ID: 1061485964

View in Genome Browser
Species Human (GRCh38)
Location 9:130920673-130920695
Sequence TTTAAGGAGGTTTGGCGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 86}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061485964_1061485973 9 Left 1061485964 9:130920673-130920695 CCCTGCCGCCAAACCTCCTTAAA 0: 1
1: 0
2: 1
3: 8
4: 86
Right 1061485973 9:130920705-130920727 CCAGTAGCACCAAGCCACCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061485964 Original CRISPR TTTAAGGAGGTTTGGCGGCA GGG (reversed) Intronic
902543693 1:17172915-17172937 TTTAGGGAGGGTTTGTGGCATGG + Intergenic
902600711 1:17539169-17539191 TTCTTGGAGGTTTGGCTGCATGG + Intergenic
903104707 1:21066216-21066238 TTTAAAGAGTTATGGCGGGAGGG + Intronic
913505891 1:119515946-119515968 TTTAAGGGGATTTGGAGGGAAGG - Intergenic
913686501 1:121236974-121236996 TATAAAGAGGCTTGGCAGCAGGG + Intronic
914038352 1:144024614-144024636 TATAAAGAGGCTTGGCAGCAGGG + Intergenic
914151103 1:145043294-145043316 TATAAAGAGGCTTGGCAGCAGGG - Intronic
914428685 1:147600414-147600436 TTTGAGCCGGTTTGGGGGCAGGG + Intronic
914931328 1:151936584-151936606 TTTAAGTATTTTTGGGGGCAGGG - Intergenic
920473824 1:206255528-206255550 TATAAAGAGGCTTGGCAGCAGGG + Intronic
922318008 1:224459376-224459398 TATAATGAGGTTTGGCTCCATGG - Intronic
923967596 1:239159079-239159101 ATTCAGGAGGTTTGTGGGCATGG + Intergenic
1065204872 10:23347687-23347709 CTCAAGGACATTTGGCGGCAAGG - Intergenic
1067946704 10:50693995-50694017 TTTAAGGAGGCTGGCCTGCAGGG - Intergenic
1069070700 10:63988111-63988133 TTTAAGCTTGTGTGGCGGCAGGG - Intergenic
1069215081 10:65810182-65810204 TTTAAGGAGTTCTGGCAACAAGG + Intergenic
1070882011 10:79858988-79859010 TTTAAGGAGGCTGGCCTGCAGGG - Intergenic
1071648585 10:87375299-87375321 TTTAAGGAGGCTGGCCTGCAGGG - Intergenic
1080762901 11:35269722-35269744 TTCAAGGAGATTTGATGGCATGG - Intronic
1085266294 11:75240035-75240057 TCTTAAGAGGTTTGGGGGCAGGG + Intergenic
1100290049 12:93205035-93205057 TTTTAGGACGATTGGCAGCAGGG - Intergenic
1106224868 13:27777522-27777544 TTTCCGGAGGTTTGGGGGGAAGG - Intergenic
1110921636 13:81094949-81094971 TTTAAGGAGGTTGGGGGAGAAGG - Intergenic
1110953989 13:81529850-81529872 TTTAAGGTGGTTTGGTGGGCAGG - Intergenic
1122453875 14:101834592-101834614 TTTAAAGAGATTTGGAGGCCAGG - Intronic
1125551161 15:40545867-40545889 ATGAATGAGGTGTGGCGGCAAGG - Intronic
1128012579 15:64311871-64311893 CTTAAGGAGATTTTGAGGCATGG - Intronic
1131804841 15:96110349-96110371 CTTAAGAAGTTTTGGAGGCAAGG - Intergenic
1132587829 16:713942-713964 TGGCAGGAGGTTTGGGGGCAGGG + Intronic
1132713933 16:1281357-1281379 TTTAAAGAGGTCTGGCAGCCAGG - Intergenic
1139484628 16:67248720-67248742 TTTGGGGAGGTTTGGGGGCGCGG + Intronic
1141294831 16:82757942-82757964 TTTAAGAAGCTGTGGCGGCCAGG - Intronic
1144078028 17:11736483-11736505 TTTCAGGATGCTTGGAGGCAGGG - Intronic
1149437261 17:56643913-56643935 GTTAAGAAGCTTTGGTGGCAGGG + Intergenic
1151597326 17:75086539-75086561 TTTAAGCAGGGTTGGCAGTAGGG + Intergenic
1153964464 18:10167310-10167332 ATTAACCAGGTGTGGCGGCATGG + Intergenic
1164703351 19:30302107-30302129 ATTAAGAAGGTTTGGGGGTAAGG + Intronic
925046231 2:774548-774570 TTTGAGGTGGTGTGGAGGCAGGG + Intergenic
927667831 2:25044432-25044454 AGTAAGGAGGTTTGGGGGCGGGG + Intronic
928245926 2:29626940-29626962 TTTAGGGATGTTTGGCAGCTGGG - Intronic
929427283 2:41856163-41856185 TTTCAGGAGGTTTGATGGCATGG - Intergenic
931400370 2:61925634-61925656 TGTAAAGAGGTTTGGGGGAAGGG + Intronic
933006476 2:77001904-77001926 TTTAAGGAGGTTTAACAGGAGGG - Intronic
941726339 2:168864741-168864763 TTTAAGGAGGTTCTGCTTCAAGG - Intronic
