ID: 1061485966

View in Genome Browser
Species Human (GRCh38)
Location 9:130920678-130920700
Sequence TCTGGTTTAAGGAGGTTTGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 149}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061485966_1061485973 4 Left 1061485966 9:130920678-130920700 CCGCCAAACCTCCTTAAACCAGA 0: 1
1: 0
2: 0
3: 14
4: 149
Right 1061485973 9:130920705-130920727 CCAGTAGCACCAAGCCACCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061485966 Original CRISPR TCTGGTTTAAGGAGGTTTGG CGG (reversed) Intronic
900852695 1:5156590-5156612 TCTGTTTTAATCAGGTTTGGGGG - Intergenic
901111438 1:6799492-6799514 TCTGGTAAAAGAAGGTATGGAGG - Intronic
903226856 1:21898722-21898744 TCTGGTTAGAGGAGATTTGAGGG + Intronic
903288210 1:22290271-22290293 TCTGGTTAAAATAGGTGTGGGGG - Intergenic
904122421 1:28208865-28208887 TGTGGTTTAAGGAGGTTCCATGG - Intronic
906843384 1:49163927-49163949 TATGGTTTATGCATGTTTGGAGG + Intronic
908590139 1:65622248-65622270 TTTGGGTTAAGGACGTTTTGTGG + Intronic
908843678 1:68303215-68303237 TCTCATATAAAGAGGTTTGGGGG - Intergenic
910732379 1:90412173-90412195 TCTTCTGAAAGGAGGTTTGGAGG - Intergenic
915341137 1:155177413-155177435 TCTGGTTAAACCAGGTTTGCAGG + Intronic
917000825 1:170356695-170356717 TCTGTTTCAAGGAAGTTTTGAGG - Intergenic
917685506 1:177411842-177411864 TCAGGTATAAGGAGGGGTGGGGG - Intergenic
919053701 1:192542573-192542595 ACAGGTTTAAGAAAGTTTGGTGG - Intergenic
919254592 1:195105127-195105149 TCTGGGATATGGAGGATTGGTGG + Intergenic
919646884 1:200104026-200104048 TCTGGCAAAAGGAGGTTAGGGGG + Intronic
924136896 1:240976613-240976635 TCATGTTTAAGGAGGTCTGGTGG - Intronic
924598506 1:245467592-245467614 TCTGGTTTAAACATGGTTGGAGG + Intronic
1063289809 10:4733814-4733836 CTTGGGTTCAGGAGGTTTGGGGG + Intergenic
1069384022 10:67868001-67868023 CCTTGTTTAAGGAAGTTTGGGGG - Intergenic
1071855079 10:89616053-89616075 TCTGGTTTAAGGAGGAGTAAGGG - Intronic
1072301602 10:94067390-94067412 CCTGGGTTCAGGATGTTTGGGGG - Intronic
1076143842 10:128100733-128100755 TCTGGCTGGAGGAGGGTTGGAGG + Intronic
1076362849 10:129901786-129901808 TCTGGTTTAATGAGTTGGGGTGG + Intronic
1079687562 11:23379732-23379754 GCTGGTTCAAGGAGGGTTAGAGG - Intergenic
1079808860 11:24969875-24969897 TCTGGTTTTCTGAGTTTTGGTGG + Intronic
1087944625 11:104143483-104143505 TCTGGTTTAAGCATCCTTGGAGG + Intronic
1088689586 11:112314289-112314311 ACTGGATTAGGGAAGTTTGGTGG - Intergenic
1089908308 11:122068825-122068847 TCTGGCAAGAGGAGGTTTGGGGG - Intergenic
1093194447 12:16113139-16113161 TCAAGTTCAAGGATGTTTGGGGG + Intergenic
1093343994 12:18017726-18017748 TCTCTTATAAGGAGGTCTGGTGG - Intergenic
1093490206 12:19696951-19696973 TCTGGTTTCTGTAGGTTTAGAGG - Intronic
1093799031 12:23349445-23349467 GATGATTTAAGGAGGTTAGGAGG + Intergenic
1094059411 12:26297629-26297651 TCTTGCTTAAGGTGGTTTGGTGG - Intronic
1095286340 12:40415384-40415406 TCTGGTTCAAGGAAATTTGGTGG + Intronic
1097633411 12:62092340-62092362 ACTCCTTCAAGGAGGTTTGGTGG - Intronic
