ID: 1061485962

View in Genome Browser
Species Human (GRCh38)
Location 9:130920669-130920691
Sequence AGGAGGTTTGGCGGCAGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 558
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 527}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061485962_1061485968 -10 Left 1061485962 9:130920669-130920691 CCTCCCCTGCCGCCAAACCTCCT 0: 1
1: 0
2: 1
3: 29
4: 527
Right 1061485968 9:130920682-130920704 CAAACCTCCTTAAACCAGATAGG No data
1061485962_1061485973 13 Left 1061485962 9:130920669-130920691 CCTCCCCTGCCGCCAAACCTCCT 0: 1
1: 0
2: 1
3: 29
4: 527
Right 1061485973 9:130920705-130920727 CCAGTAGCACCAAGCCACCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061485962 Original CRISPR AGGAGGTTTGGCGGCAGGGG AGG (reversed) Intronic
900097937 1:947926-947948 AGGAGGTTTGGGGGCAGGCCTGG - Intronic
900627161 1:3613640-3613662 AGGAGGTCTCTGGGCAGGGGAGG + Intergenic
901659451 1:10789289-10789311 AGGAGGCCTGGAGGCTGGGGTGG - Intronic
902699695 1:18163321-18163343 AGGAGGTATGGCAGATGGGGTGG + Intronic
903194182 1:21672593-21672615 AGGAGGGTGGGCTTCAGGGGCGG + Intergenic
903216851 1:21848112-21848134 AGGAGGTATGGCAGTAGGTGTGG + Intronic
903704286 1:25273580-25273602 AGAAGGTATGGCTGAAGGGGAGG + Intronic
903722953 1:25419737-25419759 AGAAGGTATGGCTGAAGGGGAGG - Intronic
903804166 1:25992280-25992302 AGGAAGTTGAGAGGCAGGGGAGG + Intronic
903947447 1:26972615-26972637 AGCATGTCTGGGGGCAGGGGTGG + Intergenic
904348256 1:29887890-29887912 AGGGGGTTGGGGGGTAGGGGAGG + Intergenic
904571815 1:31471633-31471655 GAGAAGTTTGGCGGGAGGGGTGG + Intergenic
904870549 1:33615108-33615130 GGCAGGGTGGGCGGCAGGGGAGG + Intronic
905147912 1:35902341-35902363 AGGAGGGTTCGCTGTAGGGGTGG + Intronic
905179504 1:36157156-36157178 AGTAGGCCTGGCTGCAGGGGAGG - Intronic
905233592 1:36530429-36530451 AGGAGAGCTGGCGGCAGGGCAGG - Intergenic
905446305 1:38030354-38030376 AGCAGGAATGGGGGCAGGGGTGG - Intergenic
905804429 1:40865513-40865535 AGGAGGTTGGGGTGCAGGGGAGG + Intergenic
905974900 1:42167829-42167851 AGGAGTTTCGGAGGCTGGGGTGG + Intergenic
906556500 1:46718623-46718645 AGGAGAGGTGGCGGCAGGAGGGG + Exonic
906688065 1:47775290-47775312 AGGAGGTGTGGGGACAGGGCTGG + Exonic
907267416 1:53271385-53271407 AGGAGGAGTGGGGGCAGGGCAGG + Intronic
907269249 1:53281004-53281026 TGGAGGTTTGGAGGGATGGGAGG - Intronic
907789887 1:57652373-57652395 AGGTAGTTTGGGGGAAGGGGTGG - Intronic
908322411 1:62991233-62991255 AGGAGGTGGGGCGGGAGTGGAGG + Intergenic
908497461 1:64709048-64709070 ATGAGATTTGGAGGCAGGGGGGG - Intergenic
909149887 1:71988290-71988312 AGGAGGTTGGGAGGCCGAGGCGG + Intronic
909170015 1:72282880-72282902 AGGAGGCGCGGCGGCGGGGGAGG + Intergenic
910353346 1:86325214-86325236 AGAAGGTTTGGGGGCACAGGGGG - Intergenic
911064278 1:93773744-93773766 TGGAGGTGTGGTGGCTGGGGTGG - Intronic
911364165 1:96916414-96916436 TGGGGGGTTGGGGGCAGGGGAGG + Intergenic
911866689 1:103034840-103034862 AGTAGGCCTGGCGGAAGGGGAGG - Intronic
912449658 1:109761157-109761179 AGGGGGTTGGGAGACAGGGGAGG + Intronic
912499209 1:110110766-110110788 AGGAGGTTAGGTGGGAGGGAGGG + Intergenic
912759044 1:112349900-112349922 TGGGGGTTGGGGGGCAGGGGAGG - Intergenic
912946939 1:114093141-114093163 TGGAGGTTTGGGGTCGGGGGAGG + Intronic
912985014 1:114418898-114418920 AGGTAGTTTGGAGGAAGGGGTGG - Intronic
913661739 1:121010888-121010910 TGGAGGTTGGGCGCCGGGGGTGG - Intergenic
914013112 1:143794068-143794090 TGGAGGTTGGGCGCCGGGGGTGG - Intergenic
914081130 1:144412464-144412486 AGGAGGGCTGGGGGCGGGGGGGG + Intergenic
914164714 1:145167117-145167139 TGGAGGTTGGGCGCCGGGGGTGG + Intergenic
914570485 1:148911539-148911561 AGGAGGGATGGGGGTAGGGGTGG - Intronic
914602345 1:149218730-149218752 AGGAGGGATGGGGGTAGGGGTGG + Intergenic
914651736 1:149702677-149702699 TGGAGGTTGGGCGCCGGGGGTGG - Exonic
914917990 1:151830119-151830141 AGGATGTTTGGAGGAAGAGGAGG + Intronic
915347171 1:155203395-155203417 AGTAGGTTTAAAGGCAGGGGTGG - Intronic
915484281 1:156209413-156209435 AGGAGGTAGGGCGGAAGCGGGGG + Intronic
916437760 1:164792597-164792619 CGGAGGGTCGGCGGCAGCGGCGG + Exonic
916682641 1:167118387-167118409 AGGAAATTTGGCCTCAGGGGAGG + Intronic
917022762 1:170608380-170608402 AGGGGGTTTGGGGCAAGGGGAGG - Intergenic
919511752 1:198473903-198473925 AGGAGGTGGGGGGCCAGGGGAGG - Intergenic
920550189 1:206854098-206854120 AGGGGGTTTGGGGGGAAGGGGGG + Intergenic
921180716 1:212629444-212629466 AGGAGGTGTGGAGTGAGGGGTGG + Intergenic
921337280 1:214100859-214100881 AGTAGGTTTGGCGGCTGGTAGGG + Intergenic
921591567 1:217010400-217010422 AGTTGTTTTGGCTGCAGGGGTGG - Intronic
921830597 1:219724080-219724102 ATGAAGTTTGGTGGCAGTGGAGG - Intronic
921930076 1:220747895-220747917 TCGAGGTTAGGCGGCAGCGGAGG + Intergenic
922097641 1:222456086-222456108 TGGAGGTTTGGGGACAGTGGTGG - Intergenic
922549597 1:226484326-226484348 AGGAGGTCTGGGGGCAGTGGAGG - Intergenic
923739735 1:236644335-236644357 TGGAGGTTTGGCTGTATGGGTGG - Intergenic
