGAGGGTGG - Intergenic
1170200395 20:13737605-13737627 TTGGTGGCAGTGGTGGTGGCTGG - Intronic
1170304555 20:14923788-14923810 TTGGGGGAGGGGGGGGCGGCGGG + Intronic
1170500787 20:16974200-16974222 GTGGCGGCAGGAGCGGCTGCGGG + Intergenic
1170889856 20:20368027-20368049 TTGGCTCCAGGGGAAGCGGGAGG + Intergenic
1172183425 20:33017111-33017133 TGGGAGCCAGGGGAGGGGGCTGG + Intronic
1172527788 20:35610845-35610867 TCGGGGGCAGGGGCGGCGGGTGG + Intergenic
1173516071 20:43666667-43666689 TTGGAGGCAGGAGAGGAAGCAGG + Intergenic
1173799117 20:45883758-45883780 GTGGCGGCAGGGCAGGTGGAAGG - Exonic
1173853349 20:46232893-46232915 GTGGCTGCATGGGAGGAGGCAGG + Intronic
1174053933 20:47785513-47785535 TTGGGGGGCGGGGAGGAGGCAGG - Intronic
1174441836 20:50561903-50561925 TTGGCGGGGGTGGAGGCGGTGGG - Intronic
1174656392 20:52175855-52175877 TTGGGGGCGGGGGCGGCAGCGGG - Intronic
1175429535 20:58891706-58891728 ATGGCGGCGGCGGCGGCGGCGGG - Intronic
1175825925 20:61936481-61936503 CTGTGGGCAGGGGAGGCGGAGGG - Intronic
1175898922 20:62352370-62352392 ATGGCGGGAGGGGAGGGCGCTGG + Intronic
1175937279 20:62519594-62519616 TTGGAGGAAGTGGAGGCGGAGGG + Intergenic
1176160012 20:63642993-63643015 CTGGTGGGAGGGGAGGCTGCAGG + Intronic
1176173807 20:63708288-63708310 TCGGCGGAGGGTGAGGCGGCGGG + Intronic
1176375856 21:6086627-6086649 TTGGCGGCTGTGGAGGCGAGTGG - Intergenic
1176418973 21:6499179-6499201 TCGACGGCAGCGGCGGCGGCGGG - Intergenic
1176443406 21:6798740-6798762 CTGGCGGGAGCAGAGGCGGCAGG - Intergenic
1176821574 21:13663787-13663809 CTGGCGGGAGCAGAGGCGGCAGG - Intergenic
1178400127 21:32278596-32278618 TGGGCGGCCCGGGAGGAGGCGGG - Intronic
1179304438 21:40141692-40141714 TGGAGGGCAGGGGAGGAGGCAGG + Intronic
1179408979 21:41147607-41147629 TTGGGGGCAGAAGAGGCTGCTGG + Intergenic
1179411474 21:41167128-41167150 TGGGTGCCAGGGGAGGCAGCGGG + Intergenic
1179674907 21:42974751-42974773 CGGGCGGCAGCGGCGGCGGCGGG - Intronic
1179694466 21:43107501-43107523 TCGACGGCAGCGGCGGCGGCGGG - Exonic
1179747618 21:43451617-43451639 TTGGCGGCTGTGGAGGCGAGTGG + Intergenic
1179801967 21:43815339-43815361 TGGGCGGGGCGGGAGGCGGCCGG + Intergenic
1179905160 21:44418807-44418829 TTGGCGGCTGGGGGAGGGGCAGG + Intronic
1180259894 21:46661971-46661993 TGGGGGGCAGGGGAGTAGGCGGG + Intronic
1180801455 22:18633957-18633979 CTGGCGGCGGTGGAGGCAGCAGG + Intergenic
1180852689 22:19029497-19029519 CTGGCGGCGGTGGAGGCAGCAGG + Intergenic
1180945892 22:19693235-19693257 TTGGGGGCAGGGGATGAGGGGGG - Intergenic
1181220266 22:21361304-21361326 CTGGCGGCGGTGGAGGCAGCAGG - Intergenic
1181299185 22:21867418-21867440 ATGGCGGCGGCGGCGGCGGCGGG - Exonic
