ID: 1061485961

View in Genome Browser
Species Human (GRCh38)
Location 9:130920666-130920688
Sequence AGGTTTGGCGGCAGGGGAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 585
Summary {0: 1, 1: 0, 2: 2, 3: 45, 4: 537}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061485961_1061485968 -7 Left 1061485961 9:130920666-130920688 CCGCCTCCCCTGCCGCCAAACCT 0: 1
1: 0
2: 2
3: 45
4: 537
Right 1061485968 9:130920682-130920704 CAAACCTCCTTAAACCAGATAGG No data
1061485961_1061485973 16 Left 1061485961 9:130920666-130920688 CCGCCTCCCCTGCCGCCAAACCT 0: 1
1: 0
2: 2
3: 45
4: 537
Right 1061485973 9:130920705-130920727 CCAGTAGCACCAAGCCACCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061485961 Original CRISPR AGGTTTGGCGGCAGGGGAGG CGG (reversed) Intronic
900187734 1:1340208-1340230 AGGGTTGGGGGCAGGGGCAGGGG - Intronic
900624414 1:3601603-3601625 AGGTTTGGTGACAGGTGAGCTGG - Intronic
900762750 1:4483735-4483757 AGGGTTGGCAGGCGGGGAGGAGG + Intergenic
900945811 1:5830856-5830878 AGGGGTGGAGGGAGGGGAGGGGG - Intergenic
901045535 1:6393518-6393540 AGCCTTGGCGGCCTGGGAGGCGG - Intronic
901474199 1:9478439-9478461 GCGTTTGGGGGCTGGGGAGGGGG - Intergenic
901764240 1:11489805-11489827 AAGCTTGGGGGCAAGGGAGGTGG - Intronic
902457007 1:16540960-16540982 AGGTTTCCAGGGAGGGGAGGGGG - Intergenic
902495163 1:16866954-16866976 AGGTTTCCAGGGAGGGGAGGGGG + Intronic
903804167 1:25992283-25992305 AAGTTGAGAGGCAGGGGAGGAGG + Intronic
903947450 1:26972618-26972640 ATGTCTGGGGGCAGGGGTGGGGG + Intergenic
904022787 1:27480597-27480619 AGGTATGGAGGAAGGAGAGGAGG + Intronic
904105632 1:28079915-28079937 AGGTTTGGGGCCAGGTGTGGTGG - Intronic
904370420 1:30044540-30044562 AGGAATGGCGGGAGGGGAGCTGG - Intergenic
904491682 1:30864388-30864410 AGGCTTGGGGGGTGGGGAGGAGG + Intergenic
904618986 1:31764268-31764290 GGGTTCGGCGGCAGCGGCGGCGG - Intronic
904962755 1:34347724-34347746 AGGTGTGGTGGGTGGGGAGGGGG + Intergenic
905179503 1:36157153-36157175 AGGCCTGGCTGCAGGGGAGGCGG - Intronic
905246177 1:36615545-36615567 AGGTGTGGCCCCAGGGCAGGAGG + Intergenic
905795373 1:40813139-40813161 AAGTTTGGAGGCGGGGGTGGAGG + Intronic
905804430 1:40865516-40865538 AGGTTGGGGTGCAGGGGAGGAGG + Intergenic
906110669 1:43319936-43319958 AGGGCTGTCTGCAGGGGAGGGGG - Intronic
906639579 1:47433603-47433625 AGGGTTGGGGGCGGGGGAGATGG + Intergenic
907438131 1:54462490-54462512 AGCTGGGGGGGCAGGGGAGGGGG - Intergenic
907802869 1:57789184-57789206 ATGCTTGGCGGCAGGGGCGGGGG - Intronic
908330840 1:63069292-63069314 AGGTTTGGAGGCAGTGGATCCGG - Intergenic
908522035 1:64953625-64953647 AGGTTTTGGGGCAGGGCAGTTGG - Intronic
908787156 1:67746523-67746545 AGCTATGGGGGCGGGGGAGGTGG + Intronic
909170016 1:72282883-72282905 AGGCGCGGCGGCGGGGGAGGAGG + Intergenic
909476112 1:76082487-76082509 AGGTTTGTCAGCAGGAGAGTGGG + Intronic
909534236 1:76717819-76717841 AGTTTTGGTGGCAGTGGACGTGG + Intergenic
910906888 1:92190728-92190750 AGTTTTGGCGGGGGGGTAGGGGG + Intergenic
911064275 1:93773741-93773763 AGGTGTGGTGGCTGGGGTGGGGG - Intronic
911348268 1:96722136-96722158 CGGCTTGGCGGCGGGGGATGGGG + Intronic
912468527 1:109890730-109890752 AGGAGTGGGGGAAGGGGAGGAGG - Intergenic
913195842 1:116455332-116455354 AGGGTGGGCGGGAGGGAAGGAGG - Intergenic
915292691 1:154897196-154897218 AGGCTGGGCGGTAGGGGAGGTGG - Intergenic
915333484 1:155127764-155127786 GGGCTTGGGGGCTGGGGAGGTGG - Exonic
915340774 1:155175552-155175574 AGGGGTGGAGGCAGGAGAGGTGG - Exonic
915748225 1:158181471-158181493 AGATCTGGAGGCAGCGGAGGGGG - Exonic
916057307 1:161076594-161076616 AGGTTTGGCAGCAGATGAGTAGG - Intronic
917558945 1:176124398-176124420 GGGCTGGGGGGCAGGGGAGGTGG - Intronic
918455320 1:184705684-184705706 CTATTGGGCGGCAGGGGAGGGGG + Intronic
920639916 1:207742044-207742066 AAGTTTGGCGACAGGGTAGCTGG - Intergenic
921138617 1:212285274-212285296 TGGTGCGGCGGCGGGGGAGGGGG - Intergenic
922470753 1:225875736-225875758 AGTTTTGGGGGTGGGGGAGGGGG - Intronic
922496760 1:226063106-226063128 AGGTTTGGGGTCCGGGGAAGGGG - Intronic
922748902 1:228061720-228061742 AGGCTCTGCGGGAGGGGAGGTGG - Intergenic
923622249 1:235588421-235588443 AAGTATGGAGCCAGGGGAGGAGG - Intronic
923663314 1:235977629-235977651 AGGGTTGGGGGTAGGGGTGGAGG + Exonic
923899775 1:238312950-238312972 AAGTTTGGTGGCTGGGTAGGAGG - Intergenic
923916838 1:238516552-238516574 TGGTTTGGCAGCAGGGAAGTAGG - Intergenic
1062859260 10:797296-797318 AGGTGTGGCTGCAGGGGCAGAGG + Intergenic
1063247906 10:4242237-4242259 AGGTGTTGGGGCAGGGAAGGTGG + Intergenic
1063876960 10:10489897-10489919 AGGTTTGGGGGGAGGGTGGGTGG + Intergenic
1067100674 10:43332074-43332096 GGGTTTAGGGGCAGAGGAGGAGG + Intergenic
1067103834 10:43351657-43351679 AGGTTTGGGGGGTGTGGAGGGGG - Intergenic
1067573251 10:47386869-47386891 AGGTTTGGGGCCAGGTGTGGTGG - Intergenic
1069727345 10:70589244-70589266 TAGTTTGGCGGCAAGGGAAGAGG + Intergenic
1069743715 10:70701752-70701774 GGGGTTGGAGGCCGGGGAGGAGG - Intronic
1069885058 10:71618434-71618456 AGGGGTGAGGGCAGGGGAGGAGG - Intronic
1069997586 10:72352304-72352326 AGATTTAGAGGCAGTGGAGGTGG - Intronic
1071674141 10:87638904-87638926 AGGGTTGGGGGGTGGGGAGGTGG + Intergenic
1072731499 10:97849970-97849992 AGCTTTGGCGGCGGCGGCGGCGG - Intergenic