923967597 1:239159083-239159105 AGGAGGTTTGTGGGCATGGATGG + Intergenic
924381964 1:243473908-243473930 AGGAGAGTTGCCGGCGGGGGGGG + Intronic
924945304 1:248842524-248842546 GGGAGGTGTGGAGGCAGGGGTGG + Intronic
1064019537 10:11798029-11798051 AGGCAGTTTGGGGGAAGGGGTGG - Intergenic
1064063360 10:12158807-12158829 AGGAGGCCTGGAGGCAGGGTGGG - Intronic
1067474311 10:46556205-46556227 AGGAGCGATGGCAGCAGGGGTGG + Intergenic
1067897184 10:50195899-50195921 AGGAGGTTAGGGGGTTGGGGAGG + Intronic
1068398450 10:56495239-56495261 AGGAGGTGGGGTGTCAGGGGAGG + Intergenic
1068627538 10:59265311-59265333 AGGGGTTTTGGCGGGGGGGGGGG + Intronic
1069723440 10:70563519-70563541 AGGATGTGTGGGTGCAGGGGAGG - Intronic
1069772661 10:70909553-70909575 AGGAGCTTTGGAGGCAGAGTTGG - Intergenic
1069885059 10:71618437-71618459 AGGAGGGGTGAGGGCAGGGGAGG - Intronic
1070780151 10:79132878-79132900 AGGAGGTCTGTCTGCATGGGAGG - Intronic
1072508687 10:96096095-96096117 AGGAGGATTGGCCGGAGTGGTGG - Intergenic
1073700834 10:105925198-105925220 AGGAGGTGGGGCAGCAGGCGGGG + Intergenic
1074051837 10:109887493-109887515 TGGAGGTGGGGCTGCAGGGGAGG - Intronic
1075103341 10:119521027-119521049 AGGGGCTTTGGAGGCAGAGGCGG - Intronic
1075217207 10:120546318-120546340 AGCAGGTTGGGGGACAGGGGAGG - Intronic
1075380628 10:122015830-122015852 AGGATGTTTGCTGGGAGGGGTGG - Intronic
1076371557 10:129959197-129959219 AGGAGGCTGGGAGGCAGGGGAGG - Intronic
1076409590 10:130236400-130236422 AGAAGATATGGCTGCAGGGGAGG + Intergenic
1076494618 10:130888971-130888993 CAGAGGTTTGGGGGAAGGGGCGG + Intergenic
1076735563 10:132457522-132457544 AGGTGGGTTGGGGGCTGGGGTGG - Intergenic
1076897331 10:133319023-133319045 AGGAGGTGTGGGAGCAGGGCAGG + Intronic
1077353305 11:2103004-2103026 AGGAGCCTTGGCTGCAGGGAAGG - Intergenic
1077410482 11:2401590-2401612 AGGAGTTTTGGTAGCAGGAGAGG + Intronic
1078061223 11:8046080-8046102 AGGAGGGATGGAGGGAGGGGAGG - Intronic
1078662643 11:13299508-13299530 AGGTGGTTTGGGGCCATGGGGGG + Intronic
1081014384 11:37857886-37857908 AGGAAGCTTGGGGGGAGGGGCGG - Intergenic
1081128672 11:39349853-39349875 GGGAGGCCTGGCGGTAGGGGGGG + Intergenic
1081447107 11:43141176-43141198 AGCATGTTTGATGGCAGGGGAGG - Intergenic
1082249146 11:49960480-49960502 TGGAGGTTTGGGGGCAGAGCAGG + Intergenic
1083733977 11:64669237-64669259 TGGAGATTGGGCTGCAGGGGTGG - Intronic
1084171029 11:67401241-67401263 AGGAGGGTGGGCGACACGGGTGG + Intronic
1084697314 11:70763355-70763377 AGAGGGTTTGCTGGCAGGGGTGG + Intronic
1085388524 11:76170675-76170697 AGGAGGTCAGGCTGCAGGAGGGG + Intergenic
1086211951 11:84331557-84331579 AGGAGGTGGGTCGGCAGGGGAGG + Intronic
1086546061 11:87968902-87968924 AGGAGGATGGGGGGCAGGTGAGG + Intergenic
1089132631 11:116224448-116224470 AGGAGGGTTGGGGGTGGGGGTGG - Intergenic
1089932829 11:122331565-122331587 GGGAGGTTGGGAGGCAGGAGAGG - Intergenic
1090038960 11:123273670-123273692 AGCAGTTTTGGAGGCCGGGGTGG - Intergenic
1090142124 11:124276618-124276640 AGGTGGTTTGGAGGAAGAGGAGG - Intergenic
1091061870 11:132471218-132471240 AGGGGGTTTGATGGCAGGTGAGG + Intronic
1091201783 11:133786199-133786221 AGGAGTTTTGGTGTCATGGGAGG - Intergenic
1091909478 12:4217281-4217303 AGGAAGTTAGGAGGCAGGGCTGG + Intergenic
1092370889 12:7915927-7915949 AGGCGGTGGGGCGGCGGGGGGGG - Intergenic
1092404086 12:8204595-8204617 ATGAGGTCTGAAGGCAGGGGAGG + Intergenic
1092513638 12:9184822-9184844 AGAAGATTTGGGGGCAGTGGAGG - Intronic
1096815265 12:54197799-54197821 AAGAGGCTTGGGGGCAGGGAGGG + Intergenic
1098426190 12:70367107-70367129 GGGAGGTTTGGAGGCAGCGTCGG + Intronic
1098733322 12:74065888-74065910 AGAAGGTAAGGCGGCAGAGGTGG - Intergenic
1102345821 12:112160786-112160808 AGGAGCTGTGGCCGCTGGGGAGG + Exonic
1103983705 12:124753455-124753477 AGGAGTGTCGGAGGCAGGGGAGG + Intergenic
1104067355 12:125316864-125316886 GGGAGGTTTGGGAGCAGGGCAGG + Intronic
1104597995 12:130132977-130132999 AGGAGGGCTGGAGGCAGAGGAGG + Intergenic
1105441203 13:20416426-20416448 AGGAGGTCTGGAGGCAGGAAGGG + Intronic
1105657295 13:22455178-22455200 TGGAGGGTTGGCAGCAGGTGAGG + Intergenic
1105671175 13:22618054-22618076 TGGGGGTTTGGCTGCAGGGTAGG + Intergenic
1106006766 13:25777891-25777913 AGGAGGTTTGGGGGCGAGAGTGG - Intronic
1106104351 13:26721390-26721412 AGGAGGCTTAGAGGCAGGAGGGG + Intergenic
1106476771 13:30105613-30105635 GGGAGGCCTGGCTGCAGGGGTGG + Intergenic
1108247542 13:48532912-48532934 GGGAGGTCGGGCCGCAGGGGCGG + Intronic
1109176750 13:59166897-59166919 AGGTAGTTTGGGGGAAGGGGTGG + Intergenic
1109244545 13:59937795-59937817 GGGAGGTGGGGAGGCAGGGGAGG + Intronic
1110253941 13:73410666-73410688 AGGAGGGTGGGAGGCAGGTGAGG - Intergenic
1110910842 13:80960993-80961015 AGGGGGATTGGCGGGAGGTGTGG - Intergenic
1111514964 13:89318212-89318234 AGCAGGTTGGGAGGCAGAGGTGG + Intergenic
1113739434 13:112701055-112701077 AGGACGTTGGGGGGCAGGAGTGG + Intronic
1114484915 14:23056759-23056781 AGGAGGGGTGGAGGCAGGGAGGG + Intronic
1115163090 14:30417681-30417703 AGGAGGCCAGGCAGCAGGGGAGG - Intergenic
