ID: 1061485969

View in Genome Browser
Species Human (GRCh38)
Location 9:130920686-130920708
Sequence CTGGCCTATCTGGTTTAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 80}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061485969_1061485973 -4 Left 1061485969 9:130920686-130920708 CCTCCTTAAACCAGATAGGCCAG 0: 1
1: 0
2: 0
3: 8
4: 80
Right 1061485973 9:130920705-130920727 CCAGTAGCACCAAGCCACCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061485969 Original CRISPR CTGGCCTATCTGGTTTAAGG AGG (reversed) Intronic
902891632 1:19448438-19448460 CTGGGCTTTGTGGATTAAGGCGG - Intronic
905650817 1:39655683-39655705 CTGGCCATGCTGGTTTAGGGAGG - Intergenic
919932555 1:202230797-202230819 CAGGCCAATCTGGCATAAGGAGG - Intronic
921850889 1:219930610-219930632 GAGGCTTATCTGGTGTAAGGTGG - Intronic
922670932 1:227508305-227508327 CTGCCCTTTCTGGTTAAAGGGGG + Intergenic
1068401208 10:56529835-56529857 TTGGCCAATCTGGTTTAGGTAGG - Intergenic
1069163358 10:65117748-65117770 TTTTCCTATCTTGTTTAAGGGGG - Intergenic
1075283605 10:121163106-121163128 CTGGCCTTTCTAGTTTAAGAGGG + Intergenic
1077440278 11:2565633-2565655 GTGGCCTATCTTGTTTTGGGGGG + Intronic
1078827307 11:14941526-14941548 CTGGCCTGACTGATGTAAGGTGG - Intronic
1079249359 11:18775816-18775838 CAGGCCTGTCAGGTTTAACGAGG + Intronic
1087393237 11:97566269-97566291 CTGGCCTCCATGATTTAAGGTGG - Intergenic
1087512111 11:99109518-99109540 ATGGCTTATCTGGTTTAAAGAGG - Intronic
1091678265 12:2507313-2507335 CTCCCCTTTCTGGTTTAAGGAGG + Intronic
1091832641 12:3560846-3560868 CTGGCCTATCTCCTCTAAAGGGG - Intronic
1093467831 12:19468294-19468316 CTGGCCTATCTGACTTTAGATGG + Intronic
1097910900 12:64968070-64968092 CTGGCTGATCTGGTTTCTGGTGG - Intergenic
1102022210 12:109691488-109691510 CTGGCCTATTTGTTTTGAGATGG + Intergenic
1107997275 13:45873085-45873107 CTGGCCTAGCTGGGTTCTGGAGG + Intergenic
1112586232 13:100721330-100721352 CGGGTCTATCTGCTTGAAGGAGG - Intergenic
1121892979 14:97614900-97614922 CTGGCCTGTATGGTTTCTGGGGG + Intergenic
1122520636 14:102341236-102341258 TTGGCCTAGCTGGTTTTGGGTGG + Intronic
1122743693 14:103885954-103885976 CTGGCCCATCAGGCTTCAGGAGG - Intergenic
1128232102 15:66042658-66042680 CTGCCCTAACAGGTTTCAGGGGG - Intronic
1130890300 15:88127828-88127850 CTGGCCTTGCTGGGTAAAGGTGG - Intronic
1134262934 16:12667455-12667477 CTGGCCTATCTCATTTATTGAGG - Intronic
1137583430 16:49649035-49649057 CTGTCCTTTTTGGTTTAAGCTGG - Intronic
1151189893 17:72390550-72390572 CTAGCCTATCTGGATTGCGGTGG - Intergenic
1153213495 18:2794161-2794183 CTGGCCTATCCAGTTTAAAATGG - Intronic
1155236761 18:23827603-23827625 CTGAACTATCTGATTTAGGGTGG + Intronic
1158666566 18:59438143-59438165 CTGGCCTTTCTGTTTTTAGGGGG - Exonic
1158756192 18:60328396-60328418 CTTGCCTCTCTGGTTTCTGGTGG + Intergenic
1164732751 19:30518767-30518789 GTGGTCTGTCTGGTTTACGGTGG - Intronic
927566673 2:24119482-24119504 CTGCCCTAGCTGGTTTGAGTTGG + Intronic
933087863 2:78078278-78078300 CTGGCCTAACTGGTTTATCTAGG - Intergenic
933271971 2:80242723-80242745 CTGCCCTATCTGGATAAGGGAGG - Intronic
937635048 2:124146052-124146074 TTGTCCTATCTGCTTTAAGTGGG - Intronic
937841246 2:126526724-126526746 CTGGCCACTCTGGTTTAAGATGG - Intergenic
939532542 2:143382343-143382365 CTTGCCTCTCTGGTTTCTGGTGG + Intronic
948015094 2:234682627-234682649 CTGGCCTCTCTGGTCCCAGGAGG - Intergenic
1170495874 20:16924781-16924803 CTGCCCTGTCTACTTTAAGGTGG + Intergenic