1181539154 22:23564133-23564155 TTGGTGACAGGGGAGGCGGTGGG - Intergenic
1181579878 22:23822239-23822261 TGGGGGGCAGGGGAGGAAGCTGG + Intronic
1181622146 22:24098410-24098432 TGGGAGCCAGGGGAGGGGGCAGG + Intronic
1182458533 22:30468456-30468478 CTGGGGGCAGGTGAGGCTGCCGG - Intronic
1182586271 22:31345932-31345954 CGGGCGGGAGGGGAGGTGGCAGG - Exonic
1182586361 22:31346207-31346229 GTGGCGGCGGCGGCGGCGGCTGG + Exonic
1182693547 22:32180435-32180457 TAGGTGGCAGGGGATGCAGCAGG - Intergenic
1182762656 22:32735070-32735092 TTGGTGGCAGTGGAGGCAGATGG - Intronic
1183003756 22:34883131-34883153 TCTGGGGCAGGGGAGGGGGCTGG - Intergenic
1183520233 22:38292674-38292696 CTTGGGGAAGGGGAGGCGGCAGG - Intronic
1183606987 22:38871855-38871877 GTCGCGGGAGGGGAGGCAGCGGG - Intronic
1183667892 22:39255736-39255758 CTGGAGGCAGGGGACGGGGCAGG + Intergenic
1183824037 22:40370874-40370896 ATGGGGGCCGGGGACGCGGCGGG + Intronic
1184510371 22:44929866-44929888 CTGGAGGGAGGGGAGGCGACAGG + Intronic
1184641813 22:45876905-45876927 TGGGCTGCAGGCCAGGCGGCTGG - Intergenic
1184671370 22:46013761-46013783 GTGGCGCCTGGGAAGGCGGCCGG - Intergenic
1184673492 22:46027848-46027870 CTGGCGGCAGGGGAAGCTGGGGG - Intergenic
1184737744 22:46409219-46409241 TTGGCTGCAGGGGCGGGGGATGG + Intronic
1184759426 22:46536510-46536532 TCGGCGGCAGGGGCGGCGATGGG + Exonic
1185176905 22:49333025-49333047 CTGGGGGCAAGGGAGGAGGCAGG + Intergenic
1185399120 22:50606858-50606880 TGGGAGGCAGGGGTGGCGCCAGG + Intronic
949892709 3:8745255-8745277 TTGGCTTCAGGTGAGGCCGCAGG - Intronic
952688997 3:36181737-36181759 TTGGCTTCAGGGGAGGCCTCAGG + Intergenic
953052973 3:39362357-39362379 GTGGGGGCAGGGTAGGCGGCAGG + Intergenic
953345229 3:42170073-42170095 TGGGTGGCAGGGGACGAGGCGGG + Intronic
953963395 3:47283406-47283428 ATGGAGGCAGGGGCGGTGGCCGG + Intronic
954186194 3:48918897-48918919 GAAGCGGCAGCGGAGGCGGCGGG - Exonic
954333637 3:49903834-49903856 GGGGCGGCAGGTGAGGCGGCTGG - Intronic
955338197 3:58104316-58104338 TGGGAGGCAGGGGAGGCAGAAGG + Intronic
955515923 3:59726292-59726314 TTGGAGGCTGTGGAGGCTGCAGG - Intergenic
956642818 3:71430812-71430834 GTTGGGGGAGGGGAGGCGGCGGG + Intronic
956678024 3:71753672-71753694 GCGGCGGCAGCGGCGGCGGCGGG + Intronic
957986803 3:87582378-87582400 TTTGCGGCAGGGTAGGAGCCTGG + Intergenic
958893732 3:99807831-99807853 TTGGAGGTAAGGGAGGCTGCTGG - Intergenic
959067785 3:101676232-101676254 CTCGCGGCAGTGGAGGCTGCGGG - Intronic
961186249 3:124917753-124917775 GCGGGGGCGGGGGAGGCGGCAGG + Intronic
961427303 3:126858288-126858310 GTGGTGGCAGGGGCGGGGGCGGG + Intronic