1115224892 14:31092293-31092315 TGGAGGTTTGGGGGCTGAGGAGG + Intronic
1116938028 14:50762176-50762198 AGGTGGTGGGGCGGCGGGGGTGG + Intronic
1117047303 14:51826484-51826506 TGGTGGTTGGGAGGCAGGGGTGG + Intronic
1117587382 14:57224166-57224188 AGGGGGTTTGGGGTGAGGGGTGG + Intronic
1117602578 14:57390667-57390689 AAGAGGAGTGGCGGCAGCGGCGG + Exonic
1117914018 14:60658276-60658298 AGGCGCTCTGGCGGCAGAGGTGG - Intergenic
1118246190 14:64113391-64113413 AGGAGGTTTGGAGCCCAGGGTGG + Exonic
1118405025 14:65413536-65413558 AGAAGGGTTGGGGGCGGGGGTGG + Intronic
1118586742 14:67360359-67360381 AGGAGGATCGGCGGCCGGTGAGG + Exonic
1118744753 14:68765827-68765849 AGGATGGCTGGCCGCAGGGGAGG - Intergenic
1118907440 14:70032908-70032930 ACGAGGATTGGCAGCAGGGGTGG + Intergenic
1119265637 14:73262038-73262060 AGGTGGTCTGGTGGCAGGGAAGG + Intronic
1119931454 14:78551659-78551681 AGGAGGTGAGGAGGGAGGGGAGG - Intronic
1120873689 14:89360172-89360194 GGCAGTTTTGGCGGGAGGGGAGG - Intronic
1121210859 14:92207225-92207247 AGGGAGTTTGGCTGGAGGGGAGG + Intergenic
1121410886 14:93747356-93747378 AAGTGGTTTGGCGGGAGTGGAGG + Intronic
1121634634 14:95445659-95445681 AGGGGGTTTGGGGACAGGGCTGG + Intronic
1121798578 14:96755196-96755218 AGGGGGTTTGGCTGTACGGGGGG - Intergenic
1122081698 14:99271322-99271344 AGGAGGTGCGGCGGCGGCGGCGG - Intronic
1122411464 14:101528165-101528187 TGGTGGTTTGGCGGCAGGTGTGG + Intergenic
1123110897 14:105866434-105866456 AGGGTGTCTGGGGGCAGGGGAGG + Intergenic
1123494113 15:20807271-20807293 AGCAGGGTGGGGGGCAGGGGTGG + Intergenic
1123932344 15:25177927-25177949 AGCGGGTTGGGGGGCAGGGGCGG + Intergenic
1124286373 15:28403210-28403232 AGGAGGCCTGGCGGCGCGGGCGG + Intergenic
1124296330 15:28508426-28508448 AGGAGGCCTGGCGGCGCGGGCGG - Intergenic
1124604737 15:31161731-31161753 AGGAGGGTCGGCAGCAAGGGTGG - Intergenic
1124949203 15:34300826-34300848 AGCAGGTTTGGGGGCATGAGGGG + Intronic
1124971130 15:34490508-34490530 AGGAGGCGGGGCGGCGGGGGCGG - Intergenic
1125720694 15:41843807-41843829 ATGAGGTTTGGGGGCTGGGCTGG + Exonic
1126506140 15:49406547-49406569 AGCAGCTTTGGCGGGAGGGTGGG + Intronic
1127670180 15:61187499-61187521 AGGAGGGGTGGCGGTAGGGATGG + Intronic
1128242562 15:66110933-66110955 AGGAGGTTTGGAGGGGGAGGAGG - Intronic
1128647239 15:69386850-69386872 AGCAGGTGTAGGGGCAGGGGCGG - Intronic
1128770120 15:70275786-70275808 AGGAGGTTTGCCTCCAGTGGAGG - Intergenic
1128791012 15:70434040-70434062 AGGACGCTGGTCGGCAGGGGTGG - Intergenic
1128909888 15:71503841-71503863 AGGAGGATTGGCTCCAGGAGTGG - Intronic
1129462808 15:75708324-75708346 AGGTGGCCTGGTGGCAGGGGTGG - Intronic
1129578284 15:76777406-76777428 AGAAGGTTTGAGGCCAGGGGTGG + Intronic
1129722066 15:77883092-77883114 AGGTGGCCTGGTGGCAGGGGTGG + Intergenic
1129772855 15:78213679-78213701 AGAAGGGTGGGCGGCAGGAGAGG + Intronic
1130329401 15:82909466-82909488 AGTAGTTTTGGCGGGAGGGATGG + Intronic
1130496761 15:84473593-84473615 AGGAGCACTGGCTGCAGGGGGGG - Intergenic
1130883164 15:88072292-88072314 AGGATGTTTGGGGCCAGGCGCGG - Intronic
1131609677 15:93947816-93947838 AGAAGGTTTGGAGGAAGGTGGGG - Intergenic
1132692744 16:1188908-1188930 AGGAGGTGTGGACGCAGGGCGGG - Intronic
1132768107 16:1545195-1545217 AGGAGGGATGGTGGCGGGGGCGG + Intronic
1134455304 16:14390937-14390959 ATGAGGTTGGGAGGCAGGAGAGG + Intergenic
1134748046 16:16602954-16602976 AGGAGGAAGGGAGGCAGGGGAGG - Intergenic
1134997416 16:18750673-18750695 AGGAGGAAGGGAGGCAGGGGAGG + Intergenic
1135722505 16:24829454-24829476 GGGAGGTTTGGGGGTTGGGGGGG + Intergenic
1136244117 16:28963601-28963623 AGGGAGGATGGCGGCAGGGGCGG - Intronic
1137932760 16:52604319-52604341 GGGTGGTTTGGGGTCAGGGGTGG - Intergenic
1138296453 16:55889600-55889622 TGGAGGTTTAGGGTCAGGGGTGG - Intronic
1139287861 16:65831597-65831619 AGGGGTTTTGGAGGCAGTGGAGG - Intergenic
1139531849 16:67546291-67546313 AGGAGAGATGGCGCCAGGGGTGG + Intronic
1139704668 16:68732936-68732958 AGGAGCTTTAGTGGCGGGGGTGG + Intergenic
1140049166 16:71464361-71464383 TGAAGGTTTGGGGGCAGGGAGGG - Intronic
1140733620 16:77878464-77878486 ATAAGGTTTCGGGGCAGGGGAGG - Intronic
1142371063 16:89682616-89682638 AGGTAGTTTGGGGGAAGGGGTGG + Exonic
1142571652 17:878510-878532 GTGGGGTTTGGGGGCAGGGGAGG + Intronic
1142783469 17:2200820-2200842 AGGAGGTTGGGAGGCCGAGGTGG - Intronic
1143117883 17:4590886-4590908 AGCAGCTTGGGCGGCAGGGCAGG + Intronic
1143514057 17:7410673-7410695 GGGTGGTGTGGGGGCAGGGGTGG - Intronic
1143572706 17:7770421-7770443 AGGAGGTGTGGGAGCATGGGAGG - Intronic
1143758190 17:9081730-9081752 AGGAGGCTGGGGGTCAGGGGTGG + Intronic
1143916582 17:10298069-10298091 AGGAGGATTGGCAGCAGCGGTGG - Exonic
1144062075 17:11591874-11591896 AGGCAGTTTGGGGGAAGGGGTGG + Intergenic
1144078026 17:11736479-11736501 AGGATGCTTGGAGGCAGGGAGGG - Intronic
1144575983 17:16429755-16429777 AGGAGGTTGGGAGGAAGGGAAGG + Intronic
1147244372 17:39110552-39110574 AGGAGGAATGGAGGCAGGGCAGG + Intronic
1147782039 17:42950250-42950272 AGGGGGTGGGGCGGTAGGGGCGG + Intergenic