1072806634 10:98427579-98427601 GGGATTGGGGGCAAGGGAGGGGG - Intronic
1072809968 10:98453850-98453872 AGGTTGTGGGGGAGGGGAGGAGG + Intergenic
1073447253 10:103589122-103589144 AGGTTGCGGGGCAGGGGAGATGG + Intronic
1073460261 10:103661813-103661835 GGGGGTGGAGGCAGGGGAGGGGG + Intronic
1074098726 10:110336239-110336261 AGCTGTGGCGGCAGGGGGTGTGG - Intergenic
1075605377 10:123801522-123801544 TGGGGTGGTGGCAGGGGAGGTGG - Intronic
1075645308 10:124092786-124092808 TCGTTTGGCGGTAGGGGACGGGG - Intronic
1075702027 10:124476061-124476083 AGTTCTGCCGGCAGGTGAGGAGG + Intronic
1076088746 10:127659710-127659732 AGGTTTGGAGCCAGGCGCGGTGG - Intergenic
1076493694 10:130882448-130882470 AGCTTTGGCAGCAGGGAAGCAGG - Intergenic
1076500901 10:130935214-130935236 AGGGTTGCCGGGAGGGGCGGGGG + Intergenic
1076733798 10:132450225-132450247 AGGGTTGGGGGCTGGGGTGGGGG - Intergenic
1077265548 11:1647473-1647495 AGGTTTTGCGGCAGGGAAAGAGG + Intergenic
1078103214 11:8342140-8342162 AGGTGGGGAGGAAGGGGAGGTGG + Intergenic
1078437408 11:11336952-11336974 AGGATTGGGGGCAAAGGAGGAGG + Intronic
1078464712 11:11541677-11541699 AGGTGTGGGGGCTGGGAAGGGGG - Intronic
1079100344 11:17537718-17537740 AGGCTGGGAGGCAGGTGAGGAGG - Intronic
1080801573 11:35615173-35615195 AGGGTTGGAAGCAGGGGAGGAGG - Intergenic
1081568674 11:44276232-44276254 GGGTTGGGGGGCAGGGAAGGAGG - Intronic
1081641193 11:44755586-44755608 TGGTGTGGGGGCAGGGGAGAGGG - Intronic
1081737023 11:45411360-45411382 AGGGTGGGAGGCAGGGCAGGAGG - Intergenic
1082800344 11:57409797-57409819 GGGTTTGGGGGCAGGTGTGGAGG - Intronic
1083228103 11:61297237-61297259 TGGTTTAGGGGCAGTGGAGGGGG - Intergenic
1083300631 11:61738059-61738081 AGGTATGGGGCCAGGGGCGGAGG - Intronic
1083710077 11:64542690-64542712 TGGAAGGGCGGCAGGGGAGGTGG - Intergenic
1083738392 11:64694688-64694710 AGGGTTGGTGGCAGAGTAGGAGG - Intronic
1084126086 11:67099937-67099959 GTGTTTGGAGGCAGAGGAGGCGG + Intergenic
1084327426 11:68409895-68409917 TGGTCTGGCAGCAGGTGAGGAGG - Exonic
1084859125 11:72006769-72006791 AGGTTTGGGAGGAGGGGAGAGGG - Intronic
1085308490 11:75501735-75501757 AGGGCTGGGGGCAGAGGAGGAGG + Intronic
1085641766 11:78197218-78197240 AGGATTTGGGGCGGGGGAGGTGG + Intronic
1086081055 11:82902389-82902411 AGCTGGGGCGGCGGGGGAGGGGG - Intronic
1086211952 11:84331560-84331582 AGGTGGGTCGGCAGGGGAGGTGG + Intronic
1086413847 11:86569387-86569409 TGGATTGGAAGCAGGGGAGGAGG - Intronic
1087114731 11:94512769-94512791 AAGGTTTGGGGCAGGGGAGGTGG + Intergenic
1088111638 11:106268065-106268087 AGATTTGGTGGCAGGGGGAGTGG + Intergenic
1088654471 11:111986328-111986350 GGGGTTGGGTGCAGGGGAGGGGG - Intronic
1088711858 11:112515812-112515834 AGATCTGTGGGCAGGGGAGGGGG - Intergenic
1089916476 11:122161780-122161802 AAGGTTGGAGGGAGGGGAGGTGG - Intergenic
1090080500 11:123609318-123609340 GAGTTTGGGGGAAGGGGAGGAGG - Intronic
1090142123 11:124276615-124276637 TGGTTTGGAGGAAGAGGAGGAGG - Intergenic
1090270736 11:125384322-125384344 AGGTTTGGCGGTGGGGGAATGGG + Intronic
1090515196 11:127417634-127417656 AGGTGTGGGGGCAGGGAAGTAGG - Intergenic
1090709360 11:129372233-129372255 AGGTTTTGGGGCAGAGAAGGAGG + Intergenic
1091550293 12:1530995-1531017 AGGTTCGGCAGCCGGGGCGGCGG - Intronic
1091715183 12:2771804-2771826 ATCTTGGGAGGCAGGGGAGGAGG + Intergenic
1091832279 12:3558112-3558134 GGGTGGGCCGGCAGGGGAGGTGG + Intronic
1094502394 12:31033054-31033076 ATGTTGGAAGGCAGGGGAGGAGG + Intergenic
1094602866 12:31925571-31925593 ACTTTTGGTGGCAGGGCAGGGGG + Intergenic
1094715963 12:33015515-33015537 TGGTGTGGGGGCAGGGGGGGTGG + Intergenic
1094876191 12:34645503-34645525 AGTTTTGGGGTCTGGGGAGGGGG + Intergenic
1095405996 12:41868002-41868024 TGGTTTGGAGGTAGGGGAAGCGG + Intergenic
1095922362 12:47543899-47543921 AGGGCTGGCAGCTGGGGAGGAGG + Intergenic
1096546145 12:52341434-52341456 AGGTTTGGCTACTGGGCAGGGGG + Intergenic
1096590012 12:52651859-52651881 GGATTTGGTGGCAGAGGAGGTGG - Exonic
1096800284 12:54106272-54106294 AGGGTTGGCGGGTGGGGAGAAGG + Intergenic
1096817479 12:54210646-54210668 AGCTCTGGGGGCAGGGCAGGGGG - Intergenic
1096984336 12:55745991-55746013 AGGGTGGGGGGAAGGGGAGGTGG + Intronic
1097110150 12:56652095-56652117 AGGCTGGGCGGCAGGGCAGAGGG + Intergenic
1099004911 12:77224535-77224557 ATGTGTGGCGGCAGGGTTGGGGG - Intergenic
1099955940 12:89352720-89352742 AGGGGAGGCGGCAGCGGAGGAGG + Exonic
1100189828 12:92178525-92178547 AGGTGTGATGGGAGGGGAGGTGG + Intergenic
1100821618 12:98437001-98437023 AGATTTGGTGGCAGGAGTGGAGG + Intergenic
1101703605 12:107198655-107198677 AGGATGTGGGGCAGGGGAGGAGG + Intergenic
1101755814 12:107619943-107619965 AGGGAAGGTGGCAGGGGAGGGGG - Intronic
1102003568 12:109573839-109573861 AGGGGCGGCGGCCGGGGAGGCGG + Exonic
1102021048 12:109683186-109683208 TGTTCTGGGGGCAGGGGAGGAGG + Intergenic
1103173024 12:118838156-118838178 AGGTTTAGGGGCAGGGGAGTAGG - Intergenic
1103857657 12:123984604-123984626 GGGTGTGGGGGCCGGGGAGGAGG + Intronic
1104067356 12:125316867-125316889 AGGTTTGGGAGCAGGGCAGGAGG + Intronic
1104415536 12:128594350-128594372 GGGTTGGGGGGCAGGGGATGGGG - Intronic
1104611823 12:130235101-130235123 AGGTTTGGGGGGCGGGGTGGGGG + Intergenic
1105433210 13:20356390-20356412 CTGTTTGGAGGCAGGGAAGGAGG - Intergenic
1106922665 13:34580271-34580293 ATGTTTGGTGGCGGGGGCGGGGG + Intergenic
