ID: 1061485967

View in Genome Browser
Species Human (GRCh38)
Location 9:130920681-130920703
Sequence CTATCTGGTTTAAGGAGGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 145}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061485967_1061485973 1 Left 1061485967 9:130920681-130920703 CCAAACCTCCTTAAACCAGATAG 0: 1
1: 0
2: 2
3: 23
4: 145
Right 1061485973 9:130920705-130920727 CCAGTAGCACCAAGCCACCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061485967 Original CRISPR CTATCTGGTTTAAGGAGGTT TGG (reversed) Intronic
900852698 1:5156593-5156615 CTTTCTGTTTTAATCAGGTTTGG - Intergenic
903980800 1:27186711-27186733 CTATTTGATTTTAGGAGTTTTGG + Intergenic
905834823 1:41108798-41108820 CTATCTAGTTTAATGATCTTGGG - Intronic
907511287 1:54962754-54962776 CTATTTGGTTTTAGGAGGTTTGG + Intergenic
909803349 1:79843333-79843355 CTATTTGGTTCACAGAGGTTAGG + Intergenic
912016771 1:105047738-105047760 CTATTTGGCTTTAGGTGGTTTGG - Intergenic
912194502 1:107381698-107381720 CTATTTGGTTTAAACTGGTTTGG - Intronic
915205189 1:154265137-154265159 CTATCTGGACTTAGGATGTTGGG + Intronic
921080336 1:211733843-211733865 CTATCGGGTAAATGGAGGTTAGG + Intergenic
921761618 1:218921931-218921953 CAATCTGGTTTAAGAGGATTGGG - Intergenic
922158322 1:223058002-223058024 CTATTTGATTTTAGGTGGTTTGG - Intergenic
922310592 1:224386026-224386048 CTATCTGGATTAAGTAGATAGGG + Exonic
922318009 1:224459384-224459406 TTATCTGTTATAATGAGGTTTGG - Intronic
924297073 1:242598496-242598518 CTATTTGATTTTTGGAGGTTTGG + Intergenic
1071182652 10:83004863-83004885 ACATCTGGTTTACAGAGGTTAGG + Intergenic
1072158395 10:92744316-92744338 TCACCTGGTTTCAGGAGGTTTGG + Intergenic
1072610239 10:97013052-97013074 CTATCTGGTCCCAGGAGGTTTGG - Intronic
1072978760 10:100081663-100081685 CTAGGTTGTTTAAGGAGGTGGGG - Exonic
1074066324 10:110017887-110017909 GTATCTTGTTTAAAAAGGTTGGG + Intronic
1074095678 10:110309992-110310014 CCATCTGGTGAAAGGAGGTAGGG + Intergenic
1077818193 11:5708691-5708713 CTACATGGTTTAAGCATGTTTGG - Intronic
1079276652 11:19044258-19044280 CTTACTGGCTTAAGGAGTTTTGG - Intergenic
1079283132 11:19105901-19105923 CTATGGGTTTTAAGGAGGCTTGG + Intergenic
1080277036 11:30514209-30514231 ATGACTGGTTTAAGGAGGTGCGG + Intronic
1080809983 11:35693972-35693994 CTATTTGATTTTAGGTGGTTTGG - Intronic
1085479819 11:76811889-76811911 CTATTTAATTTTAGGAGGTTTGG - Intergenic
1087384746 11:97456750-97456772 CTAACTGGTGTAAGGTGGTAGGG - Intergenic
1088103836 11:106183891-106183913 CTACTTGATTTTAGGAGGTTTGG + Intergenic
1093356254 12:18172162-18172184 CTATTTGATTTTAGAAGGTTTGG + Intronic
1093799030 12:23349442-23349464 CTTGATGATTTAAGGAGGTTAGG + Intergenic
1094239566 12:28206552-28206574 CTATTTGAGTTTAGGAGGTTTGG - Intronic
1095622915 12:44279896-44279918 CTATGTGGTTTTTGGAGTTTTGG + Intronic
1097020775 12:56019437-56019459 CTTTCTTGTTTAAGGAGGGAAGG + Intronic
1098004841 12:65985233-65985255 CTATTTGATTTTAGGTGGTTTGG - Intergenic
1099252507 12:80273648-80273670 GTATCTGCTTTAAGCAAGTTTGG - Intronic
1105731463 13:23221699-23221721 CAAAATGGTTTAAGGAGGTTAGG + Intronic
1106216814 13:27708963-27708985 CTATCTGGTGAAAAGGGGTTAGG + Intergenic