1147975731 17:44247235-44247257 TGGAGCTTGGGCAGCAGGGGAGG - Intergenic
1150250998 17:63704396-63704418 AGAAGGTTCGGTGGTAGGGGTGG + Exonic
1150917851 17:69454636-69454658 AGCAGTTTTGGAGGCAGAGGCGG - Intronic
1151266045 17:72955914-72955936 AAGAGGATAGACGGCAGGGGTGG - Intronic
1151320729 17:73350828-73350850 AGGAGATTTGGAGGGAGGAGGGG - Intronic
1151334644 17:73432660-73432682 AGGAGGTAGGGCTGGAGGGGAGG + Intronic
1151352982 17:73542601-73542623 AGGAGGGGTGGAGGCAGGGCAGG + Intronic
1151378395 17:73707833-73707855 AGCAGGTTTGGGGGCACTGGAGG - Intergenic
1151990567 17:77571401-77571423 AGGAGGGGAGGCGGGAGGGGAGG + Intergenic
1152521449 17:80859019-80859041 AGGAGGTCGGGCTGCAGGGCTGG + Intronic
1154451643 18:14481729-14481751 AGCAGGGTGGGGGGCAGGGGTGG + Intergenic
1157105662 18:44772105-44772127 AGGAGGTGGGGAGGCTGGGGCGG - Intronic
1157517009 18:48318327-48318349 TGGAGGGATGGGGGCAGGGGAGG - Intronic
1157914441 18:51651121-51651143 TGGAAGTTTGGAGGCAGGGTAGG + Intergenic
1158868631 18:61662313-61662335 AGGTAGTTTGGGGGAAGGGGTGG - Intergenic
1160887302 19:1355787-1355809 AGGAGGTTTGGGGGTGGGGGTGG - Intronic
1160914537 19:1490380-1490402 CGGCGGTTTGGCGGGAGGGAGGG - Exonic
1161021422 19:2013387-2013409 AGGAGGGCTGGGGGCTGGGGAGG + Intronic
1161250269 19:3276303-3276325 GAGAGGTGTGGCTGCAGGGGTGG + Intronic
1161803646 19:6429943-6429965 TGGAGTTTTGGGGGCATGGGAGG + Intronic
1162529473 19:11227613-11227635 AGGAGGCTTGACAGGAGGGGCGG + Intronic
1162555773 19:11384433-11384455 AGGCCGCTTGGGGGCAGGGGAGG + Intronic
1162562755 19:11426954-11426976 AGGTGGTGTTGCGGCAGAGGCGG - Exonic
1163234429 19:16022574-16022596 GGGAGGTTTGGGGGCAGGCCTGG + Intergenic
1163288092 19:16361815-16361837 AGAAGGTTTAGCTGCAGAGGAGG + Exonic
1163321746 19:16578593-16578615 AGGAGGTCAGACGGCAGGTGAGG - Intronic
1163323651 19:16589109-16589131 AGGAGCTGTGGGGGAAGGGGTGG - Intronic
1163502679 19:17686245-17686267 AGGAGGCTCGGCTGCGGGGGTGG - Intronic
1163502858 19:17686833-17686855 AGGAGGAGGGGCGGCGGGGGCGG + Intronic
1164462579 19:28461695-28461717 AGAAGGTTGGGGGGCTGGGGTGG - Intergenic
1165495337 19:36149540-36149562 CAGAGGTTTGGCGGCAGGGAAGG - Intronic
1165742001 19:38210293-38210315 AGGAGGTTTAACGGCAGAGAGGG - Intergenic
1165860891 19:38908786-38908808 AAGAGGTTTTGAGGCTGGGGTGG - Exonic
1166146854 19:40843981-40844003 AGGAGGAGAGGCGGGAGGGGTGG + Intronic
1166151015 19:40875878-40875900 AGGAGGAGAGGCGGGAGGGGTGG + Intronic
1166155510 19:40908657-40908679 AGGAGGAGAGGCGGGAGGGGTGG + Intergenic
1166387548 19:42390500-42390522 GGGAGGTTTGGCGGGGGCGGGGG + Intergenic
1166990860 19:46691884-46691906 AGGAGGGTTTGTGGGAGGGGAGG + Intronic
1167009369 19:46796628-46796650 AGGAGGTTTGGCTTAGGGGGAGG - Intergenic
1167270318 19:48502362-48502384 AGGAGGTGAGGCCTCAGGGGAGG - Intronic
1167568584 19:50272544-50272566 AGGCGGTCTGGAGGCAGGGGTGG - Exonic
1167769958 19:51508889-51508911 AGGTGCTGTGGCGGCAGGGCAGG + Intergenic
1168091675 19:54089650-54089672 AAGAGGATTGGGGGCTGGGGAGG - Intergenic
1168130107 19:54312420-54312442 AGGAGGTTCCCAGGCAGGGGAGG - Intronic
925266494 2:2570042-2570064 AGGAGGTTTGGCTGCTGCTGTGG + Intergenic
925274760 2:2640955-2640977 AGGAGGGTCAGTGGCAGGGGAGG + Intergenic
925611448 2:5706003-5706025 AGGAGGAGGGGAGGCAGGGGTGG + Intergenic
925755103 2:7126334-7126356 AGGAGGTCGGGGGGTAGGGGAGG - Intergenic
927152201 2:20202663-20202685 AGGTGGCCTGGTGGCAGGGGAGG + Exonic
927214454 2:20659710-20659732 AGGAGGTTTGAGGGCTGGGGTGG + Intergenic
927473400 2:23393814-23393836 AGGAGGTTTGGGGTGTGGGGAGG + Intronic
928780887 2:34819197-34819219 TGGAGGTTTGGAGGCCAGGGAGG + Intergenic
929484104 2:42339528-42339550 AGGAGGAATGGTGGCAGGAGAGG - Intronic
930621795 2:53651810-53651832 AGGAGGTGGGGAGGCAGGGAGGG - Intronic
931105299 2:59048651-59048673 TGGAGTTTTGGGGTCAGGGGTGG - Intergenic
931400372 2:61925638-61925660 AAGAGGTTTGGGGGAAGGGTGGG + Intronic
931689081 2:64819962-64819984 ATGAAGTGTGGTGGCAGGGGTGG - Intergenic
932105443 2:68937184-68937206 AGGAGGTTTTGCTACAGGGCTGG + Intergenic
932467589 2:71933490-71933512 AGCAGGTTTGGGGGAAGGGCAGG + Intergenic
933812931 2:86044365-86044387 ATGAGGGTTGGGGGCAGTGGAGG + Intronic
934155844 2:89199586-89199608 AGGCAGTTTGGAGGAAGGGGTGG - Intergenic
934211477 2:89983173-89983195 AGGCAGTTTGGAGGAAGGGGTGG + Intergenic
936071394 2:109374100-109374122 AGGGGGTGTGGGGGCAGGTGGGG - Intronic
936462326 2:112722595-112722617 TGGAGGGTTGGGGGCACGGGAGG + Intronic
936520601 2:113210037-113210059 AGGAGGAGTGGAGGCGGGGGAGG - Intergenic
936760603 2:115776293-115776315 AGGAGGTTGGGGGCTAGGGGAGG - Intronic
937367182 2:121271889-121271911 AGGAGGGTTGGGGGTAGGGTAGG + Intronic
937932497 2:127218142-127218164 GTGAGGGCTGGCGGCAGGGGCGG + Intronic
938290975 2:130150336-130150358 CGGAGGTGCGGGGGCAGGGGTGG + Intergenic
938480036 2:131654293-131654315 AGCAGGGTGGGCGGCAGGGGTGG - Intergenic
938730289 2:134141994-134142016 AGGAGGTGGGGTGGCAGGGCAGG + Intronic
940285267 2:152027476-152027498 AGGAGGGGAGGTGGCAGGGGAGG - Intronic
