ID: 1061485963

View in Genome Browser
Species Human (GRCh38)
Location 9:130920672-130920694
Sequence TTAAGGAGGTTTGGCGGCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 117}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061485963_1061485973 10 Left 1061485963 9:130920672-130920694 CCCCTGCCGCCAAACCTCCTTAA 0: 1
1: 0
2: 1
3: 11
4: 117
Right 1061485973 9:130920705-130920727 CCAGTAGCACCAAGCCACCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061485963 Original CRISPR TTAAGGAGGTTTGGCGGCAG GGG (reversed) Intronic
900411810 1:2515974-2515996 TTGGGGAGGTGTGGCTGCAGCGG - Intronic
901627271 1:10631395-10631417 TTAAGAAGGGTTTGCTGCAGGGG - Intergenic
901963133 1:12843252-12843274 TTAAGCAGGCATGGTGGCAGAGG + Intergenic
903104708 1:21066217-21066239 TTAAAGAGTTATGGCGGGAGGGG + Intronic
903687765 1:25144786-25144808 TAAAGGAGGAGTGGGGGCAGAGG + Intergenic
904538985 1:31219970-31219992 TGAAGCAGGTTTAGCAGCAGTGG - Intronic
907403799 1:54241556-54241578 TCAGGGAGGTTTGGCAGCTGAGG - Intronic
909149886 1:71988287-71988309 TAAAGGAGGTTGGGAGGCCGAGG + Intronic
909850136 1:80451323-80451345 TTCAGTAGCTTTGGTGGCAGTGG - Intergenic
914232823 1:145780079-145780101 TTAGCCAGGTTTGGCGGCGGGGG + Intronic
914428686 1:147600415-147600437 TTGAGCCGGTTTGGGGGCAGGGG + Intronic
914931327 1:151936583-151936605 TTAAGTATTTTTGGGGGCAGGGG - Intergenic
915484278 1:156209410-156209432 TGAAGGAGGTAGGGCGGAAGCGG + Intronic
918897831 1:190370623-190370645 TAGAGGATATTTGGCGGCAGTGG + Intronic
921417793 1:214910762-214910784 TAATGGAGGTTTGGAGGTAGTGG + Intergenic
922758187 1:228108248-228108270 GTAAGGAGGAATGGCGGCCGTGG - Exonic
1063540437 10:6928142-6928164 TTAGGGAAGTGTGGCGGCCGAGG - Intergenic
1068788083 10:60999164-60999186 TAAAGGAGGAGTGGCGGCAGAGG + Intronic
1069070699 10:63988110-63988132 TTAAGCTTGTGTGGCGGCAGGGG - Intergenic
1075783342 10:125031539-125031561 TTGAGGACGTTCGGGGGCAGGGG - Intronic
1082214725 11:49555387-49555409 TTAAGGGGGTTTACAGGCAGAGG - Intergenic
1084199589 11:67546758-67546780 TTACGGAGGCTTGATGGCAGCGG - Intergenic
1085116932 11:73937958-73937980 TTAAACAGGTGTGGTGGCAGGGG - Intergenic
1085292846 11:75412302-75412324 TTAAGGAGGTATTGTGGCACTGG + Intronic
1086634863 11:89069075-89069097 TTAAGGGGGTTTACAGGCAGAGG + Intergenic
1090716168 11:129433370-129433392 CTAAGGAGGTTGGACTGCAGGGG - Intronic
1103206209 12:119130950-119130972 TTAATGAGGTCTGGAGCCAGTGG - Intronic
1104841085 12:131826266-131826288 TTATGGAGCTTGGGCGACAGTGG - Intergenic
1104887098 12:132117169-132117191 CTGAGGAGGGTTGGTGGCAGAGG + Intronic
1105546469 13:21354506-21354528 TTAAGGAGATGTGGCTGCAGAGG - Intergenic
1109310155 13:60683900-60683922 TTGAGGAGGTATGCCAGCAGGGG + Intergenic
1113228371 13:108183440-108183462 TTATGGAGATTTGCAGGCAGAGG + Intergenic
1114399399 14:22395591-22395613 TAGAGGAGATTTGGGGGCAGTGG + Intergenic
1116763480 14:49042709-49042731 TTAAGGATGCTTGGCGGTGGTGG + Intergenic
1117268394 14:54114870-54114892 TAAAGGAGGTATGGCAGCTGTGG - Intergenic
1117914019 14:60658279-60658301 TTGAGGCGCTCTGGCGGCAGAGG - Intergenic
1121550489 14:94795983-94796005 AGAAGGAGGGTTGGAGGCAGGGG + Intergenic
1122157109 14:99756261-99756283 TTAAGGGGGTTTGGTGGTGGGGG + Intronic