942035299 2:172004618-172004640 TATAAGTTGGTTTGGCGGCTGGG - Intronic
946300404 2:218820418-218820440 TTTAAGGAGGTCTGGGAGAAGGG + Intergenic
947854197 2:233312216-233312238 TTTCAAAAGGTTTGGCTGCAAGG - Intronic
948024260 2:234764520-234764542 TTTAAGGAGGTTTGGTTGAATGG + Intergenic
1169762174 20:9107882-9107904 TTTAACGAGGTTTGGAGGGATGG + Intronic
1171448630 20:25221473-25221495 GTGAAGGTGGTTTGGCTGCAGGG + Intronic
1174285992 20:49473992-49474014 TTTAAGGAGCATTGGCGCCCTGG + Intronic
1175231353 20:57475379-57475401 TTAAATGAGGTTTGGCTACAAGG + Intergenic
1177849582 21:26330607-26330629 TTTAGCCAGGTGTGGCGGCACGG - Intergenic
1178272009 21:31199431-31199453 TTTGAGGAGGATTGGCGGAGAGG - Intronic
1182920213 22:34072450-34072472 TTGAAGGAGGTTTGGTGTCTTGG - Intergenic
1182956543 22:34432050-34432072 TTTAAGGAGTTTTGGAGGCAAGG - Intergenic
1184024770 22:41847096-41847118 TTTAGGGAGATTTGGGGGCATGG + Intronic
1184082173 22:42230139-42230161 TTTAAGGTGTTTGGGAGGCAGGG - Intronic
950571366 3:13802145-13802167 ATAAAGGAGGTTGGGCGGCGTGG - Intergenic
956630970 3:71316247-71316269 GTTCAGGAGGCTTGGGGGCAAGG - Intronic
964154574 3:153569414-153569436 CTTAAGGAGTTTTGGGGGCAGGG - Intergenic
964691060 3:159450594-159450616 TTGAAGAAGCTTTGGGGGCAGGG - Intronic
965262574 3:166503837-166503859 TTTTAGGAGGTTTAGCAGCCTGG + Intergenic
967261283 3:187645121-187645143 TTTAAGGTGGCTTGGCAGCAGGG - Intergenic
967351906 3:188523256-188523278 TTGAAGTAGGTTTGGCTCCAAGG + Intronic
970410923 4:15807177-15807199 TTTTAGGAGATTTGGGGGAAAGG + Intronic
974841664 4:67306438-67306460 TTTAAGGAGGTGTGACTGCCTGG + Intergenic
987093263 5:14525942-14525964 TTTCAGGAGGTTTACTGGCAGGG - Intronic
992812207 5:80400244-80400266 TGTAAGGAGGTTTGGTGTCTGGG + Intergenic
993546363 5:89218026-89218048 TTTTAGGGGGTTTGGGGGGAAGG - Intergenic
997632029 5:135376021-135376043 TTTCAGGAGGTTGAGTGGCAGGG + Intronic
998175411 5:139898869-139898891 CTTAAGGAGGTGTGGAGGCTTGG - Intronic
1004635039 6:17459008-17459030 TTTAAGGCGTTTTGGGGACAGGG - Intronic
1013525334 6:110968807-110968829 TTTATGGAGGTTTTGGGGTAGGG + Intergenic
1021132183 7:16924552-16924574 ATTAACGAGGTGTGGTGGCAGGG - Intergenic
1022264125 7:28736731-28736753 TTTCAGGAGGTGTGGACGCATGG + Intronic
1023203518 7:37723611-37723633 CATAAGGAGGCTTGGAGGCAAGG + Intronic
1023207587 7:37767481-37767503 TTTAAGGAGTTTTGGGGGGGAGG - Intronic
1027747814 7:82099742-82099764 TTTAAGAAGGTATTGCGGCCGGG - Intronic
1032553190 7:132805023-132805045 TCCAAGGAAGTTTGGCAGCATGG - Intronic
1033587250 7:142783184-142783206 TTTAAGGAGTCTTGGGGGCGCGG + Intergenic
1034996697 7:155581796-155581818 TTTAAGGAGTTTTTGAGGCAAGG + Intergenic
1039547471 8:38420475-38420497 CTTAAGGAAATGTGGCGGCAGGG + Intronic
1039603189 8:38859090-38859112 TTTAAGGCAGTTTGCAGGCAGGG + Intergenic
1043941764 8:86204404-86204426 TTTAAGAAGGATTGGGGGCCAGG + Intergenic
1052245640 9:26330605-26330627 TTTAATGATGCTTGGGGGCAGGG - Intergenic
1052734966 9:32332546-32332568 TTTAAGGAGGTCTGTTTGCAAGG + Intergenic
1056367186 9:85917302-85917324 TTTAAGTGGGTGTGGTGGCAGGG + Intergenic
1058220569 9:102295493-102295515 TCTAAGGAGGTTTTACAGCAAGG - Intergenic
1060764073 9:126280788-126280810 TTTAAGGTGCTTGGGAGGCATGG + Intergenic
1061485964 9:130920673-130920695 TTTAAGGAGGTTTGGCGGCAGGG - Intronic
1185864627 X:3612542-3612564 TTTAAGAAGGTGAGGCGGGAGGG + Intronic
1190866000 X:54385099-54385121 TTTATGGAGGTTTGGAGGCTGGG + Intergenic
1196184001 X:112726019-112726041 CTTAAGTAGGATTGGCTGCAAGG - Intergenic
1199603113 X:149554978-149555000 TGTAAGAAGGTTTGGGGGAAGGG - Intergenic
1199647275 X:149924497-149924519 TGTAAGAAGGTTTGGGGGAAGGG + Intergenic