1098254612 12:68604170-68604192 TGTGGTGTAGGCAGGTTTGGTGG + Intergenic
1100247043 12:92768857-92768879 TCTGTTTTAACGAGGGTGGGAGG - Intronic
1100948375 12:99815641-99815663 ACTGGTGGAGGGAGGTTTGGAGG - Intronic
1102341184 12:112122732-112122754 TCTGGTACAAGGAGGTTGGGGGG + Intergenic
1102853560 12:116274840-116274862 CTTGGTTTAAAGAGGTTTAGGGG + Intronic
1103019561 12:117523044-117523066 CCTGATTTAAGGAGGCTTGGAGG + Intronic
1105504678 13:20999274-20999296 TCTGGTTTACCAAGGTTCGGGGG - Intronic
1106126949 13:26908477-26908499 TCTGGTCAGTGGAGGTTTGGGGG + Intergenic
1106685194 13:32051211-32051233 TTTGGTTAAGGGAGGTTTTGTGG + Intronic
1110953991 13:81529855-81529877 TTTTTTTTAAGGTGGTTTGGTGG - Intergenic
1117194425 14:53325364-53325386 TCTTTTTTCAGGAGGCTTGGTGG + Intergenic
1118173356 14:63411551-63411573 TCTGGATCATGGAGGTATGGAGG + Intronic
1121775126 14:96585268-96585290 TCTGCTCGAAGCAGGTTTGGAGG + Intergenic
1122157104 14:99756255-99756277 TCCGACTTAAGGGGGTTTGGTGG + Intronic
1124431451 15:29612241-29612263 TCTGCTATAAGGATGTTTTGTGG + Intergenic
1127307694 15:57724096-57724118 TTTGGTTTAAGGAAATATGGTGG - Intronic
1128378881 15:67096937-67096959 TCTTGTTGAAGGTGCTTTGGGGG + Intronic
1128875347 15:71197071-71197093 TCTGTTTTAAGAAGGTTTCCTGG - Intronic
1130319598 15:82829547-82829569 TCTGCATCAGGGAGGTTTGGGGG + Intronic
1132838662 16:1967517-1967539 TTTAGTTTAGGGAGATTTGGTGG - Intronic
1137453542 16:48599543-48599565 ACTGGTTCAAGGAGCATTGGAGG - Intronic
1138218935 16:55233478-55233500 TCTGTTTAAAAGACGTTTGGGGG - Intergenic
1138709799 16:58958352-58958374 TTTGGTTTAAGGAAGTTTGATGG + Intergenic
1138732494 16:59210291-59210313 TCTGGTTTAATGAGCTCTGCAGG - Intergenic
1138971238 16:62146135-62146157 GCTGGTTTAATTTGGTTTGGTGG + Intergenic
1143822908 17:9579026-9579048 TCTGCTTTAAGGTGTTTTGGGGG + Intronic
1146075668 17:29726215-29726237 TCAGGTGAAAGGAGGTTAGGAGG + Intronic
1149339413 17:55670397-55670419 TCTGGATTTAGGTTGTTTGGGGG + Intergenic
1149497799 17:57131297-57131319 TTTGGATTCAGGAGGTCTGGGGG - Intergenic
1152177924 17:78800149-78800171 ACTGGTTAAAGGGGTTTTGGAGG - Intronic
1156072387 18:33228671-33228693 TCTGGATCACAGAGGTTTGGGGG - Intronic
1160372170 18:78382906-78382928 TATGGTTCAAGGATGTCTGGGGG - Intergenic
1160618844 18:80155680-80155702 TCTGATTTAAGGAACTTGGGTGG - Intronic
1165168879 19:33876800-33876822 TCTGGTTTATTGAGATTTGTGGG - Intergenic
1165783585 19:38447900-38447922 TGTGGGAAAAGGAGGTTTGGGGG + Intronic
1165899608 19:39162957-39162979 TGTGGTTAGAGGAGGGTTGGGGG + Intronic
1168429387 19:56265866-56265888 TCTGGTGCAAGGAGCTTTGAGGG + Intronic
927350965 2:22114114-22114136 TTTGTTTTGAGGGGGTTTGGGGG - Intergenic
928496315 2:31836394-31836416 TCTGTGTTAAGGAAGTTTAGAGG + Intergenic
931081716 2:58780856-58780878 TGTGGTTTAAAGAGGTTTAATGG + Intergenic
932995832 2:76851245-76851267 TCTGGTTTTATGAGTTTGGGTGG + Intronic
933188022 2:79300608-79300630 TCAGGTTTTAGGTGGTTGGGTGG - Intronic
933656847 2:84895516-84895538 TCTGGCTAAAGGAGGTTTTTGGG - Intronic