1125241046 15:37576273-37576295 TGAAGGGGGTTAGGGGGCAGAGG - Intergenic
1132587830 16:713943-713965 GGCAGGAGGTTTGGGGGCAGGGG + Intronic
1142135138 16:88448512-88448534 ATAAGGAGGTCAGGCGGCAGCGG - Intergenic
1143916583 17:10298072-10298094 TTGAGGAGGATTGGCAGCAGCGG - Exonic
1149437262 17:56643914-56643936 TTAAGAAGCTTTGGTGGCAGGGG + Intergenic
1149997166 17:61411405-61411427 TTAAGGAGGCCTTGCGGCACCGG - Intergenic
1150833560 17:68543970-68543992 TTAAGAAGCTTTGGTGACAGTGG + Intronic
1151360067 17:73583539-73583561 TTCTTGAGGTTTGGGGGCAGTGG - Intronic
1151743197 17:75997724-75997746 TTTAGGAGGTTTGTCTGCAAAGG - Intronic
1151912546 17:77093506-77093528 TAAAGGAACTTTGGCTGCAGAGG + Intronic
1151973442 17:77470982-77471004 TTGAGGAGGTCTGGAAGCAGTGG - Intronic
1152916231 17:83037571-83037593 TGATGGAGGCTTGGCTGCAGCGG - Intronic
1153255054 18:3162249-3162271 TAAAGGAGGTGTGGCTGAAGTGG - Intronic
1156483907 18:37452877-37452899 TTAAGAAGGGGTGGGGGCAGTGG - Intronic
1164228648 19:23268457-23268479 TTAAGTAGGTTTGGGCACAGTGG + Intergenic
1164912542 19:32024801-32024823 TCCAGTAGGTTTGGGGGCAGGGG - Intergenic
1166855194 19:45779826-45779848 TTAAGGAGGTCCGACTGCAGAGG - Exonic
1167502695 19:49856679-49856701 GTCAGGAGGGCTGGCGGCAGGGG + Intronic
1168094883 19:54108828-54108850 TTAAGGAACTCTGGAGGCAGGGG - Intronic
925046232 2:774549-774571 TTGAGGTGGTGTGGAGGCAGGGG + Intergenic
928245925 2:29626939-29626961 TTAGGGATGTTTGGCAGCTGGGG - Intronic
929427282 2:41856162-41856184 TTCAGGAGGTTTGATGGCATGGG - Intergenic
932498475 2:72159627-72159649 CTAAGGAGGCTTGGAGGGAGTGG + Intergenic
933006475 2:77001903-77001925 TTAAGGAGGTTTAACAGGAGGGG - Intronic
933113418 2:78433933-78433955 TCGGGGAGGTTTGGAGGCAGAGG + Intergenic
933876611 2:86626391-86626413 GTCCGGAGGTTTAGCGGCAGCGG + Intronic
934946436 2:98545850-98545872 ATAAGCAGGTATGTCGGCAGTGG - Intronic
935435130 2:103022512-103022534 TTAAGGATGTTTGGTAGAAGAGG + Intergenic
935728730 2:106047037-106047059 CTAAGGAGGTATGGGGGGAGGGG - Intergenic
939494340 2:142910281-142910303 TTAGCCAGGTTTGGTGGCAGAGG - Intronic
940052464 2:149478964-149478986 TTCAAGAGGTTTGGCTGTAGAGG - Intergenic
940391518 2:153137916-153137938 TCAAGGAGGTTTGGTTGAAGAGG - Intergenic
946563299 2:220936999-220937021 AAAAGGAGGTTTGGGGGAAGGGG + Intergenic
947981306 2:234412256-234412278 TTAGGGAGTTCTGGAGGCAGAGG + Intergenic
1170616805 20:17959898-17959920 TTAAGGGGGGATGGAGGCAGAGG - Intronic
1171448631 20:25221474-25221496 TGAAGGTGGTTTGGCTGCAGGGG + Intronic
1177212493 21:18087889-18087911 TACAGGAGGCTTGGCTGCAGAGG + Intronic
1177280099 21:18970915-18970937 TAAAGGAGCTTTGGAGACAGTGG + Intergenic
1178795864 21:35743702-35743724 TTAAGTACTTTTGGCTGCAGAGG - Intronic
1183026054 22:35066654-35066676 CAGAGGAGGTTTGGAGGCAGGGG - Exonic
951642386 3:24850561-24850583 TTTAGCATGTTTGGGGGCAGAGG + Intergenic
952076276 3:29701561-29701583 GTAAGGAGGTGTGGAGGGAGAGG + Intronic
955722639 3:61899702-61899724 TTCAGTAGATTTGGGGGCAGGGG + Intronic
956630969 3:71316246-71316268 TTCAGGAGGCTTGGGGGCAAGGG - Intronic
961147067 3:124603104-124603126 GTTAAGAGCTTTGGCGGCAGAGG - Intronic
964154573 3:153569413-153569435 TTAAGGAGTTTTGGGGGCAGGGG - Intergenic