940328884 2:152453516-152453538 AGAAGGCTGGGCAGCAGGGGAGG - Intronic
940365389 2:152843413-152843435 AGGAGGTAAGGAGGCAGGAGAGG - Intergenic
940734116 2:157429731-157429753 AAGAAGTTTGGGGCCAGGGGCGG + Intronic
940985063 2:160044379-160044401 AAGAGAAATGGCGGCAGGGGAGG + Intronic
942445395 2:176074220-176074242 AGGAGGGGTGGTGGCGGGGGTGG - Intergenic
942986888 2:182153858-182153880 AGGAGGTTTGGAGGCAGGTAAGG + Intronic
943046418 2:182866738-182866760 AGCAGCCTGGGCGGCAGGGGCGG - Exonic
943116335 2:183676299-183676321 TGGGGGTTTGGGGGCAGGAGGGG + Intergenic
943266684 2:185740369-185740391 GGGAGGTTTGGGGGTAGGTGTGG - Intronic
943333704 2:186589763-186589785 AGGAGGCGTGGGGGCGGGGGCGG - Intergenic
945102425 2:206274649-206274671 TGGAGGTTTGACGTCAGGGAAGG - Exonic
946404535 2:219485220-219485242 AGCAGGAATGGCGGCAGGGCTGG + Intronic
946563300 2:220937002-220937024 AGGAGGTTTGGGGGAAGGGGAGG + Intergenic
946776544 2:223148347-223148369 AGGTGGCTTGGCGGCGGCGGGGG + Intronic
947368269 2:229418571-229418593 AGCAGGATTTACGGCAGGGGAGG + Intronic
948869396 2:240790705-240790727 AGGAGATTTGGAGACAGGGAGGG + Intronic
1168788115 20:557183-557205 TGGAGGTGTGGGGGCAGGGGAGG + Intergenic
1169074545 20:2752702-2752724 TTGAGGTTCTGCGGCAGGGGAGG - Intronic
1169756229 20:9046119-9046141 AGCAGTTTTGGAGGAAGGGGCGG + Intergenic
1169758729 20:9068746-9068768 GGGAGGCTCGGGGGCAGGGGAGG + Intronic
1170612654 20:17927366-17927388 AGGAGGTTTGTTGACAAGGGTGG + Intergenic
1170830784 20:19838891-19838913 TGGAGGTTTGGGGGCTGGAGAGG - Intergenic
1170859440 20:20089034-20089056 AGGAGGAATGGTGGCAGGGCTGG + Intronic
1172628208 20:36360763-36360785 GGGAGGGATGGCGGCAGGGAGGG + Intronic
1172837257 20:37881071-37881093 AGGAGGTCAGGCAGCAGGTGGGG - Intergenic
1172898416 20:38316596-38316618 AGGAGGTCGGGAGGCAGGGAAGG + Intronic
1174189125 20:48727760-48727782 AGCAGGTTGGGTGGCAGGGATGG - Intronic
1175491013 20:59381318-59381340 ATGAGCTTTGGCGGCAGGACTGG + Intergenic
1175491735 20:59384535-59384557 AGGAGGTGAGGGGGCAAGGGAGG + Intergenic
1175522897 20:59613590-59613612 AGCAGGTTCCGCGGAAGGGGAGG + Intronic
1175777246 20:61661073-61661095 AGGAGGCATGGCGGGGGGGGGGG + Intronic
1175825873 20:61936367-61936389 AGGGGGTGTGGGGGAAGGGGAGG - Intronic
1175938955 20:62528929-62528951 AGGTTGTTTTGCGGCAGGGAAGG + Intergenic
1175958264 20:62622334-62622356 AGGAGGGTCGGAGGCAGAGGAGG + Intergenic
1176027458 20:62993366-62993388 AGGAGGCTGGGAGGCAGGGGAGG + Intergenic
1176027471 20:62993399-62993421 GGGAGGCTGGGAGGCAGGGGAGG + Intergenic
1176027498 20:62993481-62993503 GGGAGGCTGGGAGGCAGGGGAGG + Intergenic
1176027504 20:62993498-62993520 GGGAGGCTTGGAGGCAGGGGAGG + Intergenic
1176027511 20:62993515-62993537 GGGAGGCTGGGAGGCAGGGGAGG + Intergenic
1176027518 20:62993532-62993554 GGGAGGCTGGGAGGCAGGGGAGG + Intergenic
1176027525 20:62993549-62993571 GGGAGGCTGGGAGGCAGGGGAGG + Intergenic
1176027533 20:62993566-62993588 GGGAGGGTGGGAGGCAGGGGAGG + Intergenic
1176027601 20:62993765-62993787 GGGAGGCTGGGAGGCAGGGGAGG + Intergenic
1176027608 20:62993782-62993804 GGGAGGCTGGGAGGCAGGGGAGG + Intergenic
1176180734 20:63748199-63748221 AGGAGGTGTGGCTGCCAGGGAGG + Intronic
1176375857 21:6086634-6086656 GGGAGGCTTGGCGGCTGTGGAGG - Intergenic
1176444502 21:6808494-6808516 AGCAGGGTGGGGGGCAGGGGTGG - Intergenic
1176822667 21:13673532-13673554 AGCAGGGTGGGGGGCAGGGGTGG - Intergenic
1177176768 21:17708144-17708166 TGGAGGGTTGGGGGAAGGGGGGG - Intergenic
1178474611 21:32926547-32926569 AGCAGGCATGGCGGCGGGGGAGG + Intergenic
1178524912 21:33319447-33319469 AGGAGGTGGGGTGGGAGGGGAGG + Intergenic
1179209238 21:39312581-39312603 CGGAGGTCCTGCGGCAGGGGTGG - Intronic
1179510687 21:41871336-41871358 AGGAGGTTGGGGGGTGGGGGTGG - Intronic
1179747617 21:43451610-43451632 GGGAGGCTTGGCGGCTGTGGAGG + Intergenic
1179952148 21:44714358-44714380 AGGAGGGAGGGAGGCAGGGGAGG + Intergenic
1181503879 22:23337848-23337870 AGAAGGATTGCTGGCAGGGGAGG + Intergenic
1181654716 22:24287383-24287405 AGAAGGATTGCTGGCAGGGGAGG + Intronic
1181708868 22:24668068-24668090 AGAAGGATTGCTGGCAGGGGAGG + Intergenic
1181732924 22:24860414-24860436 AGGAGGCTTGGCTGCTGGTGGGG + Intronic
1182358876 22:29735119-29735141 AGGGGGTGTGGATGCAGGGGAGG + Intronic
1182505089 22:30776370-30776392 AGCATGTTGGGAGGCAGGGGCGG - Intronic
1182555234 22:31125534-31125556 GGGAGGTTTGGATGCAGGGTGGG - Exonic
1182790727 22:32950681-32950703 ATGAGGTTTGGCTTCAAGGGAGG + Intronic
1182801499 22:33035337-33035359 AAGAAGTTTGGTGGCGGGGGGGG - Intronic
1183096097 22:35553199-35553221 AGGTGGTGGGGCAGCAGGGGCGG - Exonic
1183231913 22:36587811-36587833 CGGAGGCTTGGCAGCAGTGGAGG + Intronic
1183318986 22:37153576-37153598 AGGCTGTCTGGCGGCAGGAGAGG + Intronic
1183370353 22:37428298-37428320 AGGGGCTTTGGCGTAAGGGGCGG - Intergenic
1184099906 22:42336541-42336563 AGCAGGTTTGGAGGCAGAGACGG - Intronic
1184550594 22:45202454-45202476 AGGAGGTTCTGCTGCAGGAGAGG - Intronic
1184759424 22:46536503-46536525 GGCAAGTTCGGCGGCAGGGGCGG + Exonic