1107149245 13:37092404-37092426 AGGAGTGGCTGCAGGGGAAGGGG + Intergenic
1107260442 13:38484159-38484181 TGAGTTGGGGGCAGGGGAGGGGG - Intergenic
1108004601 13:45934288-45934310 AGGTTTGAGGAGAGGGGAGGTGG + Intergenic
1108427113 13:50313468-50313490 TGGTTGGGGGGCAGGGGAGAGGG + Intronic
1108485330 13:50917840-50917862 AGGTTTGGTTCCAGGGAAGGAGG - Intronic
1108707445 13:53002520-53002542 AGGTCTGCAGGAAGGGGAGGAGG + Intergenic
1110380223 13:74841733-74841755 AGGGTTGGAGGCGGGGGCGGGGG - Intergenic
1110672875 13:78203009-78203031 AGGTCTGTGGTCAGGGGAGGAGG - Intergenic
1113522629 13:110951481-110951503 AGGGTTGGCCCCATGGGAGGGGG + Intergenic
1113575812 13:111394638-111394660 AGGCTTGGGGACTGGGGAGGAGG + Intergenic
1114492591 14:23112769-23112791 AGGTTTGAAGGCAGGGCTGGAGG + Intergenic
1114620597 14:24094140-24094162 CGGTTTGGAGGCAGGGGTTGGGG + Exonic
1115024194 14:28721231-28721253 AGGTTAGGTGGGAGGGGAGGAGG + Intergenic
1115658442 14:35466474-35466496 AGTTTGGGAGGCAGGGGACGAGG + Intergenic
1116498930 14:45596816-45596838 AGTTGTGGGGTCAGGGGAGGGGG - Intergenic
1116850817 14:49907132-49907154 AGGTTTTGAGGTAGGGGATGAGG + Intergenic
1116874571 14:50098255-50098277 AGGTTTGGGGGCAGAAGAGAGGG - Intergenic
1117183685 14:53217864-53217886 AGGTGTGGCGGGAGAGGCGGGGG - Intergenic
1117602579 14:57390670-57390692 AGGAGTGGCGGCAGCGGCGGCGG + Exonic
1118137409 14:63045210-63045232 AGGATCCGCGGCGGGGGAGGGGG + Exonic
1118586745 14:67360362-67360384 AGGATCGGCGGCCGGTGAGGGGG + Exonic
1118775583 14:68971990-68972012 AGGGTTGTAGGCAGGGGAAGGGG - Intronic
1118932432 14:70255071-70255093 AGGCATGGCGGGCGGGGAGGGGG - Intergenic
1119285198 14:73447866-73447888 AGGGTTGGGGGTAGGGTAGGGGG - Intronic
1119435443 14:74595144-74595166 GGGTTTGGCGGCTGGAGGGGAGG + Intronic
1119931453 14:78551656-78551678 AGGTGAGGAGGGAGGGGAGGAGG - Intronic
1120993676 14:90398550-90398572 TGGTTTGGCGGGTGGGGAGATGG + Intronic
1121789244 14:96686617-96686639 AGGTGTGGTGGCATGGGAGAAGG + Intergenic
1122057909 14:99117628-99117650 AGGGCTGGCGGCAGGGATGGGGG - Intergenic
1122064248 14:99160417-99160439 AAGTGTGGGGGCTGGGGAGGGGG + Intergenic
1122606147 14:102948445-102948467 GGGTTTGGAGGGAGGTGAGGGGG + Intronic
1122624760 14:103078862-103078884 AGGTGTGGAGGCTGGGGAGCAGG + Intergenic
1122734289 14:103827181-103827203 AGGTGTGGTGGCAGGTGTGGTGG + Intronic
1122812821 14:104297449-104297471 AGGGGTGGGGGTAGGGGAGGGGG - Intergenic
1122853460 14:104548737-104548759 AGGGGTGGGGGCAGGGCAGGGGG - Intronic
1122919833 14:104875439-104875461 AGGTTTGGGGGCAGGAGGGATGG + Intronic
1123148389 14:106156533-106156555 AGTCATGGGGGCAGGGGAGGTGG + Intergenic
1124211469 15:27768374-27768396 GGGTGTGGGGGCAGGAGAGGAGG - Intronic
1124215633 15:27805569-27805591 GGTGTTGGCGGGAGGGGAGGAGG + Intronic
1125622383 15:41075450-41075472 TTTTTTGGCGGCGGGGGAGGCGG + Intronic
1126829692 15:52588626-52588648 ATGGTTGGGGGCAGGGGCGGTGG + Intronic
1129255079 15:74329900-74329922 AGGTGTGGACACAGGGGAGGAGG - Intronic
1129578285 15:76777409-76777431 AGGTTTGAGGCCAGGGGTGGTGG + Intronic
1129706693 15:77798468-77798490 AGGTTTGGGGGGAAGGGAGCGGG - Intronic
1130931078 15:88428434-88428456 AGGGTGGGCTGCAGGGGAGGAGG - Intergenic
1131359005 15:91772672-91772694 GTGTTTGGGGGCGGGGGAGGGGG + Intergenic
1131970540 15:97888218-97888240 AGTTTTGGCAGCAGGGAAAGTGG - Intergenic
1132612243 16:822902-822924 AGGCTTGGCTGCTGCGGAGGTGG + Intergenic
1133328350 16:4956126-4956148 ATGTTGGGCAGCAGGAGAGGCGG + Intronic
1133744514 16:8676078-8676100 AGGTTGGGAGGCAGGAGAGAGGG + Intronic
1134455307 16:14390940-14390962 AGGTTGGGAGGCAGGAGAGGGGG + Intergenic
1135323118 16:21510016-21510038 AGGTGAGGGGGCAGGTGAGGAGG - Intergenic
1135788325 16:25370782-25370804 AGGTGTTGGGGCAAGGGAGGCGG + Intergenic
1136021426 16:27442853-27442875 AGGCATGGAGGCAGGGGTGGGGG + Intronic
1136169815 16:28482207-28482229 AGGGTTGGGGGGAGGAGAGGAGG + Intronic
1136681817 16:31971107-31971129 AGTCATGGGGGCAGGGGAGGTGG - Intergenic
1136690582 16:32025583-32025605 AGGTTTGGGGGGAGGGGAAACGG - Intergenic
1136782124 16:32912609-32912631 AGTCATGGGGGCAGGGGAGGTGG - Intergenic
1136791170 16:32969147-32969169 AGGTTTGGGGGGAGGGGAAACGG - Intergenic
1136878644 16:33884785-33884807 AGGTTTGGGGGGAGGGGAAACGG + Intergenic
1136887664 16:33941243-33941265 AGTCATGGGGGCAGGGGAGGTGG + Intergenic
1137430376 16:48413620-48413642 AGGTGTGGGGGCAGGCGAGTGGG - Intronic
1137435949 16:48454355-48454377 AGGTTTGAGGGAAGGGAAGGAGG - Intergenic
1138067705 16:53959191-53959213 AGGCTGGGAGGCAGGGGAGCTGG + Intronic
1138180061 16:54935149-54935171 AGAGTGGGCGGAAGGGGAGGAGG + Intergenic
1138497507 16:57417103-57417125 CAGTTTGGCGGCAGGGGCGCGGG + Intergenic
1138667707 16:58586282-58586304 AGGTGTGGGGGTGGGGGAGGGGG + Intronic
1139287860 16:65831594-65831616 GGTTTTGGAGGCAGTGGAGGAGG - Intergenic
1140733617 16:77878461-77878483 AGGTTTCGGGGCAGGGGAGGGGG - Intronic
1140767069 16:78169782-78169804 AGGCTGGGAGGCAGGGGCGGTGG + Intronic
1141266123 16:82498778-82498800 AGGTTTGGGGGGAAGGGAGTAGG + Intergenic
1141455341 16:84137497-84137519 AGGTAACGCAGCAGGGGAGGAGG + Intronic
1141602390 16:85134632-85134654 GGGTGTGGCGGGAAGGGAGGAGG - Intergenic
