ID: 1061485965

View in Genome Browser
Species Human (GRCh38)
Location 9:130920674-130920696
Sequence GTTTAAGGAGGTTTGGCGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 69}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061485965_1061485973 8 Left 1061485965 9:130920674-130920696 CCTGCCGCCAAACCTCCTTAAAC 0: 1
1: 0
2: 0
3: 8
4: 69
Right 1061485973 9:130920705-130920727 CCAGTAGCACCAAGCCACCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061485965 Original CRISPR GTTTAAGGAGGTTTGGCGGC AGG (reversed) Intronic
900097938 1:947931-947953 CATTCAGGAGGTTTGGGGGCAGG - Intronic
900173049 1:1279696-1279718 GTTTAAAAAGGTTTGTCTGCTGG - Intergenic
905179691 1:36157856-36157878 GTTTCAGGAGGCTTGTAGGCTGG + Intronic
906607665 1:47183071-47183093 GATGAAGGATGTTTGGGGGCGGG + Intergenic
909480293 1:76123073-76123095 GTTTAAGAAGTTTTGCTGGCTGG + Intronic
921337278 1:214100854-214100876 GGAGAAGTAGGTTTGGCGGCTGG + Intergenic
921640570 1:217547821-217547843 GTCAGAGGAGGTCTGGCGGCGGG + Intronic
1074151586 10:110764143-110764165 GTTTCAGGAGCTTTGCTGGCTGG + Intronic
1085266293 11:75240034-75240056 GTCTTAAGAGGTTTGGGGGCAGG + Intergenic
1088368791 11:109066449-109066471 GTTTGAGGAGAGTTGGCAGCTGG + Intergenic
1088969683 11:114761868-114761890 GCATAAAGAGGCTTGGCGGCCGG - Intergenic
1089581650 11:119485199-119485221 GTATTTGGAGGGTTGGCGGCAGG - Intergenic
1090203694 11:124873427-124873449 GTTGAAGCAGGTTTGGAGGAAGG - Intronic
1090385941 11:126357577-126357599 GTCTAACGAGGTTGGGAGGCTGG - Intronic
1093799032 12:23349449-23349471 ATTTAAGGAGGTTAGGAGGTTGG + Intergenic
1097187193 12:57202241-57202263 CTATAAGGAGGTTTGGGGACAGG - Intronic
1100290050 12:93205036-93205058 GTTTTAGGACGATTGGCAGCAGG - Intergenic
1100901492 12:99246209-99246231 GTTGAGGGAGGTTTGGGGGAAGG - Intronic
1106843608 13:33712781-33712803 CTGTAAGGAGGTATGGCGTCTGG - Intergenic
1108446722 13:50516804-50516826 CATTAAGAAGGTTTGGCTGCAGG - Intronic
1116358139 14:43957401-43957423 GTTTAAGAAGCTTTTGGGGCCGG - Intergenic
1132587828 16:713941-713963 GTGGCAGGAGGTTTGGGGGCAGG + Intronic
1137263726 16:46851973-46851995 GTTTCAGGAGGTCTGACTGCAGG - Intergenic
1137629555 16:49932588-49932610 TTTTAGAGAGGTTTGGCAGCTGG + Intergenic
1138748934 16:59395599-59395621 GATTTAGTAGGTTTGGTGGCAGG + Intergenic
1141167093 16:81668236-81668258 GTTTATGGAGGGTCGGGGGCAGG + Intronic
1141546853 16:84776246-84776268 GTTTTAGGAAGTTTGGCGAGTGG + Intronic
1141565194 16:84896943-84896965 GATTAAGGAGGGTGGACGGCCGG - Intronic
1143523769 17:7461259-7461281 GGTCAAGGAGGTTTGGGGGAGGG - Exonic
1148754370 17:49964976-49964998 GATTAATTCGGTTTGGCGGCGGG - Intergenic
1152622565 17:81372625-81372647 GCTCAAGGAGGTCAGGCGGCCGG - Intergenic
1158558290 18:58492984-58493006 CATTAAGGAAGTTTGGAGGCTGG - Intronic
1158641767 18:59209611-59209633 CTTTAAGGAGATTTTGCAGCTGG + Intergenic
1161650835 19:5483697-5483719 GTTTAGGGAGGTGAGGCGGGAGG + Intergenic
1163100409 19:15092382-15092404 GTTTAAGGAGGATAGGGGGTGGG + Intergenic