1109806237 13:67447621-67447643 CTTTCTGGATTAAGGAAATTAGG + Intergenic
1110364723 13:74669247-74669269 CAATCTGGTTTTAGCAGGCTAGG + Intergenic
1111594625 13:90395923-90395945 CTATTTGATTTTAGGAGGTTTGG + Intergenic
1113968431 13:114168529-114168551 CTATTTGATTTTAGGAGGTTTGG - Intergenic
1114335142 14:21681488-21681510 CTATTTGATTTTAGGTGGTTTGG + Intergenic
1114912198 14:27214240-27214262 CTATTTGACTTTAGGAGGTTTGG - Intergenic
1116483941 14:45424367-45424389 CTATTTGATTTTAGGTGGTTTGG + Intergenic
1116576567 14:46582731-46582753 CCATTTGATTTTAGGAGGTTTGG - Intergenic
1116725602 14:48558067-48558089 CTATTTGATTTTAGGAGGTTTGG - Intergenic
1118942416 14:70349792-70349814 CTGTCTGGATTAAGGAGGGAAGG - Intronic
1120232129 14:81851164-81851186 CTATTTGATTTTAGGAGGTTTGG - Intergenic
1121268119 14:92617667-92617689 CTCTTTGATTTTAGGAGGTTTGG - Intronic
1122024535 14:98866133-98866155 CTATGTGGTTTCCAGAGGTTGGG + Intergenic
1125214847 15:37259830-37259852 ATATCTGGATTAAGTATGTTTGG + Intergenic
1125630744 15:41144947-41144969 CTATTTGATTTTAGAAGGTTTGG - Intergenic
1126387964 15:48113279-48113301 CTATGTGATTTTAGGAGGGTGGG - Intergenic
1129260337 15:74363522-74363544 CCATTTGATTTTAGGAGGTTTGG + Intronic
1130914723 15:88295905-88295927 CCATCTGTTTTAGGGAGGTCAGG + Intergenic
1132278391 15:100590799-100590821 CTATTTGATTTTAGGTGGTTTGG + Intronic
1140677649 16:77349191-77349213 CTATTTGGCTTAATGAGTTTGGG - Intronic
1144065225 17:11618602-11618624 CTAGAGGGCTTAAGGAGGTTTGG + Intronic
1147928363 17:43960240-43960262 CTACATGGTTTAAGAATGTTTGG + Intronic
1148253564 17:46107809-46107831 CCATCTAGTTGAAGCAGGTTTGG - Intronic
1148644065 17:49209297-49209319 GCATCTTGGTTAAGGAGGTTAGG - Intronic
1155657650 18:28210300-28210322 CTGTCTGGATTAAGGAGGGGAGG + Intergenic
1155803410 18:30137011-30137033 CTGTTTGATTTTAGGAGGTTTGG - Intergenic
1160262907 18:77312113-77312135 CTATTTGATTTTAGGAGGTTTGG - Intergenic
1160316574 18:77853561-77853583 TGGTCTGGTTTAAGAAGGTTAGG - Intergenic
1164461357 19:28451717-28451739 CTATTTGATGTTAGGAGGTTTGG + Intergenic
1165564261 19:36710619-36710641 CTATCTGCTTTCAGGAGGTTAGG - Intronic
926833274 2:16988587-16988609 CTGGCTTGTTTCAGGAGGTTGGG + Intergenic
927295761 2:21451402-21451424 CTATTTGGTTTTAGGAAGGTGGG - Intergenic
927355936 2:22173307-22173329 TTATCTAGTTTAAGAATGTTGGG + Intergenic
927689224 2:25195884-25195906 CTATTTTGTATAAGGAGGTCTGG - Intergenic
927771670 2:25867601-25867623 GTATCTGTTTTAAGCAGATTGGG - Intronic
928351938 2:30565815-30565837 CTGTTTTGTTTAAGGTGGTTAGG + Intronic
930052470 2:47227331-47227353 CTCTCTGGTTAAAGGAGGGTGGG - Intergenic
930498535 2:52180176-52180198 CTATTTGATTTTAGGTGGTTTGG + Intergenic
933077713 2:77950579-77950601 CTATTTGATTTTAGGTGGTTTGG - Intergenic
939315699 2:140546841-140546863 ATACCTGGTTTATTGAGGTTTGG + Intronic
940010039 2:149042821-149042843 CTATATGGTCTAAGCAGGTAGGG + Intronic
941222232 2:162797029-162797051 CAATCTGGTTGAAGGATGGTGGG + Intronic
944048223 2:195437944-195437966 CTATTTGATTTCAGGTGGTTTGG + Intergenic
946286480 2:218707475-218707497 TTATCTGGTTGAGGGAGTTTAGG - Intergenic