1141624145 16:85252640-85252662 AGCTGTGGCTTCAGGGGAGGAGG + Intergenic
1141658618 16:85429670-85429692 AGGTCTGAGGACAGGGGAGGAGG - Intergenic
1142035315 16:87859038-87859060 AGGTGAGGGGGCAGGTGAGGAGG - Intronic
1142239721 16:88939771-88939793 CGCTTTCGCGGCAGGGGAGGAGG - Exonic
1142271161 16:89090049-89090071 ATGTCTGGGGGCAGGGGTGGGGG + Intronic
1203084787 16_KI270728v1_random:1176595-1176617 AGTCATGGGGGCAGGGGAGGTGG - Intergenic
1203093379 16_KI270728v1_random:1230609-1230631 AGGTTTGGGGGGAGGGGAAACGG - Intergenic
1142571605 17:878403-878425 GGGTTTGGGGGTGGGGGAGGGGG + Intronic
1142571638 17:878476-878498 GGGTGTGGGGGCAGGGGAGGGGG + Intronic
1142571655 17:878513-878535 GGGTTTGGGGGCAGGGGAGGGGG + Intronic
1142572983 17:887301-887323 AGGTTTGGCGGAGGTGCAGGGGG + Intronic
1142810521 17:2393661-2393683 AGGCTCTGCGGCCGGGGAGGAGG + Intronic
1143316780 17:6038841-6038863 AGGTGTGGGGGCAGAGGGGGTGG + Intronic
1143539821 17:7562273-7562295 AGGGCTGGGGGGAGGGGAGGGGG - Intronic
1143954118 17:10655630-10655652 AGGTCAGGCGGGAGAGGAGGTGG - Intronic
1144592902 17:16539845-16539867 AGTTTTGGCGACAGGGTAGCTGG - Intergenic
1144712290 17:17409720-17409742 AGGGCTGGCGGGAGGGGAGGAGG - Intergenic
1145875624 17:28316921-28316943 GGGTTTGGCTGGAGAGGAGGAGG - Intergenic
1145933197 17:28700474-28700496 GGCTATGGCGGCAGTGGAGGCGG + Exonic
1146371182 17:32266308-32266330 AAGTTTGCCGGGCGGGGAGGGGG - Intronic
1147153443 17:38531726-38531748 AGGTTTGGGGGGAGGGGAAACGG - Exonic
1147312710 17:39604879-39604901 AATTTTGGCGGGAGGGGAAGTGG - Exonic
1147644970 17:42028004-42028026 GGGGTTGGAGCCAGGGGAGGGGG - Intronic
1147669655 17:42169722-42169744 GGGTTTGGGAGCTGGGGAGGTGG - Intronic
1148005396 17:44423756-44423778 TGGGGTGGCGGCGGGGGAGGGGG + Intronic
1148577566 17:48722652-48722674 AGGTTTGCGGGGAGGCGAGGAGG - Intergenic
1148664186 17:49362179-49362201 GGGGCGGGCGGCAGGGGAGGGGG + Intronic
1148684029 17:49490722-49490744 AGCTTAGGGGGCAGGAGAGGAGG - Intergenic
1148876482 17:50690329-50690351 GGGATCGGCGGGAGGGGAGGGGG + Intronic
1149387899 17:56159941-56159963 AGGGGTGGGGGCAGGGCAGGAGG + Intronic
1149437266 17:56643920-56643942 AGCTTTGGTGGCAGGGGGTGGGG + Intergenic
1150122538 17:62616235-62616257 AGTTTTGGAGCCAGGGGAAGAGG - Intergenic
1150472513 17:65449137-65449159 AACTTTGGCAGGAGGGGAGGAGG + Intergenic
1150587957 17:66535482-66535504 CTGTTTGGCAGCAGGGGTGGGGG - Intronic
1150602937 17:66666195-66666217 AGGTTTGTCTGTAGGGGAGAAGG - Intronic
1150627218 17:66849298-66849320 GGGGTTGGGGGCAGGGGTGGGGG + Intronic
1150631633 17:66884492-66884514 TGGTTGGGCAGCAGGGGAGAGGG - Intronic
1151013271 17:70526131-70526153 AGGTTGGGAGGCAGGGGATGAGG + Intergenic
1151327893 17:73390240-73390262 AGGCTTGGGGGCAGCTGAGGGGG - Intronic
1151380256 17:73720719-73720741 AGGACAGGCAGCAGGGGAGGAGG - Intergenic
1151384828 17:73748619-73748641 AGGTGTGATGGCGGGGGAGGTGG + Intergenic
1151677409 17:75605769-75605791 TGGTTTGGCTGGAAGGGAGGAGG + Intergenic
1152149170 17:78588411-78588433 TGGATTGGGGGCAGGGGAGTGGG + Intergenic
1152278785 17:79373108-79373130 AGGGGTGACGGCAGGGGAGCAGG + Intronic
1152410514 17:80120450-80120472 AGGTGGGGTGGGAGGGGAGGTGG - Intergenic
1152579309 17:81159052-81159074 AGGGCTGGGGGCAGGGGATGGGG + Intronic
1152579482 17:81159817-81159839 AGGCTGGGGGGCAGGGGAGCTGG - Intronic
1152599155 17:81252805-81252827 AGGGAGGCCGGCAGGGGAGGTGG - Intronic
1152811782 17:82385918-82385940 AGATTTGGCTGAAGGGCAGGGGG - Intergenic
1152856224 17:82666063-82666085 AGGTGTGGTGGCAGGTGCGGTGG - Intronic
1152856230 17:82666087-82666109 AGGTGTGGTGGCAGGTGCGGTGG - Intronic
1152928691 17:83099445-83099467 AGGAATGGCAGGAGGGGAGGGGG - Intergenic
1153130799 18:1853706-1853728 AGCTTTGGGGGGAGGGGATGGGG + Intergenic
1153661747 18:7331908-7331930 GGGTGTGGAGGAAGGGGAGGGGG - Intergenic
1153849168 18:9077273-9077295 AGCTTTGGTGACTGGGGAGGTGG + Intergenic
1154055253 18:11006690-11006712 AGGGAGGGAGGCAGGGGAGGAGG - Intronic
1154428119 18:14287718-14287740 GGGTTTGGAGGTAGGGGAGTGGG + Intergenic
1155064778 18:22258839-22258861 AGGGTGGGCGGCAGGGGCGGGGG - Intergenic
1155724486 18:29062639-29062661 AGGTGTGGAGGTAGGGGAGAGGG - Intergenic
1157785025 18:50474106-50474128 AAGTTGGGCGGCTGGGGAGCAGG - Intergenic
1158119329 18:54030713-54030735 AGGGTTGGGGGGAGGGGATGGGG + Intergenic
1158174338 18:54637357-54637379 AGGTTTAGGGGTTGGGGAGGAGG + Intergenic
1158436769 18:57439787-57439809 AGGTTTGGCGGGAGGGGGGCAGG - Intronic
1158952486 18:62507057-62507079 GGGGTTGGGGGCAGGGGCGGGGG + Intergenic
1158976890 18:62717073-62717095 AGGGTGGGCGGCGGGGGCGGCGG - Exonic
1159102374 18:63970712-63970734 AGCTTGGGCGCCAGGGGAGCAGG - Intronic
1159609525 18:70510383-70510405 AGAATTGGCGGCAGGGGGCGAGG + Intergenic
1159877222 18:73826629-73826651 AGGCTGAGCAGCAGGGGAGGCGG + Intergenic
1160258528 18:77267808-77267830 AGGTTTGTGGCCAGTGGAGGAGG + Intronic
1160590761 18:79943690-79943712 AGGTTTGGGACCAGGAGAGGCGG - Intronic
1161014731 19:1978046-1978068 AGGTGGGGGGGCGGGGGAGGAGG + Intronic
1161365945 19:3879907-3879929 AGGGCTGGGTGCAGGGGAGGCGG - Intronic
1161849589 19:6731561-6731583 AGGGTGGGAGGGAGGGGAGGGGG + Intronic
1162012073 19:7823468-7823490 AGGGGTGGAGGGAGGGGAGGGGG + Intergenic
1162541558 19:11299471-11299493 GGGTTTGGTGGCAGGAGAAGGGG + Intronic