936574570 2:113642332-113642354 TCTGCTTCAAGGAGATCTGGTGG - Exonic
940020094 2:149147153-149147175 TCTGCTTCCAGGAGGCTTGGGGG + Intronic
942033511 2:171987897-171987919 TCTTGTTTTATGAGGTGTGGTGG + Intronic
942329260 2:174804756-174804778 TGTGGGTGGAGGAGGTTTGGTGG + Intronic
942691026 2:178585323-178585345 TCTGGCATAAGGATCTTTGGTGG + Exonic
944463970 2:199982089-199982111 TTTGATTTCAGTAGGTTTGGGGG - Intronic
945096463 2:206224021-206224043 TTTTGTTTTAGGGGGTTTGGGGG - Intergenic
948693433 2:239720962-239720984 GCTGGCATCAGGAGGTTTGGAGG + Intergenic
1169607213 20:7335303-7335325 TCAGGTTTAAGGGTCTTTGGTGG + Intergenic
1170479377 20:16750136-16750158 TCTGAGATAATGAGGTTTGGGGG + Intronic
1171375776 20:24693425-24693447 TCTGAATTCAGTAGGTTTGGGGG + Intergenic
1172042169 20:32053022-32053044 TCTGGGGCCAGGAGGTTTGGGGG - Intronic
1175654557 20:60758141-60758163 TCACTTTTAAGGAGGTTTTGGGG + Intergenic
1175871095 20:62209863-62209885 TCTTGTTGAAGGAGGTTAAGTGG - Intergenic
1178277110 21:31249095-31249117 ACTGGATTTAGGATGTTTGGAGG - Intronic
1178528263 21:33351376-33351398 TCTGGTCCAAGGAGGATTAGAGG + Intronic
1178612211 21:34093892-34093914 TCTGTTTTGTTGAGGTTTGGCGG + Intronic
1181409173 22:22706044-22706066 TGTGGTTGATGGAGGTTTGAAGG - Intergenic
1181416589 22:22763811-22763833 TGTGGTTGATGGAGGTTTGAAGG - Intronic
1181745222 22:24951460-24951482 TGTGGCTTCAGGAGGATTGGTGG - Intergenic
1181930600 22:26397956-26397978 TTTGGCTTAAGGAGATGTGGTGG + Intergenic
1184962557 22:47942005-47942027 GCTGGTTTAAGGGGGCTTGGGGG + Intergenic
1185214667 22:49591578-49591600 TCTGGTTTACGCAGGTGTGCTGG - Intronic
1185288828 22:50014180-50014202 CCTGGTATAAGGAGGGCTGGAGG - Intergenic
1185425600 22:50768551-50768573 TCTGCTTCAAGGAGATCTGGTGG + Exonic
954433315 3:50482855-50482877 TCAGGTTTCAGCAGCTTTGGGGG + Intronic
955622239 3:60877267-60877289 ACTGGTTTGGGGTGGTTTGGAGG - Intronic
956490059 3:69761497-69761519 TTTGGTGTTCGGAGGTTTGGAGG + Intronic
961648304 3:128404496-128404518 TCTGGTGCCAGGAGGTCTGGAGG - Intronic
968275745 3:197438968-197438990 TCAGGCATATGGAGGTTTGGAGG - Intergenic
970053512 4:11944817-11944839 TCTCTTTTGAGGAGATTTGGAGG + Intergenic
970410922 4:15807172-15807194 GCTTGTTTTAGGAGATTTGGGGG + Intronic
971780164 4:31023273-31023295 TATGGTTTAAAGAGGTCTGGAGG + Intronic
976353571 4:84088155-84088177 TCTGGTATTAGGAGGTGTCGGGG - Intergenic
979605240 4:122631526-122631548 TCTGGTTGAAGCAGGGCTGGAGG - Intergenic
983290704 4:165799768-165799790 TCTGCTGTGAGGAGGTGTGGAGG - Intergenic
984282752 4:177691396-177691418 TGTGGTGGAAGGAGGTGTGGAGG - Intergenic
988065430 5:26225252-26225274 TCTAGTTTGAGGATGTTTGAGGG + Intergenic
988441383 5:31237591-31237613 TATGGTTTAAGGTTGTCTGGGGG - Intronic
989701066 5:44265426-44265448 TCTGGTAGAAGGAGGTTGGTAGG - Intergenic
989955180 5:50350628-50350650 TCTAGTTTTTGAAGGTTTGGTGG + Intergenic
990888932 5:60627397-60627419 TCTGGTTTAAGAAGTTCTGAAGG + Intronic
993027765 5:82665906-82665928 TCTGGTAGAAAGTGGTTTGGAGG + Intergenic