1184925450 22:47633249-47633271 AGGAGACATGGGGGCAGGGGGGG + Intergenic
949549888 3:5104118-5104140 AGGAGGTTAGGGGGAAGAGGAGG - Intergenic
950033051 3:9864454-9864476 ATGAGGCTTGGGGGCTGGGGAGG - Intergenic
952108696 3:30097524-30097546 AGGCAGTTTGGGGGAAGGGGTGG - Intergenic
953269852 3:41430896-41430918 ATGAGGTTTGGGGGTGGGGGTGG + Intronic
953410580 3:42688437-42688459 GGGAGGTTGGGGGGCAGGGTGGG + Intronic
954274684 3:49534399-49534421 AAAAGGTCTGGCGGCTGGGGAGG + Exonic
954900614 3:54016177-54016199 AGGAGATGTGTGGGCAGGGGAGG + Intergenic
956366221 3:68506031-68506053 AGGAGGTGGGGAGGTAGGGGAGG - Intronic
956397530 3:68841688-68841710 AGGGGGTTGGGGGGTAGGGGAGG - Intronic
956525696 3:70157538-70157560 AGTAGTTTTGGTGGCAGGAGAGG + Intergenic
956781391 3:72606083-72606105 AGGGGGTTGGGGGGCAGGTGAGG - Intergenic
957745286 3:84333262-84333284 TGGAGGGTTGGGGGTAGGGGAGG - Intergenic
958532324 3:95349389-95349411 AGGCAGTTTGGGGGAAGGGGTGG - Intergenic
959243592 3:103831956-103831978 AGGAGGTGTGGGGCAAGGGGAGG + Intergenic
959706108 3:109340164-109340186 AGGAGGTGTGGCTGTGGGGGAGG + Intergenic
961037638 3:123653563-123653585 GGGAGGGGTGGCAGCAGGGGAGG + Intronic
961345422 3:126260576-126260598 AGGAGGTTAGGCAGGAGGAGGGG - Intergenic
961726343 3:128933440-128933462 AGGAGGCTTTGGGGCTGGGGAGG - Intronic
962260275 3:133897656-133897678 AGGTGGTATGGCAGTAGGGGAGG + Intergenic
963113171 3:141702910-141702932 AAAAGGTTTGGGGGAAGGGGAGG + Intergenic
964031866 3:152147486-152147508 AGGAGGTTGGGGGCTAGGGGAGG + Intergenic
964376364 3:156052207-156052229 AGGAGGTGGGGTGGCGGGGGAGG - Intronic
965473889 3:169130457-169130479 GGGAGGGCTGGCGGCGGGGGCGG - Intronic
966146390 3:176816881-176816903 AGGATGTTTGTCGCCAGGCGCGG - Intergenic
967864344 3:194177964-194177986 AGGAGATTTGGGTGCAGGGAGGG - Intergenic
968652064 4:1764043-1764065 AGGATGGTTGGGGGCAGAGGAGG + Intergenic
968879173 4:3290385-3290407 AGAAGGGTGGGTGGCAGGGGCGG - Intergenic
968903092 4:3440280-3440302 ACCAGGTGTGGCTGCAGGGGAGG + Intergenic
969401731 4:6960337-6960359 AGCATGTTGGGAGGCAGGGGTGG - Intronic
969761971 4:9193099-9193121 ATGAGGTCTGAAGGCAGGGGAGG - Intergenic
970266170 4:14289005-14289027 AGGATGTATGGTGGCAGGTGGGG - Intergenic
970661322 4:18289075-18289097 GGGGGGTGTGGGGGCAGGGGTGG - Intergenic
971190842 4:24427731-24427753 TGGAGGTGTGGCAGGAGGGGTGG + Intergenic
972132108 4:35850686-35850708 AGGAAGTTTGGAGGTAGGTGAGG - Intergenic
972716931 4:41655882-41655904 AGGAGTTTAGGTGGCAGGAGGGG - Intronic
973012347 4:45092767-45092789 AGGAGGTTTGGGGTCATGGGGGG - Intergenic
975676251 4:76830771-76830793 AGGAGCTGTGGTGGAAGGGGAGG + Intergenic
975683923 4:76901096-76901118 AAGGGCTTTGGGGGCAGGGGCGG + Intergenic
977694209 4:99949223-99949245 AGAAGGTTTGGGGGGCGGGGAGG - Intronic
979698537 4:123640914-123640936 AGGAGGGATGGAGGGAGGGGAGG + Intergenic
980397872 4:132239066-132239088 AGCAGGTTTGGCACCAGTGGGGG + Intergenic
980541479 4:134201631-134201653 AGGAGGCGTGGGGGAAGGGGAGG + Intronic
984439236 4:179745787-179745809 AGGGGGTTGGGGGGAAGGGGAGG + Intergenic
985588457 5:752799-752821 AGGAGGACTGGGGGCAGGGTAGG - Intronic
985603129 5:845254-845276 AGGAGGACTGGGGGCAGGGTAGG - Intronic
985935723 5:3096437-3096459 AGGAGTTTTGGGGGCACAGGTGG - Intergenic
986733004 5:10649146-10649168 AGGAGGCTTGGGGCCAGGGGTGG + Intronic
987335721 5:16896209-16896231 AGCAGTTTGGGAGGCAGGGGTGG + Intronic
987974931 5:25002966-25002988 AGGGGGTGTGGCGCAAGGGGAGG - Intergenic
988993479 5:36693161-36693183 AGGGGGTCTGGCAGAAGGGGAGG - Intergenic
990277410 5:54212759-54212781 AGCATGTTTGGTGGTAGGGGTGG + Intronic
990915918 5:60905854-60905876 AGGTAGTTTGGGGGAAGGGGTGG + Intronic
995530478 5:113087068-113087090 AAGACTTTTGGCGGCAGGGCTGG - Intronic
995618366 5:113993895-113993917 AGGGGGTTGGGAGGAAGGGGAGG - Intergenic
996164932 5:120212262-120212284 AGAAGGCTTGGTGGCAGGAGTGG + Intergenic
996847159 5:127912578-127912600 GGGAGGTTTCTCGGCAAGGGAGG + Intergenic
997631423 5:135372032-135372054 ATTAGCTTTGGGGGCAGGGGCGG + Intronic
997999353 5:138611442-138611464 AGGAGCTTTGGCAGAAAGGGAGG + Intronic
998162446 5:139821306-139821328 AGGAGGATTGGGTGCAGGGGTGG + Intronic
998307736 5:141096140-141096162 AGGAGGTTTGGGTGAAGGCGGGG - Exonic
998310283 5:141123339-141123361 AGGAGGTTTGGGTGAAGGCGGGG - Exonic
998311441 5:141136775-141136797 AGGAGGTTTGGGTGAAGGCGGGG - Exonic
998312725 5:141151595-141151617 AGGAGGTTTGGGTGAAGGCGGGG - Exonic
998313417 5:141157342-141157364 AGGAGGTTTGGGTGAAGGCGGGG - Intergenic
998315482 5:141179381-141179403 AGGAGGTTTGGGTGAAGGCGGGG - Exonic
998316577 5:141188662-141188684 AGGAGGTTTGGGTGAAGGCGGGG - Exonic
998317213 5:141193896-141193918 AGGAGGTTTGGGTGAAGGCGGGG - Exonic
998317888 5:141201118-141201140 AGGAGGTTTGGGTGAAGGTGGGG - Exonic
998320388 5:141224849-141224871 AGGAGGTTTGGGTGAAGGTGGGG - Exonic
998322627 5:141246922-141246944 AGGAGGTTTGGGTGAAGGCGGGG - Exonic
998423628 5:142009374-142009396 AGGGAGTGTGTCGGCAGGGGTGG - Intronic