1162967595 19:14163413-14163435 AGAGTGGGCGGGAGGGGAGGAGG + Intronic
1164462578 19:28461692-28461714 AGGTTGGGGGGCTGGGGTGGAGG - Intergenic
1165797584 19:38527883-38527905 AAGTTTTGGGGCAGGGCAGGAGG + Intronic
1165799196 19:38537289-38537311 ATGGTGGGCGGTAGGGGAGGAGG - Intronic
1165876532 19:39011682-39011704 AGAGATGGCGGCGGGGGAGGGGG + Intronic
1165909647 19:39217392-39217414 AGATTTGGCTACAGAGGAGGAGG + Intergenic
1167457744 19:49606548-49606570 AGGTTGGGGGGCGGGGGAGGCGG - Intronic
1167467644 19:49658551-49658573 AGGCTTGGGGGCAAGGGAGGTGG - Exonic
1167568581 19:50272541-50272563 CGGTCTGGAGGCAGGGGTGGGGG - Exonic
1167792323 19:51689938-51689960 ACGTCTGGCTGGAGGGGAGGGGG + Intergenic
925024181 2:594866-594888 CGGGATGGCTGCAGGGGAGGTGG + Intergenic
925533250 2:4887438-4887460 GGGTGTGGCTGGAGGGGAGGAGG + Intergenic
925610573 2:5697514-5697536 AGGGGTGGGGGCTGGGGAGGAGG - Exonic
925969255 2:9095679-9095701 AGGGGTGGTGGCAGGGGTGGTGG - Intergenic
925969260 2:9095691-9095713 AGGGGTGGTGGCAGGGGTGGTGG - Intergenic
926015190 2:9445157-9445179 AGGGTTGGCGGAAGGGAATGGGG - Intronic
926305920 2:11637150-11637172 CGGTATGGAGGAAGGGGAGGAGG + Intronic
926704286 2:15825898-15825920 AGGTTTGTCTCCATGGGAGGGGG + Intergenic
927108123 2:19845021-19845043 AGGCTTGGGGTCAGGGGTGGTGG - Intergenic
927123461 2:19990377-19990399 AGGTGTGGCGGGAGGGAGGGCGG - Intergenic
927515807 2:23671011-23671033 AGGTTAGGAGGGAAGGGAGGAGG - Intronic
929484103 2:42339525-42339547 AGGAATGGTGGCAGGAGAGGAGG - Intronic
929983110 2:46699225-46699247 AGGGGAGGCGGCAGGGAAGGGGG + Intronic
931090457 2:58880538-58880560 AGGGTGGGAGGCAGGGAAGGAGG + Intergenic
931464645 2:62475590-62475612 GGGCTTGGCAGCAGGGCAGGAGG - Intergenic
931847492 2:66219671-66219693 AGATTTGTCGGGAGGGGAGTGGG - Intergenic
932457834 2:71860917-71860939 GGGTCTGTAGGCAGGGGAGGAGG + Intergenic
932467590 2:71933493-71933515 AGGTTTGGGGGAAGGGCAGGAGG + Intergenic
934567901 2:95350691-95350713 AGGAGTGGTGGCAGTGGAGGTGG + Intronic
934649409 2:96082405-96082427 AGGTCTATCTGCAGGGGAGGAGG + Intergenic
935151410 2:100440023-100440045 AGGTGTGGAGGCGGGAGAGGAGG - Intergenic
936462327 2:112722598-112722620 AGGGTTGGGGGCACGGGAGGTGG + Intronic
937198289 2:120179885-120179907 AGGATGGGCAGCAGTGGAGGTGG + Intergenic
939630269 2:144520473-144520495 AGGCTTGACGGGCGGGGAGGGGG - Intronic
939951672 2:148482850-148482872 AGTTGTGGTGGCAGGAGAGGTGG - Intronic
940362717 2:152813396-152813418 AGGTTTGTCCTCAGGGGTGGGGG + Intergenic
940365388 2:152843410-152843432 AGGTAAGGAGGCAGGAGAGGTGG - Intergenic
940734117 2:157429734-157429756 AAGTTTGGGGCCAGGGGCGGTGG + Intronic
942246745 2:174014892-174014914 AGGTGTGGGGGCAGGGGCTGTGG + Intergenic
942445149 2:176072662-176072684 AGGCTTTGCGGAAGGGCAGGAGG - Intergenic
942456627 2:176142608-176142630 AGGGTTGGGGGGAGTGGAGGTGG - Intergenic
942568000 2:177285564-177285586 AGGTTTGGTGGAGGGGAAGGTGG - Intronic
943046417 2:182866735-182866757 AGCCTGGGCGGCAGGGGCGGTGG - Exonic
943060632 2:183038412-183038434 AGGTGTGGCGGCGGCGGCGGCGG + Exonic
944060109 2:195563226-195563248 AGGTGTGGGGGCGGGGGATGGGG - Intergenic
944183759 2:196926174-196926196 AGGATTTGGGGCTGGGGAGGAGG + Intronic
944734061 2:202545208-202545230 AGGTGTGTGGGGAGGGGAGGGGG - Intronic
945018582 2:205547653-205547675 AGAATTGGTGGCAGGAGAGGTGG - Intronic
945765234 2:213968343-213968365 AGGTGTGGTGGCAGGTGTGGTGG - Intronic
945808234 2:214516309-214516331 AGCTTAGGAGGCAGGGGATGAGG - Intronic
946217758 2:218198882-218198904 AAGTCTGGCTGAAGGGGAGGAGG - Intergenic
946238617 2:218340691-218340713 AGGTTTGGAGACTGGGGAGCAGG - Intronic
946337569 2:219048847-219048869 GGGTTGGGTGGCAGGGGCGGTGG - Intergenic
946367049 2:219254646-219254668 AGTTCTGGCAGCAGGGGAGTGGG - Intronic
947524204 2:230868633-230868655 AGGTATGCAGGCTGGGGAGGGGG - Intronic
948546907 2:238739122-238739144 AGGTTTGGCTCCATGGGAGACGG - Intergenic
948653995 2:239465458-239465480 GGGTTTGGCTGAAGGGAAGGAGG - Intergenic
1169309072 20:4519776-4519798 GGCTTTGGCGGCAGTTGAGGTGG + Intergenic
1169444396 20:5659297-5659319 AGGGTTGGGGGTGGGGGAGGTGG + Intergenic
1169607325 20:7337157-7337179 AGGATTAGAGGAAGGGGAGGTGG - Intergenic
1169758730 20:9068749-9068771 AGGCTCGGGGGCAGGGGAGGAGG + Intronic
1170200396 20:13737609-13737631 AGTTTTGGTGGCAGTGGTGGTGG - Intronic
1170830783 20:19838888-19838910 AGGTTTGGGGGCTGGAGAGGAGG - Intergenic
1171412581 20:24956995-24957017 AGGTGAGGGGGCAGGTGAGGGGG + Intronic
1171412604 20:24957061-24957083 AGGTGAGGGGGCAGGTGAGGGGG + Intronic
1171796166 20:29568069-29568091 AGGGTTGGCGGGTGGGGAGAAGG - Intergenic
1172014200 20:31863310-31863332 AGATTTGGAGGATGGGGAGGAGG + Intronic
1172519971 20:35560049-35560071 AGGGCTGGAGGCAGGGGCGGAGG + Intergenic
1172527786 20:35610841-35610863 AGGGTCGGGGGCAGGGGCGGCGG + Intergenic
1172671964 20:36640880-36640902 AGCTCTGGGGGCTGGGGAGGTGG + Intronic
1172889379 20:38253147-38253169 ACCTTGGGCTGCAGGGGAGGGGG - Intronic
1172935499 20:38617161-38617183 TGGTTTGGCTGCTGGAGAGGAGG + Intronic
1173534435 20:43798600-43798622 AGGACTGGGGGCAGGGGAGAAGG + Intergenic
1173536816 20:43821095-43821117 GGGTTTGGCGGTTGGGGAGGAGG + Intergenic
1173759059 20:45543803-45543825 GGGTTCTGCGGCAGGAGAGGAGG - Intronic