962714599 3:138115533-138115555 TTGGCGGCACTGGAGTGGGCCGG - Exonic
966920841 3:184610508-184610530 TTGGGGGCAGGAGAGACGGTGGG - Intronic
968230913 3:197003863-197003885 ATAGCACCAGGGGAGGCGGCAGG + Intronic
968434075 4:576106-576128 CAGGCGGCGGGGGCGGCGGCGGG - Intergenic
968850580 4:3075029-3075051 GTGGCGGCGGGGGCGGCGGCGGG - Exonic
969338133 4:6523612-6523634 CTGGGGGCAGGTGAAGCGGCAGG + Intronic
969413346 4:7043445-7043467 GTGGCGGCAGCCGCGGCGGCGGG + Exonic
969619089 4:8269948-8269970 ATGGCGGCAGGGCCGGCGGCGGG - Exonic
971577517 4:28294831-28294853 TTGGTGGGTGGGGAGGCGGGAGG + Intergenic
972318518 4:37950561-37950583 GGGGCGGGAGGGGAGGGGGCAGG - Intronic
972632895 4:40857216-40857238 TTGGCTGCTGGGGAGGCGCGTGG + Intronic
973152068 4:46900487-46900509 CTGGTGGCAGGGGAGGAGGGGGG + Intronic
973230830 4:47837482-47837504 CTGGCGGCAGGGGAGGCTGCAGG - Intronic
974501426 4:62709054-62709076 TTGGTGGCAAGGGAGGGTGCTGG + Intergenic
975139144 4:70902513-70902535 TTGGCCGCGGGGCAGGCTGCAGG - Exonic
977177537 4:93834986-93835008 GAGGCGGCAGAGGCGGCGGCGGG + Intergenic
977684880 4:99836379-99836401 TGGTAGTCAGGGGAGGCGGCTGG + Intronic
977941958 4:102868956-102868978 TGGGCGGCGGGCGGGGCGGCGGG - Exonic
978741818 4:112145647-112145669 CTGGCGGAGCGGGAGGCGGCAGG + Exonic
979273051 4:118784736-118784758 TTGGTGGCGGGGGGGGGGGCAGG - Intronic
979283035 4:118888868-118888890 CAGGCGGCTGGGGCGGCGGCTGG + Exonic
982292198 4:153791234-153791256 TGGGCCGCAGGGGACGCCGCGGG - Intergenic
984092867 4:175396180-175396202 TTGGCGGCAGGTGGCGGGGCGGG + Intergenic
984251697 4:177343518-177343540 CTGGGGGCAGGGGAGGGAGCTGG + Intronic
984952028 4:185015028-185015050 TTGGAGGCAGGGGTGGAGGGAGG + Intergenic
985475707 5:77794-77816 ATGACAGCAGGGGAGGCCGCAGG + Intergenic
986703917 5:10439851-10439873 TTGGAGGCAGGGAGGACGGCAGG - Exonic
987087993 5:14487542-14487564 GTGGGGGCAGCGGCGGCGGCGGG + Exonic
989099194 5:37808701-37808723 TGGGGAGCAGGGGAGGCGGGTGG - Intergenic
990825432 5:59893361-59893383 GCGGCGGCGGGGGCGGCGGCAGG + Exonic
993463228 5:88211619-88211641 GTGGCGGCGGGCGCGGCGGCGGG + Intronic
993500550 5:88661214-88661236 GTGGCAGCAGCGAAGGCGGCTGG - Intergenic
994043628 5:95284678-95284700 GTGGCGGCGGCGGCGGCGGCGGG + Intergenic
995530476 5:113087061-113087083 TTGGCGGCAGGGCTGGCACCGGG - Intronic
996690920 5:126338950-126338972 GTGGCGGCAGCGGTGGCGGCTGG - Intergenic
996815334 5:127567526-127567548 TTGGCTCTAGGGGAGGTGGCGGG + Intergenic
996862821 5:128084255-128084277 GCGGCGGCAGCGGCGGCGGCTGG + Exonic
997485169 5:134225485-134225507 TTGGCGCCAGACGAGGTGGCAGG - Intronic
997521268 5:134525852-134525874 GTCGCGGCGAGGGAGGCGGCCGG - Intronic