967158236 3:186712798-186712820 TTATGGCTGTTTGGGGGCAGAGG + Intergenic
969146698 4:5130346-5130368 GTGGGGAGGTTTGGCGGGAGGGG + Intronic
969241420 4:5901025-5901047 TGTCGGAGGTGTGGCGGCAGTGG - Intronic
975619959 4:76286725-76286747 TTAAGGAGATTTTGGGGCTGAGG + Intronic
977466608 4:97390081-97390103 GTAAGGTGGTGTGACGGCAGTGG + Intronic
980397869 4:132239063-132239085 TTCAGCAGGTTTGGCACCAGTGG + Intergenic
984169059 4:176339391-176339413 TTAAAGTGGGTTGGAGGCAGGGG + Intergenic
985935724 5:3096440-3096462 TTCAGGAGTTTTGGGGGCACAGG - Intergenic
988489174 5:31692340-31692362 TCAGGGAGGTTTGGAGGGAGAGG - Intronic
990277409 5:54212756-54212778 TTAAGCATGTTTGGTGGTAGGGG + Intronic
992812208 5:80400245-80400267 GTAAGGAGGTTTGGTGTCTGGGG + Intergenic
1001135887 5:169102269-169102291 ATCAGGAGATTTGGCTGCAGTGG - Intronic
1001530373 5:172456927-172456949 TGGAGGAGGTTGGGGGGCAGTGG - Intergenic
1001708020 5:173756099-173756121 TTGAAGAAGTTTGGTGGCAGGGG - Intergenic
1002581775 5:180213007-180213029 TGGAGGAGGTCTGGAGGCAGCGG + Intergenic
1005682312 6:28218897-28218919 CTTAGGAGGTTGGGCGGCTGGGG + Intergenic
1005938787 6:30545661-30545683 ATGAGCAGGTCTGGCGGCAGGGG + Exonic
1010860534 6:80904371-80904393 TGAAGAAGGATTGGCAGCAGTGG - Intergenic
1013525335 6:110968808-110968830 TTATGGAGGTTTTGGGGTAGGGG + Intergenic
1016931225 6:149412275-149412297 TTAAAGGGGTTTGGGGGTAGAGG + Intergenic
1021132182 7:16924551-16924573 TTAACGAGGTGTGGTGGCAGGGG - Intergenic
1021774356 7:24037798-24037820 TTAAGGAGGTTGGGAGGCCGAGG + Intergenic
1030005846 7:105119018-105119040 CTAAGGAGGTCTGTGGGCAGGGG - Intronic
1032597649 7:133257721-133257743 TCAAGGAGGTTTGAAGGCAGTGG + Intronic
1032708282 7:134441018-134441040 TTTAGGAGCCTTGCCGGCAGTGG - Intergenic
1034350962 7:150414506-150414528 TTAAGGAGGTTTGGGCACTGTGG - Intergenic
1034670396 7:152853321-152853343 TTAGGGGGATTTGGCAGCAGGGG + Intronic
1038719578 8:30021839-30021861 TCATGGAGGTTAGGAGGCAGTGG + Intergenic
1039547472 8:38420476-38420498 TTAAGGAAATGTGGCGGCAGGGG + Intronic
1039869748 8:41535770-41535792 TTATGGAGTTTTGGAGCCAGAGG - Intronic
1044404075 8:91807352-91807374 TTCAGGAGGGATGGTGGCAGAGG - Intergenic
1047363155 8:124187824-124187846 TAAAGGGGGTTTGGCAGGAGGGG - Intergenic
1047611526 8:126525812-126525834 TTAACCAGGTATGGTGGCAGGGG - Intergenic
1048410530 8:134168069-134168091 TAAAGGAGGTTTGCTGGCAGTGG + Intergenic
1049253199 8:141600243-141600265 TAAAGGAGGAGTGGTGGCAGAGG + Intergenic
1051281583 9:15446763-15446785 TCCAGTAGGTTTGGTGGCAGAGG + Intronic
1053154286 9:35764640-35764662 ATAAGGAAATTTGGGGGCAGTGG - Intergenic
1054863944 9:69980841-69980863 TTAAGGAATTTTGGGGGAAGAGG - Intergenic
1055340427 9:75275963-75275985 TGAAGGATGTATGGTGGCAGGGG - Intergenic
1056367187 9:85917303-85917325 TTAAGTGGGTGTGGTGGCAGGGG + Intergenic
1057618999 9:96619063-96619085 TAAAGGGGGTGTGGCGGCCGGGG + Intronic
1057810768 9:98255366-98255388 TTAAGTAAGTTCGGCGGCAAAGG - Exonic
1061485963 9:130920672-130920694 TTAAGGAGGTTTGGCGGCAGGGG - Intronic
1190257577 X:48775007-48775029 TGAAGGAGGGTTGTGGGCAGAGG + Intergenic
1195292627 X:103443931-103443953 TGAAGCAGGGTGGGCGGCAGGGG - Intergenic
1196184000 X:112726018-112726040 TTAAGTAGGATTGGCTGCAAGGG - Intergenic