1173799118 20:45883762-45883784 GGATGTGGCGGCAGGGCAGGTGG - Exonic
1174020261 20:47524360-47524382 AAGTTTGGCGACAGGGTAGCTGG + Intronic
1174838807 20:53882385-53882407 GGGTTGGGTGGCAGGGGAGAGGG - Intergenic
1175168637 20:57064112-57064134 AGTTTTGGGGGCAGGGGTGAAGG - Intergenic
1175825870 20:61936364-61936386 GGGTGTGGGGGAAGGGGAGGGGG - Intronic
1175892334 20:62321311-62321333 AGGTGTGGGGCCAGTGGAGGAGG + Intronic
1176379971 21:6107518-6107540 AGGTCGGACGGCGGGGGAGGGGG - Intergenic
1176548930 21:8213333-8213355 AGGAGGGGCGGCGGGGGAGGAGG - Intergenic
1176567859 21:8396366-8396388 AGGAGGGGCGGCGGGGGAGGAGG - Intergenic
1178305809 21:31489357-31489379 AGGTTGGGGGGGAGAGGAGGAGG + Intronic
1178474612 21:32926550-32926572 AGGCATGGCGGCGGGGGAGGAGG + Intergenic
1178480037 21:32971755-32971777 AGGATGGGCGGGAGAGGAGGTGG + Intergenic
1178922869 21:36750469-36750491 AGGAGTGGGGGCAAGGGAGGCGG - Intergenic
1179145942 21:38767553-38767575 TGGCTTGTGGGCAGGGGAGGAGG - Intergenic
1179709967 21:43207705-43207727 AGTTTTGGCAACAGGGGAAGGGG - Intergenic
1179714606 21:43280583-43280605 AGGTGGAGGGGCAGGGGAGGTGG + Intergenic
1179743503 21:43430720-43430742 AGGTCGGACGGCGGGGGAGGGGG + Intergenic
1180633784 22:17248191-17248213 ACGTTTGCTGGCAGGGGATGAGG + Intergenic
1180945896 22:19693239-19693261 GGGGTTGGGGGCAGGGGATGAGG - Intergenic
1181270946 22:21658095-21658117 AGCTTTGGGGGCCGGGGATGGGG + Intronic
1181831679 22:25565011-25565033 AGCTTTGGCGGCGGCGGCGGCGG - Exonic
1182218778 22:28741866-28741888 TGGTCCGGCGGCAGGGGAGGGGG - Intronic
1182317721 22:29459083-29459105 AGGTTTGGAGGGTGGGGAGGAGG - Intergenic
1182443057 22:30375330-30375352 AGGTTGGGGGACAGGGAAGGGGG + Intronic
1182801496 22:33035334-33035356 AAGTTTGGTGGCGGGGGGGGGGG - Intronic
1182860664 22:33556597-33556619 AGGTAGGGAGGCAGGGAAGGAGG + Intronic
1183430642 22:37763479-37763501 AGGTGTGGCTGCTGGAGAGGCGG + Intronic
1183665547 22:39244029-39244051 AGGGTGGGGGGCTGGGGAGGGGG + Exonic
1183785567 22:40027346-40027368 TGGTTTGCTGGCAGGTGAGGTGG - Intronic
1184114610 22:42415253-42415275 AGGTGTAGGTGCAGGGGAGGTGG - Intronic
1184264388 22:43339269-43339291 AGGTGTGGCCCCAGGGCAGGTGG + Intronic
1184786557 22:46674771-46674793 CTGTGTGGCTGCAGGGGAGGGGG + Intronic
1185076786 22:48687431-48687453 TGGATTGGTGGCAGGGGTGGGGG + Intronic
1185255056 22:49827368-49827390 ATGTTTGGCGGCGGCGGCGGCGG - Intronic
949752498 3:7370706-7370728 AGGTCTGAAGGCAGGGAAGGAGG - Intronic
950056170 3:10026511-10026533 AGATTAGGCCGCAGGGGAGCGGG - Intronic
950094964 3:10323717-10323739 AGGTTTGGGGGCAAGGGGTGGGG - Intergenic
950425598 3:12923301-12923323 AGGAATGGCTGCAGGGGATGGGG + Intronic
950482128 3:13250803-13250825 AGGGGTGGCAGCAGGGGTGGGGG - Intergenic
952337895 3:32420781-32420803 GGGTCTGGGGGCAGGAGAGGGGG + Intronic
953295352 3:41710419-41710441 ATGGCTGGGGGCAGGGGAGGGGG - Intronic
953345227 3:42170069-42170091 AGCTTGGGTGGCAGGGGACGAGG + Intronic
953561387 3:43995841-43995863 AGGTGTGGCCGCGGGGGAGGGGG + Intergenic
954411813 3:50374234-50374256 AGGGTGGGGGGAAGGGGAGGGGG + Intronic
954479868 3:50788787-50788809 AGGGAGGGAGGCAGGGGAGGGGG + Intronic
954795068 3:53157150-53157172 ATGTTTGGGGGCAGGGGCAGAGG + Intronic
956144948 3:66182966-66182988 AGGTTGGACAGCAGGGGATGCGG + Intronic
959681297 3:109099670-109099692 AGGTTTGGCTGCAGGGGAAAGGG + Intronic
961001180 3:123375104-123375126 AGGGCTGGGGGCAGGGGTGGAGG - Intronic
961369157 3:126419049-126419071 GGGTTGGGCGGCGGGGGAGGAGG - Intronic
961537702 3:127580076-127580098 ATGTTTGGTGCCAGGGGTGGGGG + Exonic
962150532 3:132888483-132888505 GGGCTTGTCGGCAGGGGTGGGGG + Intergenic
962319508 3:134378638-134378660 AGGTTGGGGGTGAGGGGAGGGGG + Intergenic
962357339 3:134706024-134706046 AGGTTTGGTGGTGGTGGAGGGGG + Intronic
962971009 3:140402017-140402039 AGGGGTGGCGGCGGGGGAGTGGG + Intronic
963247073 3:143073510-143073532 AGGCTTCGCGGCAGTGGGGGTGG + Intergenic
964376363 3:156052204-156052226 AGGTGGGGTGGCGGGGGAGGAGG - Intronic
964376373 3:156052224-156052246 GGGTGGGGTGGCAGGGGAGGAGG - Intronic
964386694 3:156155206-156155228 AGGGGTGGTGGCAGGGCAGGGGG - Intronic
964829690 3:160870120-160870142 GGGTGTGGGGGTAGGGGAGGAGG + Intronic
965463624 3:168999998-169000020 GGGTTTGGGGGGAGAGGAGGAGG + Intergenic
965473886 3:169130454-169130476 AGGGCTGGCGGCGGGGGCGGGGG - Intronic
965937333 3:174130413-174130435 AGGTTTGGAGGCATGGGGTGAGG - Intronic
966422293 3:179745545-179745567 AGGTTGGGAGGAAGGGAAGGAGG - Intronic
968879170 4:3290382-3290404 AGGGTGGGTGGCAGGGGCGGGGG - Intergenic
969411331 4:7030198-7030220 AGGGTTGGAGGCAGTGGAAGTGG + Intronic
969989164 4:11242698-11242720 GGGTTTGTCGGTGGGGGAGGGGG + Intergenic
972279115 4:37585635-37585657 AGGTGTTGAGGGAGGGGAGGAGG + Intronic
972913678 4:43849546-43849568 AAGTTGGGTGGCAGGGAAGGGGG - Intergenic
973152064 4:46900483-46900505 AGAACTGGTGGCAGGGGAGGAGG + Intronic
973814571 4:54607353-54607375 GGCTTTGGAGGCTGGGGAGGAGG - Intergenic
974993563 4:69125005-69125027 AGGATAGAGGGCAGGGGAGGAGG + Intronic
975616898 4:76256044-76256066 AGGGTTGGGGGTAGGGGAAGTGG - Intronic
976215822 4:82714578-82714600 TGGTTTGGCTCCAGGGCAGGGGG + Intronic
977694208 4:99949220-99949242 AGGTTTGGGGGGCGGGGAGGCGG - Intronic