997754449 5:136383105-136383127 TTGCGGGCAGGGGCGGCGGGAGG - Intronic
997980969 5:138467158-138467180 TTGGCGGCAGGGTAGGCAGGAGG - Exonic
998228573 5:140345180-140345202 TTGGAGGCAGGAGAGCTGGCAGG + Intronic
999773675 5:154793965-154793987 GTCGCGGCCGGGGACGCGGCCGG + Exonic
999998978 5:157119851-157119873 TTGGTGGCAGTGGGGGCTGCTGG - Intronic
1000554458 5:162707707-162707729 TATGCAGTAGGGGAGGCGGCTGG + Intergenic
1001338949 5:170826009-170826031 TTGGCAGCAGTGGAAGTGGCAGG - Intergenic
1001605156 5:172954467-172954489 GTGGGGGCAGGGGCGGCGGGGGG + Intergenic
1001688794 5:173616568-173616590 ATGGCGGCAGGGGCGGTGGTGGG + Exonic
1002541201 5:179907636-179907658 CTGGCGGCGGGGCTGGCGGCGGG - Intronic
1002897859 6:1389750-1389772 CTGGCGGCGGCGGCGGCGGCGGG - Intergenic
1004593973 6:17081144-17081166 TTGGCGGCAGAGGAGATGGCTGG + Intergenic
1006076279 6:31534683-31534705 ATGGCGGCAGCGGAGGCCGCGGG - Intronic
1006078063 6:31547066-31547088 CGGGAGGCAGGGGAGGGGGCGGG - Intronic
1006091146 6:31629718-31629740 TTGGGGGCATGGGTGGGGGCCGG - Exonic
1006183300 6:32166719-32166741 GTGGCGGGAGGTGAGGCGGGAGG + Exonic
1006429366 6:33985619-33985641 TCGGTGGCAGGAGAGGAGGCAGG - Intergenic
1006451677 6:34109142-34109164 TTGCTGGCAGGGGAGGAGGGAGG - Intronic
1006599688 6:35217218-35217240 TTGGCGGGGGGGGGGGGGGCGGG + Intronic
1006634087 6:35449927-35449949 TATGGGGCAGGGGAGGCTGCTGG + Intergenic
1006645396 6:35511783-35511805 TGGGCGGACGGGGAGGCCGCGGG - Exonic
1006860738 6:37170221-37170243 TCGGTGGCAGCGGCGGCGGCGGG + Exonic
1007170264 6:39857855-39857877 TTGGAGGCAGGGGAGGTCTCTGG - Intronic
1007323913 6:41046050-41046072 GTGGGGGTAGGGGTGGCGGCAGG - Intronic
1007600035 6:43075951-43075973 GTGGGGGCAGGGGAAGAGGCGGG - Intergenic
1008644303 6:53497971-53497993 TTGGCGGCAGGGGTGGGGGGTGG - Exonic
1011208031 6:84922570-84922592 TAGGAGGCAGGGCAGGAGGCAGG + Intergenic
1011795332 6:90947095-90947117 GTGGCAGCAGGGGTGGCTGCAGG + Intergenic
1012142207 6:95637346-95637368 TTGGCGGCAGGAGTGGCTGCTGG - Intergenic
1012924937 6:105258281-105258303 TTGGCGGCGGGGGTGGGGGAGGG - Intergenic
1013048665 6:106511724-106511746 TCGGCGTCAGGGGGGGCTGCGGG - Intergenic
1013306161 6:108848644-108848666 CTGGCTGCCGGGGCGGCGGCGGG + Intronic
1013350154 6:109298305-109298327 TTGGTGGGAGGGGAGGTGGCAGG - Intergenic
1013793526 6:113859848-113859870 TCGGGGGCAGCGGCGGCGGCCGG - Exonic
1015251888 6:131135710-131135732 CTGGCGGCAGCGGCGGTGGCGGG - Exonic
1015509562 6:134024311-134024333 TTGGCAGCAGGGCAGGCCGGAGG - Intronic
1017672421 6:156779301-156779323 GCGGCGGCGGGGGCGGCGGCGGG + Exonic
