ID: 1061485970

View in Genome Browser
Species Human (GRCh38)
Location 9:130920689-130920711
Sequence CTACTGGCCTATCTGGTTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 102}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061485970_1061485973 -7 Left 1061485970 9:130920689-130920711 CCTTAAACCAGATAGGCCAGTAG 0: 1
1: 0
2: 0
3: 8
4: 102
Right 1061485973 9:130920705-130920727 CCAGTAGCACCAAGCCACCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061485970 Original CRISPR CTACTGGCCTATCTGGTTTA AGG (reversed) Intronic
904467193 1:30715179-30715201 CTTCTTGCCTATCTGGTTGATGG + Exonic
904980570 1:34497507-34497529 CTCTTAGCCCATCTGGTTTATGG + Intergenic
907546299 1:55262792-55262814 CTACAGGCCATTCTGGTCTAGGG - Intergenic
911827717 1:102508539-102508561 CTTCTGGCCAATTTGGTTTCTGG + Intergenic
915484453 1:156210547-156210569 CAAGTGGCCTATCTGGGATAGGG + Exonic
916882871 1:169037469-169037491 CTACTAGCCTGTATGGTTTCTGG - Intergenic
921418324 1:214916557-214916579 CTTCTTGCCTATGTGGTTAAGGG - Intergenic
1065060142 10:21891624-21891646 CTTCTGGCCTCTATGGTTTGGGG - Intronic
1069361841 10:67652057-67652079 GTACTGGCCCATCTGGTGTCTGG + Intronic
1069629311 10:69888282-69888304 CATCTGGCCTTTCTGGTTTCAGG + Exonic
1071722442 10:88160583-88160605 CTACTGGCATTTCTACTTTAAGG + Intergenic
1072590923 10:96827791-96827813 CTACTGGCTTGTCTGTTTTGAGG - Intergenic
1073656723 10:105424766-105424788 CTAGTGGCCTATTTGGATTTTGG - Intergenic
1084530066 11:69721941-69721963 CTGATGGCCTGTCTGGGTTATGG - Intergenic
1087302344 11:96450138-96450160 GTACTGGCCCATTTGGTTTCTGG - Intronic
1090954796 11:131504381-131504403 CTGCGGTCCTATCTGATTTATGG - Intronic
1093416633 12:18927976-18927998 CTGCTGGCCTAGAGGGTTTAGGG - Intergenic
1094086511 12:26598432-26598454 CTAGTGGCCCATTTGGGTTAAGG - Intronic
1097516665 12:60616322-60616344 ATGCTGGCCACTCTGGTTTATGG + Intergenic
1097669410 12:62518040-62518062 CTACTAGCATATCTGGTGTCTGG + Intronic
1098354902 12:69603219-69603241 TTATTGGCCAATCTGTTTTAAGG - Intergenic
1098366724 12:69711445-69711467 CTAATGTCCTAACTGGTCTAAGG - Intergenic
1103932530 12:124458187-124458209 CTTTTGGCCAATCTGGTTTGGGG - Intronic
1111968820 13:94889063-94889085 CGACTGTCTTATCTGGTTGATGG + Intergenic
1118528095 14:66668808-66668830 CTTCTAGCCTTTCTGGTTTCTGG + Intronic
1119779461 14:77268667-77268689 CTACTGGCCTCTCTTGCTTTGGG - Intronic
1120428738 14:84386785-84386807 GTCCTGGCCTATTTGGTTTCTGG - Intergenic
1122632343 14:103112690-103112712 CCACTGGCCTTTCTGCTCTAAGG + Intergenic
1125687253 15:41570798-41570820 CTACAAGCATATCTTGTTTACGG - Intronic
1125807858 15:42509752-42509774 CTACTGTCATAGCTGTTTTATGG - Intronic