1182183115 22:28372102-28372124 CTGGACTCTCTTTTTTAAGGCGG - Intronic
1185234809 22:49705527-49705549 AAGGCTTATCTGGATTAAGGTGG + Intergenic
949571619 3:5299457-5299479 CTGGCCTATAAGGTCTGAGGGGG + Intergenic
956792209 3:72688781-72688803 CTGACCTTTCTGATTTAGGGGGG - Intergenic
960588596 3:119344313-119344335 GTGTCCTATCTGGTTTCAGACGG - Intronic
966266201 3:178047490-178047512 CAGGCCTAGCTGGTAAAAGGTGG + Intergenic
974009568 4:56594549-56594571 CTCTCCTTTCTGGTTTAAGTAGG - Intronic
974386171 4:61202949-61202971 CTGGAAAATCTGGTTTGAGGAGG + Intronic
975013332 4:69380958-69380980 CTGGGCTTTCTGGGTTAAGTAGG + Intronic
976728849 4:88242843-88242865 CTTGTCTTTCTGGTATAAGGAGG - Intergenic
977431662 4:96938130-96938152 CTGGCCTATCTGGTCTAGTGAGG - Intergenic
979205954 4:118038251-118038273 CTGCCCTATATGACTTAAGGGGG - Intronic
984759199 4:183349163-183349185 TTGCCCTATATGGTCTAAGGGGG + Intergenic
992398015 5:76385427-76385449 ATAGCCTAACTGGTTTAAGAAGG - Intergenic
993637320 5:90360300-90360322 TTGGGGGATCTGGTTTAAGGTGG + Intergenic
1001134977 5:169094998-169095020 CTGGTCCCTGTGGTTTAAGGTGG - Intronic
1005423129 6:25673307-25673329 CTGGAGGGTCTGGTTTAAGGGGG - Intronic
1007055273 6:38876924-38876946 TTGGCCTTTCTGGTTAAAGATGG - Intronic
1007744979 6:44038243-44038265 CTAGCCTAAGTGGTTCAAGGAGG + Intergenic
1008211115 6:48727063-48727085 CTGACCTACCTGGTTCAAGTTGG + Intergenic
1008385215 6:50881239-50881261 CTGGCCTATCTGGGGGAGGGGGG + Intergenic
1016354798 6:143206848-143206870 CTGGCCTAGCTCATTTAAGTTGG - Intronic
1021180583 7:17500879-17500901 CTGGCCTCTCTTGTTCCAGGTGG - Intergenic
1025230708 7:57201777-57201799 CTGGCCAATGTCGTTGAAGGTGG + Intergenic
1027932575 7:84556231-84556253 CTGGCCAAACTGATTTAAGAAGG + Intergenic
1028870544 7:95766894-95766916 CTTGCCTATTTGGTGTAAAGAGG - Intergenic
1031001314 7:116418462-116418484 CTGTTCTATCTGTTCTAAGGAGG - Intronic
1035231202 7:157467053-157467075 CTGCCCTGCCTGCTTTAAGGAGG + Intergenic
1036391252 8:8326043-8326065 CTGACCTTTCTGTTTTGAGGAGG - Intronic
1039432905 8:37539552-37539574 TTGACCTGGCTGGTTTAAGGTGG - Intergenic
1045297552 8:100885307-100885329 CAGGCCTACCTGATTTAATGGGG - Intergenic
1046950805 8:120018126-120018148 CTGGCCTCTCTTGGTTCAGGGGG - Intronic
1049661205 8:143820431-143820453 CTGGCCGATTAGTTTTAAGGTGG + Intronic
1050528378 9:6565366-6565388 CTCTCCTTTCTGGTTTAAGTAGG + Exonic
1054984761 9:71248607-71248629 CTGTCTTAACTGATTTAAGGTGG + Intronic
1055171019 9:73258339-73258361 GTGGCCTACAGGGTTTAAGGAGG + Intergenic
1057501173 9:95597605-95597627 CTGGCCTACCTGGCTGTAGGTGG + Intergenic
1058818270 9:108705439-108705461 CTGCCCTATCTAGTTTCAGGTGG - Intergenic
1060750160 9:126163487-126163509 CTGTCCTATCTTGGTTGAGGGGG + Intergenic
1061461942 9:130746968-130746990 CTGGCCTCTCTGGCTTCTGGAGG + Intronic
1061485969 9:130920686-130920708 CTGGCCTATCTGGTTTAAGGAGG - Intronic
1185831625 X:3308698-3308720 CTTGTCCATCTGGTCTAAGGTGG - Exonic
1186222212 X:7362209-7362231 CTGGGCTACCTGGTTTATGACGG + Intergenic
1187985882 X:24810521-24810543 CTTGCCTTTCTGGTTTATAGGGG + Intronic
1188673675 X:32912180-32912202 TGGGCCTATCTGGTTGGAGGGGG + Intronic
1193586792 X:83332142-83332164 CTGGCACAACTTGTTTAAGGAGG - Intergenic
1194958430 X:100208116-100208138 CTGGCCTATCTGCCTCCAGGTGG - Intergenic
1201244372 Y:11988429-11988451 CTTGTCCATCTGGTCTAAGGTGG + Intergenic