978159515 4:105529118-105529140 AGGGTGGGGGGCGGGGGAGGTGG + Intergenic
980920855 4:139084238-139084260 AGCAGCGGCGGCAGGGGAGGAGG + Intronic
982128653 4:152206669-152206691 GGGATTAGGGGCAGGGGAGGAGG + Intergenic
982422110 4:155209684-155209706 AGGAATGGGGGCAGGGGAGGGGG - Intronic
982682849 4:158452860-158452882 AGGGTTGTGGGCAGGGCAGGGGG - Intronic
984206543 4:176793053-176793075 AGGTGGGGCCGCCGGGGAGGAGG - Intergenic
985891027 5:2715338-2715360 AGGATGGGCGGCAGTGGAGAAGG - Intergenic
986733007 5:10649149-10649171 AGGCTTGGGGCCAGGGGTGGGGG + Intronic
987282618 5:16426215-16426237 AGCTGTGGTGGCAGGAGAGGGGG + Intergenic
987759110 5:22136180-22136202 AGGTGTGGTGGAAGGAGAGGAGG + Intronic
988612147 5:32736780-32736802 AGGTTTCGTGGGAGAGGAGGAGG + Intronic
991414053 5:66373365-66373387 AAGTTTAGCAGCAGGGGAGGGGG - Intergenic
991893822 5:71369626-71369648 AGGTGTGGTGGAAGGAGAGGAGG + Intergenic
992380197 5:76229047-76229069 CGTTTTGTGGGCAGGGGAGGAGG - Intronic
993168682 5:84387755-84387777 AAATTTGGGCGCAGGGGAGGGGG - Intergenic
993970841 5:94418469-94418491 AAGTGTGGGGGCAGGGGTGGGGG - Intronic
995620309 5:114018924-114018946 TTGTTTAGCGGAAGGGGAGGGGG + Intergenic
996024142 5:118624905-118624927 TGGTGTGGCAGGAGGGGAGGTGG + Intergenic
996112915 5:119585979-119586001 AGGGTTGGGGGAAAGGGAGGTGG - Intronic
997329735 5:133051538-133051560 AGGTTGGCCGGTAGGGGAGAAGG - Intergenic
997411676 5:133695766-133695788 TGGTTTGCAGGGAGGGGAGGGGG - Intergenic
998228572 5:140345176-140345198 AGGTTTGGAGGCAGGAGAGCTGG + Intronic
999812203 5:155138208-155138230 ATGATGGGGGGCAGGGGAGGAGG + Intergenic
1000685075 5:164238491-164238513 AGATTTGGGGGCGGGGGGGGGGG - Intergenic
1001530367 5:172456921-172456943 AGGTTGGGGGGCAGTGGGGGGGG - Intergenic
1001764608 5:174235566-174235588 AGTGATGGGGGCAGGGGAGGTGG - Intronic
1002422984 5:179159293-179159315 AGGGTCCGTGGCAGGGGAGGCGG + Intronic
1002590869 5:180291310-180291332 AGGCTGGGCGGGTGGGGAGGGGG + Intronic
1002914108 6:1515337-1515359 AGCAGCGGCGGCAGGGGAGGAGG + Intergenic
1002914120 6:1515404-1515426 AGCAGCGGCGGCAGGGGAGGAGG + Intergenic
1003907581 6:10716433-10716455 TTTCTTGGCGGCAGGGGAGGGGG + Intergenic
1005994536 6:30923299-30923321 AGGAAAGGAGGCAGGGGAGGGGG + Intronic
1006026667 6:31151343-31151365 AGGGTTGGTGGCAGTGGAGACGG - Intronic
1006898839 6:37487012-37487034 GGGTTGGGGGGCAGGGGACGGGG + Intronic
1007080776 6:39102164-39102186 AGCTTTGCGGGAAGGGGAGGTGG - Intergenic
1007753926 6:44086693-44086715 AGGTGTGGTGGCAGGGGAGAGGG + Intergenic
1008644305 6:53497975-53497997 AAAGTTGGCGGCAGGGGTGGGGG - Exonic
1010209595 6:73352585-73352607 AGGGGTGGGGGCGGGGGAGGGGG + Intergenic
1011226822 6:85117079-85117101 ATGTTGGGGAGCAGGGGAGGTGG - Intergenic
1013104042 6:107011169-107011191 AGGTCTGGAGGGAGGGGAGGAGG + Intergenic
1013173704 6:107659876-107659898 AAATTTGGGGGCAGGGGAAGGGG + Exonic
1013268480 6:108523309-108523331 AGAGTTGGCGGCAAGGGCGGGGG - Exonic
1013350155 6:109298309-109298331 AGGCTTGGTGGGAGGGGAGGTGG - Intergenic
1013874451 6:114806289-114806311 AGGTGTGGGAGGAGGGGAGGAGG - Intergenic
1014001696 6:116371559-116371581 CCATTTGGGGGCAGGGGAGGTGG + Intronic
1014144159 6:117978281-117978303 AGGGTGGGGGCCAGGGGAGGGGG - Intronic
1016850125 6:148610550-148610572 AGATTAGGCTGCAGGGGTGGAGG - Intergenic
1017022625 6:150152582-150152604 GGGAGTGGGGGCAGGGGAGGGGG - Intronic
1017717415 6:157222467-157222489 ACGTTTGGCAGCGGGAGAGGTGG - Intergenic
1017776942 6:157688061-157688083 AGGCTTGGGCACAGGGGAGGTGG - Intergenic
1017914222 6:158819217-158819239 GGGTTCGGCGGCAGGTGCGGCGG - Intronic
1018423961 6:163663508-163663530 AGGCCTGGAGGCAGGGGAGGTGG + Intergenic
1018823554 6:167392896-167392918 AGGTTTGGTACCAGGTGAGGGGG - Intergenic
1019296636 7:280415-280437 AGTTTGGGCGGCGGGGAAGGGGG - Intergenic
1019691898 7:2419871-2419893 GGTTGTGGGGGCAGGGGAGGGGG - Intronic
1019777842 7:2923105-2923127 GGGGATGGCGGCAAGGGAGGTGG - Intronic
1019929070 7:4211426-4211448 GGGTGCGGGGGCAGGGGAGGAGG + Intronic
1020189707 7:5986039-5986061 GGGATCGGCGCCAGGGGAGGTGG - Intronic
1020293213 7:6738629-6738651 GGGATCGGCGCCAGGGGAGGTGG + Intergenic
1021083478 7:16391172-16391194 AGGTTTGGAGGCTGTGGAGTGGG - Intronic
1021841425 7:24724565-24724587 AAGTCTGGAGGCAGGGGAAGGGG + Intronic
1022742203 7:33133415-33133437 AGGTCTGGGGGTAGGGGAGAAGG - Intronic
1023115879 7:36862044-36862066 AGTTTTGGTGGCGGGCGAGGAGG - Intronic
1023299857 7:38758736-38758758 AGGTTGTGGGGCAGGGGTGGGGG - Intronic
1023843195 7:44107934-44107956 AGGATGGGGGGCAGGAGAGGAGG + Intronic
1023866067 7:44238987-44239009 GGGTTTGAGGCCAGGGGAGGAGG + Intronic
1023981579 7:45073626-45073648 AGGATGGGGGGAAGGGGAGGAGG + Intronic
1026846236 7:73700518-73700540 AGTGTTGGCGGCAGGTGGGGTGG + Intronic
1027308983 7:76934620-76934642 AGCTGTGGAGGCAGGGGATGAGG - Intergenic
1027829470 7:83159934-83159956 TGGTTTGTGGGCAGAGGAGGTGG + Intronic
1028244358 7:88459121-88459143 AGGTTTTGAGGAAGTGGAGGTGG - Intergenic
1028696482 7:93719245-93719267 AGTTTTGGAGGAAGGAGAGGTGG - Intronic
1029538061 7:101167271-101167293 AGAGATGGGGGCAGGGGAGGAGG + Intergenic
1031937777 7:127753480-127753502 ATCTTTGGTGGCAGGGGAAGAGG - Intronic
1034117631 7:148598173-148598195 AGGGGTGGGGGCAGGAGAGGAGG - Intronic