1017764006 6:157592657-157592679 TAGGCGGCAGGAGAGGCCCCAGG - Intronic
1018151781 6:160946400-160946422 TTGGCAGGTGGGGAGGCAGCTGG - Intergenic
1018423964 6:163663512-163663534 CTGGAGGCAGGGGAGGTGGAGGG + Intergenic
1018966194 6:168490928-168490950 CTGGGGGCAGCGGGGGCGGCTGG + Intronic
1019149720 6:169997173-169997195 ATGGGGGCAGGGGAAGCAGCAGG + Intergenic
1019279672 7:193410-193432 CCGGCGGCGGAGGAGGCGGCCGG - Exonic
1019315083 7:380560-380582 AGGGAGGCAGGGGAGGGGGCAGG + Intergenic
1019691897 7:2419867-2419889 GTGGGGGCAGGGGAGGGGGATGG - Intronic
1019705494 7:2495450-2495472 CTGGAGGCAGGGGTGGAGGCAGG + Intergenic
1019974734 7:4572158-4572180 TTGGCTGCAGGTGAGGCCTCAGG + Intergenic
1022090050 7:27102148-27102170 GTGGCGGCGGCGGCGGCGGCCGG + Exonic
1022806154 7:33824496-33824518 TAGGCTGCAGGGTAGGTGGCAGG - Intergenic
1023115878 7:36862040-36862062 TTGGTGGCGGGCGAGGAGGCAGG - Intronic
1023177587 7:37448604-37448626 GGCGCGGCAGGGGAGGGGGCCGG - Intronic
1023278650 7:38547186-38547208 TTAGGGGCAGTGGAGGCTGCTGG - Intronic
1023873211 7:44273755-44273777 TTGGGGGCAGAGGATGAGGCTGG - Intronic
1023972112 7:44999652-44999674 CCGGCGGGAGGGGACGCGGCCGG - Intronic
1025004739 7:55344972-55344994 AGGGCGGCAGGAGAGGCGGGCGG - Intergenic
1028125279 7:87105527-87105549 TTGGCTGCTGGGGAGGCCTCAGG - Intergenic
1029353064 7:100029366-100029388 TTAGTGGCAGGTGAGGCGGGAGG - Intronic
1029524209 7:101085367-101085389 TTGGCGGGAGAGGACGGGGCCGG + Intergenic
1029538062 7:101167275-101167297 ATGGGGGCAGGGGAGGAGGAAGG + Intergenic
1029557858 7:101282797-101282819 CAGGCGGCAGGGAAGGAGGCTGG + Intergenic
1029644374 7:101844181-101844203 TTGGGGGCGGGGGCGGGGGCGGG - Intronic
1032781931 7:135170666-135170688 TGGGCGCCAGGCGAGACGGCAGG - Exonic
1033607201 7:142936231-142936253 GGGCCGGCAGGGGAGGAGGCTGG + Intergenic
1034257253 7:149731424-149731446 GAGGCGGCTGGGGAGGCAGCTGG - Intronic
1034469789 7:151248991-151249013 GGGACGCCAGGGGAGGCGGCGGG + Intronic
1034530423 7:151693004-151693026 TTGGGAGAAGGGGAGGGGGCAGG + Intronic
1034691515 7:153017954-153017976 GTGGCACCAGGGGAGGCGACAGG + Intergenic
1034894848 7:154869844-154869866 TTGGGGGCAGGGGTGGGGGTGGG - Intronic
1035073449 7:156161075-156161097 CTGGCGGGAGGAGAGGCAGCCGG - Intergenic
1035331422 7:158099232-158099254 TGGGAGGAAGGGGAGGCAGCCGG - Intronic
1035331624 7:158099727-158099749 TGGGAGGAAGGGGAGGCAGCCGG - Intronic
1035404223 7:158587700-158587722 ATGGCCGCGCGGGAGGCGGCGGG + Intronic
1035553016 8:544657-544679 TGGGCGGCGGCGGCGGCGGCCGG + Exonic
1036370704 8:8160685-8160707 GTGGGGGCGGGGGAGGCGGGAGG + Intergenic
1036880190 8:12504946-12504968 GTGGGGGCGGGGGAGGCGGGAGG - Intergenic