999141520 5:149365590-149365612 AGGAGATGTGTCAGCAGGGGTGG + Intronic
1000463319 5:161547863-161547885 AGGAGGGATGGCGGCGGGTGGGG - Intronic
1001339889 5:170833670-170833692 GGCAGGGTTGGTGGCAGGGGTGG - Intergenic
1001530370 5:172456924-172456946 AGGAGGTTGGGGGGCAGTGGGGG - Intergenic
1001601909 5:172934446-172934468 AGGAAGGTTGGTGGCAGGGCGGG + Intronic
1002435352 5:179227882-179227904 AGGAGGGTGGAAGGCAGGGGAGG + Intronic
1002784817 6:392765-392787 AGGAGGGGTGGCGGCTGGGTGGG + Intronic
1003240691 6:4343362-4343384 AGAAGGTGGGGAGGCAGGGGAGG + Intergenic
1003392420 6:5725301-5725323 AGGAGCTTTGGAGGCAGGTTGGG + Intronic
1005128216 6:22473080-22473102 AGGGGGGTTGGGGGTAGGGGAGG - Intergenic
1005761275 6:28970216-28970238 TGGAGGCCTGGCGGCAGGGATGG - Intergenic
1005898413 6:30197272-30197294 AGGAGATTTGGAGGCAGGAAAGG - Intronic
1005959313 6:30684687-30684709 AGGAGGTTGGGGGGCAGTTGGGG + Exonic
1006449065 6:34095620-34095642 AGGAGGTTTAGCGGGAGGAATGG - Intronic
1006491508 6:34392246-34392268 AGGAGGTGAGGCGGCAGGCTGGG - Exonic
1009061989 6:58408124-58408146 TGTGGGGTTGGCGGCAGGGGAGG - Intergenic
1010974265 6:82295130-82295152 AGCAGGTTGGGTGGCCGGGGTGG - Intergenic
1012261648 6:97094389-97094411 AGAAGTTTTGGAGGCAAGGGTGG - Intronic
1012991039 6:105926210-105926232 AGGAGGATTGGCAGTAGGTGTGG + Intergenic
1013045052 6:106477314-106477336 AGGAGGTTTAGAGGCAGAAGAGG + Intergenic
1013068147 6:106703668-106703690 TGGTGGGTTGGCGACAGGGGTGG + Intergenic
1013273633 6:108562653-108562675 AGGAGGTTTGGGGGCTGGGCCGG + Intronic
1013350156 6:109298312-109298334 AAGAGGCTTGGTGGGAGGGGAGG - Intergenic
1014989886 6:128061547-128061569 TGGGGGTTGGGAGGCAGGGGAGG + Intronic
1015771471 6:136772463-136772485 AGGATGGTTGGGGGCAGTGGCGG + Intronic
1016502580 6:144738365-144738387 TGGAGGTTTGGGGGTAGGGGTGG - Intronic
1017235869 6:152117177-152117199 AGGAGGTGTGGGGCAAGGGGTGG + Intronic
1018341024 6:162851141-162851163 AGGAGGTTCAGTGGCAGGTGGGG - Intronic
1018422349 6:163650311-163650333 AGGAGGTGGGCCAGCAGGGGAGG + Intergenic
1018723907 6:166596122-166596144 AGGAGGTTTGGAAGGCGGGGCGG + Intronic
1018785042 6:167101688-167101710 AGGAGAGTTGGAGGCAGGGATGG + Intergenic
1018901632 6:168054565-168054587 AGGAGGGTGGGGGGCAGGGCTGG - Intergenic
1018913593 6:168118833-168118855 AGTAGATTTGGCGTCTGGGGAGG - Intergenic
1018940934 6:168308552-168308574 AGCAGGGGTGCCGGCAGGGGCGG - Exonic
1019276845 7:180219-180241 AGGAGGGAGGGAGGCAGGGGAGG + Intergenic
1019795800 7:3047419-3047441 AGGAGGTTGGGAGGCCGAGGCGG - Intergenic
1020101127 7:5394887-5394909 GGCTGGTTGGGCGGCAGGGGTGG - Intronic
1020695919 7:11413949-11413971 AGGCAGTTTGGGGGAAGGGGTGG - Intronic
1021452198 7:20793508-20793530 AGGGGGTGTGGTGGCAGTGGGGG + Intergenic
1021774357 7:24037801-24037823 AGGAGGTTGGGAGGCCGAGGTGG + Intergenic
1022988671 7:35685833-35685855 AGCAGGTGTGGTGGCAGGTGTGG + Intronic
1023299860 7:38758739-38758761 TGGAGGTTGTGGGGCAGGGGTGG - Intronic
1023355909 7:39366788-39366810 AGGAGTTGGGGAGGCAGGGGAGG + Intronic
1023821940 7:43985479-43985501 GGGAGGTGTGGGGGCAGGAGGGG - Intergenic
1024638436 7:51309866-51309888 AGGAGGTTTTCGGACAGGGGAGG + Intronic
1025066528 7:55860844-55860866 AGCAGGTTTGGTGTCAGGTGGGG - Intronic
1025084210 7:56009530-56009552 AGGTGGTGGGGCGGCAGGGGTGG - Intergenic
1026504384 7:70969803-70969825 AGGAGGTGTGGTTGCTGGGGAGG + Intergenic
1026884657 7:73932904-73932926 AGAAAGTTTGGGGGCAGGGCAGG - Intergenic
1027191459 7:75998543-75998565 AGCAGGTTGGGAGGCAGAGGTGG - Intronic
1027219342 7:76204065-76204087 AAGAGGTTGGGAGGCAGAGGAGG - Intronic
1027239621 7:76318489-76318511 AGGTGGGTTGGAGGCGGGGGTGG + Intergenic
1029737173 7:102471449-102471471 AGGGGCCTTGGCGGCAGAGGTGG + Intronic
1029750204 7:102538892-102538914 GGGAGGTGTGGGGGCAGGAGGGG - Intronic
1029768155 7:102638000-102638022 GGGAGGTGTGGGGGCAGGAGGGG - Intronic
1030005845 7:105119015-105119037 AGGAGGTCTGTGGGCAGGGGTGG - Intronic
1030438780 7:109559072-109559094 AGCAGATTTGGTGGCAGGTGAGG + Intergenic
1032895307 7:136244085-136244107 GGGAGGTTGGGAGGAAGGGGAGG - Intergenic
1033286097 7:140041719-140041741 TGGAGGTTTGGTGACAGAGGAGG + Exonic
1034105862 7:148489210-148489232 AGGACTTTTGGAGGCAGAGGTGG - Intergenic
1034366026 7:150548632-150548654 AGGAGGTTGGGGGCAAGGGGAGG + Intergenic
1034670397 7:152853324-152853346 GGGGGATTTGGCAGCAGGGGCGG + Intronic
1034940981 7:155230179-155230201 TGGAGGGTTTGGGGCAGGGGCGG - Intergenic
1035771858 8:2153900-2153922 ATCTGGCTTGGCGGCAGGGGAGG - Intronic
1036431871 8:8699325-8699347 AGGAGATGAGGCGGCAGGGAGGG + Intergenic
1036490214 8:9218208-9218230 AGGAGGTTTGGGTGGAGAGGCGG + Intergenic
1036493020 8:9245125-9245147 AGGAGGTTTTGCAGCAGTGCAGG + Intergenic
1036542791 8:9735092-9735114 AGGAGGCTTGGAGGCACTGGGGG - Intronic
1036744254 8:11392910-11392932 GGGAGGCTTGGCCACAGGGGTGG + Intronic
1036985660 8:13526771-13526793 AGGGGGTTGGGGGACAGGGGAGG + Intergenic
1038495495 8:27999323-27999345 AGGAGGCTAGTGGGCAGGGGTGG - Intergenic