946949420 2:224856744-224856766 ATATCTGCTTTCTGGAGGTTTGG + Intronic
946976393 2:225157103-225157125 CTATTTGGGTTAAGAAGGATTGG - Intergenic
947393345 2:229662656-229662678 ATCTCTGGTTTCAGGAGGCTGGG - Intronic
1170677856 20:18499000-18499022 CTATTTGATTTTAGGAGGTTTGG + Intergenic
1173541002 20:43851154-43851176 ATATATGTTTTAAGGATGTTTGG - Intergenic
1178277111 21:31249098-31249120 CTAACTGGATTTAGGATGTTTGG - Intronic
1179152458 21:38820797-38820819 CTATTTGGTAGAAAGAGGTTGGG + Intronic
1181453658 22:23040734-23040756 CTATTTGGTTTTAGGTGGTTTGG - Intergenic
951841544 3:27039139-27039161 CTATTTGATTTTAGGAGGTTTGG - Intergenic
957030902 3:75239918-75239940 ATCTCTGGTTTCAGGTGGTTTGG - Intergenic
957719068 3:83970782-83970804 CTATTTGATTTTAGGTGGTTTGG + Intergenic
958010093 3:87866055-87866077 ATGTCTGGGTTAAGGAGGCTAGG - Intergenic
962246098 3:133795221-133795243 CTATTTGAGTTTAGGAGGTTTGG + Intronic
963576645 3:147068737-147068759 CTATTTGATTTTAGGAGGTTTGG + Intergenic
966161138 3:176969731-176969753 CTCTCTGCTTTGAGGAGCTTAGG - Intergenic
967951862 3:194847512-194847534 CTCTCTGGATTAAGGAGGGGAGG + Intergenic
970493090 4:16595948-16595970 GTATCCGGTTTTAGGAGGTTTGG - Intronic
970881344 4:20935824-20935846 ATAGCTGGTTTGAGGAAGTTTGG - Intronic
973902659 4:55493826-55493848 CTCTCTGGTTTTAAGAGGTCTGG - Intronic
974009566 4:56594544-56594566 CTTTCTGGTTTAAGTAGGCTCGG - Intronic
974189775 4:58489499-58489521 CTATTTGATTTTAGGAAGTTTGG - Intergenic
974649380 4:64734523-64734545 TTATTTGATTTCAGGAGGTTTGG + Intergenic
978950706 4:114555492-114555514 CTATTTGATTTTAGGAGGTTTGG - Intergenic
980101352 4:128544353-128544375 GTATCAGGTTTAATGAGGTCAGG - Intergenic
980302002 4:131007654-131007676 CTGTTTGATTTTAGGAGGTTTGG - Intergenic
980936948 4:139234594-139234616 CTATTTGATTTTAGGAGGTTTGG - Intergenic
981233964 4:142392902-142392924 TTATTTGGTTTTAGGTGGTTTGG + Intronic
982353377 4:154441400-154441422 GTATTTGATTTAAGAAGGTTGGG - Intronic
986228374 5:5838643-5838665 CTTTCTGGGTCAAGGAAGTTAGG - Intergenic
989477362 5:41889801-41889823 CTATTTGGTCTAAAGAGGTGGGG + Intergenic
989598804 5:43182791-43182813 CAATTTGATTTTAGGAGGTTTGG - Intronic
991480472 5:67073065-67073087 CTGTCTGGTTTAAGCAGGGGAGG + Intronic
992398013 5:76385422-76385444 CTAACTGGTTTAAGAAGGCATGG - Intergenic
995099301 5:108278888-108278910 CTGTCTTGTCAAAGGAGGTTGGG - Intronic
998889022 5:146726619-146726641 CTAACTGGTTTTAGGATGTTAGG - Intronic
998994272 5:147853426-147853448 AGATTTGGTTTCAGGAGGTTTGG - Intergenic
999393825 5:151213990-151214012 CTATCTGGAAAAAGGAGGTGGGG - Intronic
1001345992 5:170899394-170899416 TTATCAGCTTTAAGGAGATTTGG + Intronic
1005639427 6:27782131-27782153 CTATTTGATTTTAAGAGGTTTGG + Intergenic
1007580088 6:42952994-42953016 CTATGTGATTTTAGGTGGTTTGG - Intergenic
1009338160 6:62519796-62519818 GTATCTGGTTTTTGTAGGTTTGG - Intergenic
1010972357 6:82276382-82276404 TGATTTGGTTTAAGGAGTTTTGG + Intergenic
1013195712 6:107843759-107843781 CTAACTGGTTTCTGGAAGTTTGG - Intergenic
1018255983 6:161919864-161919886 CTATCTGTCCTAAGGAGGATAGG - Intronic
1019468836 7:1206868-1206890 ATATCTAGTATAAGTAGGTTTGG + Intergenic