1037313141 8:17577180-17577202 GGGGACGCAGGGGAGGCGGCGGG - Exonic
1037330072 8:17735599-17735621 TTGCCAGCAGAGGAGGCTGCTGG - Intronic
1037460452 8:19103246-19103268 TTGGCTTCTGGGGAGGCCGCAGG + Intergenic
1037562706 8:20089009-20089031 TTGGGGGCAGGGGTGGGGGCGGG + Intergenic
1037583656 8:20261813-20261835 ATGGCGGCAGAGGAGGAGGAGGG - Intronic
1038447331 8:27612960-27612982 TGGGGGGCAGGGGGGGCGGGGGG + Intronic
1038828550 8:31033180-31033202 GCGGCGGCGGGGGAGGAGGCGGG - Exonic
1038883619 8:31640114-31640136 CTGGCGCCGGGGGCGGCGGCCGG + Intronic
1039839993 8:41286356-41286378 TGTGCGGCGGGGGAGGCGGTGGG - Intronic
1039945416 8:42124727-42124749 TTGGCGGCGGGAGGGGCGGGGGG - Intergenic
1041162417 8:55059023-55059045 TTGGCGGCGGGGCGGGGGGCAGG + Intergenic
1041552677 8:59119253-59119275 GCGGCGGCAGCGGCGGCGGCGGG - Intergenic
1041919785 8:63168757-63168779 ACGGCGGCAGCGGCGGCGGCTGG + Exonic
1042040126 8:64581059-64581081 GTGGCGGCGGCGGCGGCGGCGGG + Exonic
1042076651 8:65002964-65002986 TTGACTGCATGGGATGCGGCGGG - Intergenic
1044091144 8:88003291-88003313 TTGGCAGCAGGGGAAGGGGTGGG - Intergenic
1045224605 8:100232243-100232265 TTGGCTGCGGAGGAGGAGGCTGG + Intronic
1045353161 8:101360851-101360873 TTGCAGGCAGGGGAGTCGGCTGG + Intergenic
1045431958 8:102123335-102123357 GAGGCCGCAGGCGAGGCGGCTGG - Intronic
1045951306 8:107854507-107854529 TGGGGAGCAGGGGAGGGGGCAGG + Intergenic
1047702395 8:127462098-127462120 TTGGAGGCAGGGAAGGAGTCAGG + Intergenic
1048063915 8:130948767-130948789 TTGGGGGCTGGGGAAGCGGGTGG + Intronic
1048971422 8:139647070-139647092 TTGGCGGCAGGGGGCTCTGCAGG + Intronic
1049025264 8:139984097-139984119 TAGGAGGGAGGAGAGGCGGCAGG + Intronic
1049086199 8:140480417-140480439 GTGACGGCAGAGGAGGAGGCAGG - Intergenic
1049665117 8:143839581-143839603 GTGGGCGCAGGAGAGGCGGCTGG + Intronic
1049675089 8:143885747-143885769 ATGGCTGCAGAGGAGGAGGCGGG - Intergenic
1049746961 8:144267087-144267109 GAGGCGGCGGGGGCGGCGGCGGG - Exonic
1049752438 8:144291573-144291595 AGGGCGGCAGCGGCGGCGGCGGG + Intronic
1049941480 9:550196-550218 CTGGGGGGAGGGGAGGCGGTTGG - Intronic
1050653654 9:7799988-7800010 GTGGGGGCGGGGGGGGCGGCGGG - Exonic
1051079558 9:13279236-13279258 GTGGGGGTAGGGGTGGCGGCGGG - Intronic
1052862768 9:33447085-33447107 TGGGAGGCAGGGGAAGTGGCTGG + Intronic
1054407254 9:64773454-64773476 TTGGCGGCGGGGGGGGGGGGGGG + Intergenic
1055757631 9:79572694-79572716 GCCGCGGCAGCGGAGGCGGCCGG - Exonic
1057208110 9:93185098-93185120 TTGGAGGCAGCCGAGGCGCCGGG + Exonic
1057870820 9:98715824-98715846 TAGGTGGCAGGGGATGCAGCAGG - Intergenic