1038503790 8:28067160-28067182 AAGAGGTTTGGGGGCAGTAGGGG - Intronic
1039498409 8:37998484-37998506 AGGAGGTTTGGGGTCGGCGGGGG - Intergenic
1040662851 8:49595941-49595963 AGGAAGTGTGGGGGCAGGTGAGG + Intergenic
1041484442 8:58359088-58359110 AGGAGCTTAGGCCACAGGGGTGG - Intergenic
1043268597 8:78300058-78300080 AGGCGGTGTGGGGCCAGGGGAGG + Intergenic
1043480479 8:80647600-80647622 ACTAGGTATGGCGGCAGTGGTGG + Intronic
1044594617 8:93946729-93946751 AGGAGGTTGGGGGCTAGGGGAGG - Intergenic
1044870955 8:96619525-96619547 AGGAGGTTTGGGGGTATGTGGGG - Intergenic
1045405516 8:101863134-101863156 AGGAGGTTTGGGAGCTGGGTGGG - Intronic
1045680897 8:104658783-104658805 AGGAGGTTTGGGGAAAGGTGAGG - Intronic
1047779686 8:128101130-128101152 AGGCAGTTTGGGGGAAGGGGTGG - Intergenic
1048952728 8:139509614-139509636 AGGAGGTTGGTCCCCAGGGGAGG - Intergenic
1049219036 8:141420528-141420550 AAGAGGGGAGGCGGCAGGGGGGG - Intronic
1049587341 8:143438135-143438157 AGGAGCTTTGCAGGCTGGGGAGG - Intronic
1049720553 8:144113584-144113606 GGGGGTTTTGCCGGCAGGGGAGG + Intronic
1050421190 9:5466987-5467009 AGGAGGTTTAGGAGCAGGGAAGG + Intronic
1051562708 9:18459917-18459939 AGGAAGGTAGGCTGCAGGGGTGG + Intergenic
1053154285 9:35764637-35764659 AGGAAATTTGGGGGCAGTGGTGG - Intergenic
1056292731 9:85160334-85160356 GGGAGGGTGGGAGGCAGGGGAGG - Intergenic
1056292871 9:85161305-85161327 GGGAGGGTGGGAGGCAGGGGAGG - Intergenic
1056700392 9:88900876-88900898 AGCAGGTTTGGTGTCTGGGGGGG + Intergenic
1056914055 9:90729749-90729771 AGGGGGCATGGCGGCAGGGGTGG - Intergenic
1057284327 9:93737724-93737746 AGGGGATTTGGGGGAAGGGGAGG + Intergenic
1057410241 9:94811460-94811482 AAGAGGTCTGGGGGCAGGGAGGG - Intronic
1058952553 9:109917114-109917136 AGGAGGGGTGGCTGCAGGGAAGG + Intronic
1060245416 9:121941899-121941921 AGAGTGTTTGGAGGCAGGGGTGG - Intronic
1060681937 9:125573782-125573804 AGGAGGCATTGGGGCAGGGGAGG - Intronic
1060732539 9:126047755-126047777 AGCAGGCTTGGTGGGAGGGGAGG - Intergenic
1060750700 9:126166502-126166524 AGGAGGCTCGGTGGCAGGGAAGG + Intergenic
1060895243 9:127212833-127212855 AGGTGGGAAGGCGGCAGGGGAGG + Intronic
1061194098 9:129098194-129098216 AGGAGACCTGGGGGCAGGGGAGG - Intronic
1061363348 9:130157480-130157502 AGTAGGTGGGGCGGGAGGGGCGG - Intergenic
1061485962 9:130920669-130920691 AGGAGGTTTGGCGGCAGGGGAGG - Intronic
1061853545 9:133429426-133429448 AGGAGGGTAGGATGCAGGGGTGG - Intronic
1061972108 9:134050425-134050447 AGGAGGTGGGGCGGCAGCTGGGG + Exonic
1062008627 9:134255020-134255042 AGGGGGTTTGGCGGGGGGCGAGG + Intergenic
1062014224 9:134283171-134283193 GGGAGGGTTGGCAGCAGAGGCGG - Intergenic
1062032012 9:134366022-134366044 GGGAGGGGTGGAGGCAGGGGTGG - Intronic
1062354952 9:136157550-136157572 AGGAGGGCTGGGGGCATGGGAGG - Intergenic
1203524696 Un_GL000213v1:76033-76055 AGCAGGGTGGGGGGCAGGGGTGG + Intergenic
1185850408 X:3480695-3480717 TGCAGGTTTGGGGCCAGGGGTGG - Intergenic
1185978624 X:4749863-4749885 AGGCAGTTTGGAGGAAGGGGTGG - Intergenic
1186032245 X:5380712-5380734 AGGCAGTTTGGGGGAAGGGGTGG - Intergenic
1186055845 X:5649052-5649074 AGGCAGTTTGGGGGAAGGGGTGG + Intergenic
1186479866 X:9888321-9888343 AGGAGGTTGGGCGACAGCTGGGG + Intronic
1186984387 X:14996415-14996437 AGTAGGGTAGGGGGCAGGGGAGG - Intergenic
1187013428 X:15302887-15302909 AGGAGGTTTGGGGGAAGAGGAGG + Intronic
1188048030 X:25450567-25450589 AGGGGGTTTGGGGTTAGGGGAGG + Intergenic
1189002180 X:36958369-36958391 AGGAGGAATGGCCACAGGGGAGG - Intergenic
1189232915 X:39466098-39466120 GGGAAGTGTGGTGGCAGGGGTGG - Intergenic
1189626840 X:42907131-42907153 AGGAGGATTGGAGGTAGGTGAGG + Intergenic
1190024630 X:46912460-46912482 AGGCGGTTGGGCGGCGGCGGCGG - Exonic
1190257578 X:48775010-48775032 AGGAGGGTTGTGGGCAGAGGAGG + Intergenic
1191004695 X:55698723-55698745 AGGCAGTTTGGGGGAAGGGGTGG - Intergenic
1191184280 X:57592721-57592743 AGGAGGTCTGGCGGCAGCTCTGG - Exonic
1192414853 X:70970016-70970038 AGGTAGTTTGGGGGAAGGGGTGG + Intergenic
1192494641 X:71607333-71607355 AGGAAGTTGGGCTGCAGAGGGGG - Intronic
1194641260 X:96406370-96406392 AGGCAGTTTGGGGGAAGGGGTGG - Intergenic
1195722590 X:107880435-107880457 AGGTAGTTTGGGGGAAGGGGTGG + Intronic
1198963929 X:142208072-142208094 AGCAGGCATGGGGGCAGGGGAGG + Intergenic
1199603111 X:149554974-149554996 AGAAGGTTTGGGGGAAGGGTGGG - Intergenic
1199647277 X:149924501-149924523 AGAAGGTTTGGGGGAAGGGTGGG + Intergenic
1199680301 X:150219877-150219899 AGGGGCTCTGGAGGCAGGGGAGG - Intergenic
1199858501 X:151779327-151779349 AGGAATTTGGGCGGCAGCGGGGG + Intergenic
1200032223 X:153306152-153306174 AGGTGGCTTGGGGGCAAGGGCGG - Intergenic
1200149434 X:153944083-153944105 AGTATGTGTGGCTGCAGGGGAGG - Exonic
1200300098 X:154965562-154965584 AGGAGGATGGGAGGAAGGGGAGG - Intronic
1200909610 Y:8518076-8518098 AGGGGGTTGGGGGGCTGGGGAGG + Intergenic
1201438589 Y:13985465-13985487 AGGAGGTTTGTGGGGAGGGAGGG - Intergenic
1201445984 Y:14057243-14057265 AGGAGGTTTGTGGGGAGGGAGGG + Intergenic
1202031087 Y:20575188-20575210 AGGAATTTGGGCGGCAGAGGCGG + Intergenic