994374186 5:98999795-98999817 TCAGGTTTAGGCAAGTTTGGTGG + Intergenic
994821012 5:104651249-104651271 TCTGGCTTAGATAGGTTTGGGGG + Intergenic
1002304994 5:178277995-178278017 TCTGGTGGAAGGAAGTCTGGGGG + Intronic
1004425677 6:15505477-15505499 CCTGGTTTGAGCAGGTTTGAAGG - Intronic
1008087615 6:47261096-47261118 TGTCTTTTAGGGAGGTTTGGGGG - Intronic
1010976080 6:82314928-82314950 TTATGTTTAAGGAGGTTTGCTGG - Intergenic
1014658875 6:124141618-124141640 TCTGGGTTCAGGAGTTTTGCTGG + Intronic
1017292887 6:152761852-152761874 TCTCGTTTCAGGTGGTTTGCAGG + Intergenic
1018637670 6:165878578-165878600 TCTGGTTTAAAGAGATGTTGTGG + Intronic
1020509702 7:9038133-9038155 TCTGGTTTAAGGAAGCAAGGGGG + Intergenic
1021633828 7:22671871-22671893 TGTCCTTTAAGTAGGTTTGGAGG - Intergenic
1023142267 7:37113335-37113357 TGTGGTTTTATGAGGTTTGCTGG + Intronic
1023207590 7:37767486-37767508 TATGATTTAAGGAGTTTTGGGGG - Intronic
1025791007 7:64686647-64686669 TCTGGTTCCAGGAAGTCTGGAGG - Intronic
1026600052 7:71770449-71770471 TCTGGTTTCAGGAGAGGTGGAGG - Intergenic
1026672746 7:72403947-72403969 TATGCTTTAAGGAAGTTAGGAGG - Intronic
1032003571 7:128282425-128282447 TCAGGTTTGAGGCTGTTTGGGGG + Intergenic
1032150485 7:129425191-129425213 TGAGGTTAAAGGAAGTTTGGGGG + Intronic
1032205173 7:129857415-129857437 TCTGGTTTAAGATGTTTTGTTGG - Intronic
1033729372 7:144159907-144159929 ACTGGTTCCAGGAGTTTTGGAGG - Intergenic
1036287983 8:7461713-7461735 TTTGGTTAAAGGAGATTTAGTGG - Intronic
1036333493 8:7849815-7849837 TTTGGTTAAAGGAGATTTAGTGG + Intronic
1040434974 8:47381417-47381439 ACTGTTTTAAGGAGGTTGGATGG - Intronic
1045721661 8:105118771-105118793 TCTGATATATGCAGGTTTGGGGG + Intronic
1047349600 8:124061060-124061082 TCTGGTTTAACGAGGTTTCCAGG + Intronic
1047713707 8:127576440-127576462 TGAGGTTTAAGGAGGCTGGGAGG - Intergenic
1048107018 8:131422051-131422073 TCTTGTTTAGGGAGGACTGGTGG - Intergenic
1048271978 8:133036692-133036714 TCTGGGTTGAGGAGGATGGGTGG - Intronic
1051691924 9:19723484-19723506 TATGGCTTAAGACGGTTTGGTGG - Intronic
1051753650 9:20371056-20371078 TTTGGTTTAAGGAAGTGTTGTGG - Intronic
1056311785 9:85348329-85348351 GCTGGTTTAAGGAGGATTTGAGG - Intergenic
1057814971 9:98287521-98287543 GCTGTTTTCAGGAGGTTTGAAGG - Intergenic
1059875332 9:118628399-118628421 TCTGGATTGAGGAGCTCTGGAGG + Intergenic
1060759466 9:126235410-126235432 GCTGGTTTGAGGGGGTTGGGGGG - Intergenic
1061485966 9:130920678-130920700 TCTGGTTTAAGGAGGTTTGGCGG - Intronic
1061503039 9:131014486-131014508 TCTGGTGGAAGGAGGATTAGGGG - Intronic
1062049065 9:134437912-134437934 TCTGGTTGAAGGTGGGGTGGGGG + Intronic
1186275038 X:7929156-7929178 TCTGGTTTAAAGTGATGTGGTGG + Intergenic
1187037949 X:15562095-15562117 TCTGTGTTAAGGAGGCTGGGAGG + Intronic
1188514294 X:30968699-30968721 CCTGTTTTAATGAGGATTGGGGG - Intronic
1193712185 X:84893752-84893774 TCTGGCTGAAAGAGGTTTTGGGG - Intergenic
1198184392 X:134239056-134239078 TCTGGCTTAAAAAGTTTTGGGGG - Intronic
1200481525 Y:3708855-3708877 TCAAGTTTAAGGATATTTGGTGG + Intergenic