1058332301 9:103778018-103778040 TTGGCTTCAGGGGAGGCTTCAGG - Intergenic
1058851102 9:109013060-109013082 TCGGCAGCAGGGGAGGCTGCGGG - Intronic
1059406818 9:114104644-114104666 TTGGCAGCGGGGGAGGGGGGCGG - Intergenic
1060280803 9:122214244-122214266 TGGGCGGCGGGGGCGGGGGCCGG - Intronic
1060444995 9:123679740-123679762 TAGGCTGCAGGTGAGGCTGCAGG + Intronic
1060540876 9:124429278-124429300 TTCTCGACAGGGGAAGCGGCAGG + Intergenic
1060583375 9:124771075-124771097 CTAGCGGAGGGGGAGGCGGCGGG - Exonic
1061275293 9:129566663-129566685 TTGGTGACAGGGGAGGCGATGGG - Intergenic
1061349576 9:130053894-130053916 TGGGCGGGAGAGGAAGCGGCTGG + Exonic
1061485960 9:130920662-130920684 TTGGCGGCAGGGGAGGCGGCAGG - Intronic
1061828252 9:133275025-133275047 TCGGAGGCTGGGGCGGCGGCCGG + Intronic
1061943296 9:133894359-133894381 CTGGTGACAGGAGAGGCGGCTGG + Intronic
1062192311 9:135254328-135254350 CTGGCCGCAGTGGAGGCAGCAGG - Intergenic
1062349785 9:136133141-136133163 TTAGGGGCAGGGGTGGGGGCAGG - Intergenic
1062630587 9:137461429-137461451 TGGGCGGGAGGGGAGGCCGTGGG + Intronic
1062671327 9:137711636-137711658 TTGGGGCGAGGGGAGTCGGCGGG + Intronic
1062740966 9:138175224-138175246 TGGGTGGCTGGCGAGGCGGCCGG + Intergenic
1203773678 EBV:61501-61523 GTCGCGGCGGGGGCGGCGGCGGG + Intergenic
1203785146 EBV:123447-123469 CTGGGGCCAGGGGAGTCGGCAGG + Intergenic
1203791734 EBV:155300-155322 TGGTCGACAGGGGAGGAGGCCGG - Intergenic
1203525795 Un_GL000213v1:85787-85809 CTGGCGGGAGCAGAGGCGGCAGG + Intergenic
1185881684 X:3746801-3746823 GTGGGGGCTGGGGAGGCGGAGGG + Intergenic
1187916098 X:24153355-24153377 TTTGCCGCAGGGGAGGTTGCAGG + Intronic
1189465789 X:41276604-41276626 TTGGCCCCAGGAGAGGGGGCCGG - Intergenic
1189893959 X:45633735-45633757 GTGGAGGCAGGGGTGGAGGCAGG + Intergenic
1190096212 X:47482999-47483021 GCGGCGGCAGGGGCGGGGGCGGG - Intergenic
1190984424 X:55488522-55488544 GTGGGGGCGGGGGTGGCGGCGGG + Exonic
1190984431 X:55488534-55488556 GTGGCGGCGGGGGCGGGGGCCGG + Exonic
1191727487 X:64296722-64296744 TTGGGGGCGGGGGAGGGGGAAGG - Intronic
1192312817 X:70030563-70030585 TTGGAGGCTGGGGAGGAGGCAGG - Intronic
1192624769 X:72715362-72715384 TCGGCGGCGGGGGAAGCGGGGGG - Intergenic
1195268115 X:103203620-103203642 TTGGCGGGGGGGGGGGGGGCGGG - Intergenic
1196808026 X:119605912-119605934 GGGGCGGCAGCGGCGGCGGCGGG + Intergenic
1199770755 X:150973772-150973794 TTGGTGGCGGGGGAGGGGGGAGG + Intergenic
1199994430 X:153011687-153011709 TTGGAGGCAGAGGCGGAGGCGGG - Intergenic
1200147784 X:153935311-153935333 GTGGGGGCGGGGGAGGGGGCGGG + Exonic
1200165052 X:154030035-154030057 TGGGCGGGAGGGGAGGTGCCTGG + Intronic