927667830 2:25044431-25044453 GAGTAAGGAGGTTTGGGGGCGGG + Intronic
927698869 2:25254950-25254972 GAATAAGGAAGTTTGACGGCCGG - Intronic
928245927 2:29626941-29626963 CTTTAGGGATGTTTGGCAGCTGG - Intronic
928595187 2:32853333-32853355 GTTTAAGGAAATTTTGAGGCTGG + Intergenic
934793198 2:97080969-97080991 GCTTAAGAAGCTTTGGGGGCTGG + Intergenic
936079665 2:109423682-109423704 GTCAAAGGAGGCTGGGCGGCTGG - Intronic
940445908 2:153777447-153777469 GTTTAAGGAGGTGGGGCTGTTGG + Intergenic
942035300 2:172004619-172004641 TTATAAGTTGGTTTGGCGGCTGG - Intronic
947581165 2:231319534-231319556 GTTTAAGGAGCATGGGCGCCTGG - Intronic
1179249956 21:39664308-39664330 GAGTACGGAGGTTTGGGGGCTGG - Exonic
1180083743 21:45498220-45498242 GTTTGAGGATGTCTGGGGGCTGG + Intronic
1181732921 22:24860409-24860431 GCTTGAGGAGGCTTGGCTGCTGG + Intronic
1181930601 22:26397960-26397982 GCTTAAGGAGATGTGGTGGCTGG + Intergenic
952103686 3:30044497-30044519 GATTAAGTAGGTTTGGAAGCAGG - Intergenic
961760991 3:129167708-129167730 GTTAAATGAGGTTTGGGGGCTGG - Intergenic
962885942 3:139627893-139627915 GTTTAAGGAGGGTTGGCCATGGG + Intronic
964154575 3:153569415-153569437 GCTTAAGGAGTTTTGGGGGCAGG - Intergenic
967261284 3:187645122-187645144 ATTTAAGGTGGCTTGGCAGCAGG - Intergenic
970960140 4:21861964-21861986 GTTTAAGGAGGCTTGGAGGAGGG - Intronic
976185661 4:82440462-82440484 GTTCAAAGAGGTTTCGCTGCTGG - Intronic
983024232 4:162713788-162713810 GTTTAAGTTGGTCTGGCGTCTGG - Intergenic
985561448 5:588442-588464 GTATCAGGAGGCTTGGCCGCTGG - Intergenic
987093264 5:14525943-14525965 GTTTCAGGAGGTTTACTGGCAGG - Intronic
987225187 5:15832571-15832593 GTTTAAGGAGGTTTTGCAAGTGG + Intronic
992812206 5:80400243-80400265 GTGTAAGGAGGTTTGGTGTCTGG + Intergenic
996577957 5:124997441-124997463 GTTTAATGTGGTTTGGCTTCAGG + Intergenic
1003094093 6:3129053-3129075 GTTTAAGAAGGTTTCTCTGCTGG + Exonic
1013961060 6:115900902-115900924 GCTTCAGGAGGTTTGACGGAGGG - Intergenic
1015205926 6:130638565-130638587 GCTTAAGAAGTTTTGGGGGCCGG - Intergenic
1017196598 6:151707061-151707083 GTTGAAGGAGCATTGGAGGCAGG + Intronic
1021393271 7:20120634-20120656 GTTTAAGGAGCTGTGGCCCCAGG - Intergenic
1027747815 7:82099743-82099765 GTTTAAGAAGGTATTGCGGCCGG - Intronic
1030540087 7:110819282-110819304 GTTTGGGGAGGTTCGGAGGCTGG + Intronic
1036768928 8:11565751-11565773 CTTTAAGGAGGTCTGGGGGGGGG + Intergenic
1038462446 8:27728504-27728526 GTTTAGGGAGGATTAGCCGCTGG - Intergenic
1040424390 8:47270528-47270550 GACCAAGGAGGTTTGGGGGCGGG - Intronic
1042053888 8:64741612-64741634 GTTTAAGAATTTTTGGGGGCTGG - Intronic
1048574614 8:135680917-135680939 GTTTACGCAGGTTTGGCTGCAGG + Intergenic
1051753649 9:20371052-20371074 GTTTAAGGAAGTGTTGTGGCTGG - Intronic
1061485965 9:130920674-130920696 GTTTAAGGAGGTTTGGCGGCAGG - Intronic
1190865999 X:54385098-54385120 TTTTATGGAGGTTTGGAGGCTGG + Intergenic
1196688411 X:118532482-118532504 GTTGAAGAAGGTGTGCCGGCCGG + Intronic
1200128209 X:153828118-153828140 GTTTAAGGAGGCCGGGAGGCAGG + Intronic