1025822905 7:64986739-64986761 CTTTTTGGTTTAATGAGTTTGGG + Intronic
1026672747 7:72403950-72403972 CTGTATGCTTTAAGGAAGTTAGG - Intronic
1029887628 7:103889855-103889877 CTACCTGCTTGGAGGAGGTTGGG - Intronic
1030144479 7:106339769-106339791 CTATTTGATTTTAGGTGGTTTGG + Intergenic
1032997789 7:137467223-137467245 CTGTCTGGTGTTGGGAGGTTGGG - Intronic
1033088512 7:138364319-138364341 CTATTTGATTTTAGGTGGTTTGG - Intergenic
1034294097 7:149956686-149956708 CTCTCTGGTTGCAGTAGGTTAGG + Intergenic
1034811971 7:154140187-154140209 CTCTCTGGTTGGAGTAGGTTAGG - Intronic
1039999076 8:42561402-42561424 TTATCTTTTTTAAGGAGGATGGG + Intergenic
1041002523 8:53466323-53466345 TTATCTGTTTTAAGGAGGAAGGG - Intergenic
1041604832 8:59769176-59769198 CTATTTGATTTTAGGTGGTTTGG - Intergenic
1043005386 8:74811822-74811844 AAATCAGGTTTAAGAAGGTTAGG + Intronic
1044874216 8:96648379-96648401 CTAAGTGGTTTAGGGAGGGTAGG - Intronic
1046254336 8:111676393-111676415 CTATTTGATTTTAGGTGGTTTGG + Intergenic
1046487163 8:114901873-114901895 CTATTTGATGTTAGGAGGTTTGG + Intergenic
1049124303 8:140772992-140773014 CTACCTCCATTAAGGAGGTTGGG + Intronic
1049980433 9:899414-899436 CTCTATTTTTTAAGGAGGTTTGG - Intronic
1050125372 9:2351970-2351992 CAATTTGGTTTAATGAGCTTTGG - Intergenic
1050528380 9:6565371-6565393 CTTTCTGGTTTAAGTAGGCTCGG + Exonic
1050548855 9:6732045-6732067 CTATTTGATTTTAGGTGGTTTGG - Intronic
1050621909 9:7462558-7462580 CTATCTGGTTTAAGCAATCTTGG + Intergenic
1050999074 9:12257552-12257574 CAATTTGGTTTAAGGACATTTGG - Intergenic
1056430332 9:86521223-86521245 CTATTTGATTTTAGGTGGTTTGG + Intergenic
1057597173 9:96424397-96424419 ATCTCAGGTTGAAGGAGGTTTGG - Intergenic
1059838418 9:118183919-118183941 CTATATGGTCTAAGAAGGTGAGG + Intergenic
1061485967 9:130920681-130920703 CTATCTGGTTTAAGGAGGTTTGG - Intronic
1186294643 X:8135550-8135572 CCATCTTGTTCAAGGATGTTTGG - Intergenic
1188073254 X:25743980-25744002 CTATTTGATTTTAGGTGGTTTGG - Intergenic
1192983574 X:76372379-76372401 CTATTTGATTTTAGGAGGTTTGG - Intergenic
1194051491 X:89074617-89074639 CTATTTGATTTTAGGTGGTTTGG - Intergenic
1194161241 X:90454832-90454854 CCTTCTGGTTTAATGAGTTTGGG + Intergenic
1194350344 X:92818976-92818998 CTATTTGATTTTAGGAAGTTTGG - Intergenic
1194691863 X:96995900-96995922 CTATCTGCTTTGATTAGGTTTGG - Intronic
1195597198 X:106705361-106705383 CTATCTGCATTGAGGAGATTAGG + Intronic
1196400772 X:115313612-115313634 CTATTTGATTTTAGGAGGTTTGG - Intergenic
1196464135 X:115956341-115956363 CTATTTGATTTTAGGAGGTTTGG + Intergenic
1196967916 X:121078227-121078249 CTATTTAGTTTTAGGAGGTTTGG - Intergenic
1197934537 X:131727241-131727263 CTGTTTGGTTTTAGGAGGTTTGG + Intergenic
1198156971 X:133970498-133970520 CTCTCTGGCTTAAGGGAGTTTGG + Intronic
1198520134 X:137444171-137444193 CTCTGTGGAGTAAGGAGGTTGGG + Intergenic
1200507529 Y:4031766-4031788 CCTTCTGGTTTAATGAGTTTGGG + Intergenic
1200658662 Y:5935618-5935640 CTATTTGATTTTAGGAAGTTTGG - Intergenic
1200706859 Y:6450461-6450483 CAATCTGGTGAAAGGTGGTTGGG - Intergenic
1200761893 Y:7046300-7046322 CTACTTGATTTTAGGAGGTTTGG - Intronic
1201027253 Y:9714247-9714269 CAATCTGGTGAAAGGTGGTTGGG + Intergenic