1034299866 7:150006037-150006059 AGGTTTCTAAGCAGGGGAGGTGG + Intergenic
1034806181 7:154091267-154091289 AGGTTTCTAAGCAGGGGAGGCGG - Intronic
1034994795 7:155570901-155570923 AGGTTTAGGGGCGGGGGTGGGGG - Intergenic
1035262528 7:157671109-157671131 AGGTCTGTGGGCAGGGGACGGGG - Intronic
1036010230 8:4713709-4713731 AGGTTTGGGGTTTGGGGAGGAGG - Intronic
1037546313 8:19926890-19926912 ACAGTTGGAGGCAGGGGAGGGGG + Intronic
1037562704 8:20089005-20089027 GGATTTGGGGGCAGGGGTGGGGG + Intergenic
1037783290 8:21886071-21886093 AGGTGTGGGGACTGGGGAGGAGG - Intergenic
1037817531 8:22120014-22120036 GGGGTTGGGGGCAGAGGAGGAGG + Intronic
1037995521 8:23349547-23349569 CTATTTGGGGGCAGGGGAGGGGG - Intronic
1038503789 8:28067157-28067179 AGGTTTGGGGGCAGTAGGGGTGG - Intronic
1041039692 8:53834762-53834784 ATATTTGGGGTCAGGGGAGGAGG - Intronic
1042743346 8:72075828-72075850 AGGTTGGGGGGCAGGGCAAGGGG - Intronic
1043837882 8:85066139-85066161 GGGTTTGGCACCAAGGGAGGGGG - Intergenic
1044704842 8:94998702-94998724 AGGTCAGGTGGAAGGGGAGGTGG + Intronic
1044861690 8:96530012-96530034 AGATTTAGTGGCAGGGGCGGGGG + Intronic
1044999705 8:97869036-97869058 AGGGCGGGCGGCTGGGGAGGCGG - Intronic
1046612656 8:116443068-116443090 AAATTTGGAGGCAGGGGAGTGGG + Intergenic
1046954182 8:120046356-120046378 AGGGTTGGGAGCAGGGGTGGTGG - Intronic
1047361319 8:124171997-124172019 AGTTTGGGCGGCGGGGGGGGGGG + Intergenic
1048680351 8:136834106-136834128 AGGTTTGGAGGCAGGAGAGTGGG - Intergenic
1048882467 8:138882128-138882150 AGGTTTGGAGCTCGGGGAGGAGG - Intronic
1049469539 8:142769219-142769241 AGGGTTGGGGGATGGGGAGGGGG + Intronic
1050653603 9:7799657-7799679 AGGTTTGGCGGGCGCGGCGGCGG + Exonic
1050711807 9:8474088-8474110 AGGTTCATGGGCAGGGGAGGAGG - Intronic
1053404453 9:37859943-37859965 AGGAATGACGGCATGGGAGGTGG + Intronic
1054155288 9:61635402-61635424 AGGGTTGGCGGGTGGGGAGAAGG - Intergenic
1054475077 9:65566510-65566532 AGGGTTGGCGGGTGGGGAGAAGG - Intergenic
1055792488 9:79937666-79937688 AGGTTTGGAGGCTGGGGATGTGG - Intergenic
1056037048 9:82617908-82617930 AGGCTTGGCGTCAAGGAAGGAGG + Intergenic
1056969516 9:91190847-91190869 AGGTTGCGGGGCAGGGGTGGGGG + Intergenic
1058324225 9:103675475-103675497 AGGTCTGATGGCAGTGGAGGTGG - Intergenic
1058997689 9:110315826-110315848 TTTTTTGGCGGCAGGGGAGGGGG + Intronic
1060700052 9:125743053-125743075 AGGTCTCAAGGCAGGGGAGGAGG - Intergenic
1060732538 9:126047752-126047774 AGGCTTGGTGGGAGGGGAGGAGG - Intergenic
1060750701 9:126166505-126166527 AGGCTCGGTGGCAGGGAAGGTGG + Intergenic
1060784903 9:126443356-126443378 AGGTTTTGCCTCAGGGTAGGAGG + Intronic
1060795604 9:126510727-126510749 AGGTGTGGGGCGAGGGGAGGAGG - Intergenic
1061194095 9:129098191-129098213 AGACCTGGGGGCAGGGGAGGGGG - Intronic
1061262022 9:129485615-129485637 AGGCATGGTGGCAGGAGAGGAGG + Intergenic
1061363345 9:130157477-130157499 AGGTGGGGCGGGAGGGGCGGGGG - Intergenic
1061485961 9:130920666-130920688 AGGTTTGGCGGCAGGGGAGGCGG - Intronic
1062032011 9:134366019-134366041 AGGGGTGGAGGCAGGGGTGGAGG - Intronic
1062276304 9:135733184-135733206 AGGTGTGGGGGCAGGTGCGGGGG - Intronic
1062314704 9:135960991-135961013 GGTGTTGGGGGCAGGGGAGGGGG + Intronic
1062341653 9:136096105-136096127 AGGTTAGGGGGCAGCTGAGGAGG - Intergenic
1062343089 9:136102420-136102442 AGGTCTGGCTGCCGGGGAGAGGG + Intergenic
1062354951 9:136157547-136157569 AGGGCTGGGGGCATGGGAGGCGG - Intergenic
1062466448 9:136683675-136683697 AGGTGTGGCGGGCGGGAAGGAGG + Intronic
1062522774 9:136965306-136965328 TGGCCTGGGGGCAGGGGAGGTGG + Intergenic
1185850407 X:3480692-3480714 AGGTTTGGGGCCAGGGGTGGTGG - Intergenic
1186466089 X:9785903-9785925 AGGTGAGGCGGCAGGTGAGATGG - Intronic
1187006749 X:15240043-15240065 AGGTGGGGGGGCGGGGGAGGGGG + Intronic
1188811215 X:34656598-34656620 AGGTTTGGCGACCAGGGATGGGG + Intronic
1189002167 X:36958323-36958345 AGGTTTGGCGGCCAGGGATGGGG - Intergenic
1189103990 X:38218968-38218990 AGGTTAGGAGTCAGTGGAGGTGG + Intronic
1189212433 X:39295306-39295328 AAGTTTGAAGGCAGGGGAGATGG + Intergenic
1189337713 X:40180488-40180510 ACGTTGGGAGGCTGGGGAGGAGG - Intergenic
1189465790 X:41276608-41276630 ACGTTTGGCCCCAGGAGAGGGGG - Intergenic
1190078587 X:47337239-47337261 AGGTGTGGGGGCAGTGCAGGTGG + Intergenic
1190772484 X:53526826-53526848 AGGTTTGGGGCCAGGCGTGGTGG + Intergenic
1191853178 X:65601409-65601431 AGATTTGGAGTCAGGGGAGAGGG - Intronic
1192160750 X:68784938-68784960 GGACCTGGCGGCAGGGGAGGAGG + Intergenic
1195266813 X:103189391-103189413 ATGTTTGGAGGTAGGGCAGGTGG + Intergenic
1196196223 X:112840820-112840842 AGGATGGGAGGTAGGGGAGGGGG + Intergenic
1196324602 X:114388717-114388739 TGGTGTGGTGGGAGGGGAGGTGG - Intergenic
1196861011 X:120026809-120026831 TGGTGTGGTGTCAGGGGAGGGGG + Intergenic
1197334707 X:125198869-125198891 AGGGGTGGGGGCAGGGAAGGGGG + Intergenic
1197489031 X:127093528-127093550 AGGTTTGGCGGTAGGTGCTGTGG + Intergenic
1198807628 X:140506124-140506146 AGGTGCGGGGGCAGTGGAGGGGG - Intergenic
1199600108 X:149536803-149536825 AGGGTTGGGGGCAGGGGGTGGGG + Intergenic
1199650475 X:149943137-149943159 AGGGTTGGGGGCAGGGGGTGGGG - Intergenic
1200317242 X:155146992-155147014 AGGTTTAGTGGCAGAGAAGGAGG + Intronic
1200954854 Y:8933204-8933226 AAGTTGGGGGGCAGGGCAGGAGG + Intergenic