1125968557 15:43893741-43893763 CTCCTGGCCTCTCTGCTTTCAGG + Intronic
1129511727 15:76128792-76128814 CGACTGGCCTCTCTGGTACAAGG - Intronic
1131990405 15:98088267-98088289 CTTCTGGCCTCCGTGGTTTATGG - Intergenic
1132392773 15:101450859-101450881 CCACTGGCCTCTCTGGTCTGAGG + Intronic
1136586658 16:31190796-31190818 CTCCTGGGCCATCTGGTTTAGGG - Exonic
1140228450 16:73097477-73097499 CAACTGGATTATCTGGTTTTAGG + Intergenic
1148598682 17:48877551-48877573 CTACTAGCCTGTCTACTTTATGG - Intergenic
1150237552 17:63605283-63605305 CTACTGGCTTTTCTCCTTTAGGG - Intronic
1155400824 18:25437392-25437414 CAAATGTCCAATCTGGTTTAAGG + Intergenic
1158401536 18:57125839-57125861 CTAATGGCCCTGCTGGTTTATGG - Intergenic
1159478659 18:68959200-68959222 CTACAGTCATATCTGCTTTAGGG + Intronic
1162262174 19:9542176-9542198 CTTCTGGCCTCTCTGGTTCTAGG - Intergenic
1164758192 19:30706631-30706653 CTGCTGGCCTATTTGGATCATGG + Intronic
925677072 2:6374006-6374028 CTACTGGCAGATCTGGTGTCTGG - Intergenic
927768101 2:25831904-25831926 CTTCTGGCCTATGTGGTTTTAGG - Intronic
928242881 2:29601849-29601871 TCATTGGCCTATCTGGATTAGGG + Intronic
929185957 2:39094899-39094921 CCACTGGACTAACAGGTTTATGG - Intronic
931489600 2:62730054-62730076 CTACTGTTCTATCTAGTTTTTGG + Intronic
933652392 2:84859899-84859921 CAAATGGCCTATCTGGCTCATGG + Intronic
936841321 2:116773323-116773345 ATACTGCCCTATAGGGTTTAGGG - Intergenic
937145263 2:119638985-119639007 CTACTTGCCTTTCTGTTTTATGG + Intronic
937209031 2:120255559-120255581 CTACTGGCCCCTCTGCTTTTTGG - Intronic
938623547 2:133083348-133083370 GCAATGGCCTATCTGGTCTATGG + Intronic
942515211 2:176745506-176745528 CTCCTGGCCTAATTTGTTTAAGG - Intergenic
943628031 2:190220618-190220640 CCACTGGCCTTTCTGGTTACAGG + Intronic
943831886 2:192473498-192473520 CTGCAGGCATATCTGCTTTAGGG - Intergenic
1169511814 20:6272740-6272762 CTACTGGCATATCTTTCTTAAGG - Intergenic
1173623067 20:44451178-44451200 CTGCTGGCCTCTCTGCTTTGTGG + Intergenic
1174862702 20:54106364-54106386 CAACTGGCTTATTTGCTTTAAGG + Intergenic
1182892807 22:33832924-33832946 CTACGGGCCCATCTGGTCTGAGG + Intronic
955661056 3:61299516-61299538 CTACTGTCCTCTGTGGTTGAGGG - Intergenic
961903291 3:130236276-130236298 CAACTGATCTACCTGGTTTAGGG + Intergenic
965477968 3:169181343-169181365 TTACTGACCTATATGGTTAATGG - Intronic
969331544 4:6476041-6476063 GTTCTGGCCAATCTGGTTCATGG - Intronic
969644997 4:8422969-8422991 CTGCTGGCTTATCTGGTTAGTGG - Intronic
971101107 4:23467120-23467142 TTACTGGCCTAGCTGGCTGAAGG + Intergenic
971690460 4:29827586-29827608 CTACAGCCATATCTGCTTTAAGG - Intergenic
974939577 4:68449764-68449786 CAACTGGCCTATTTCATTTATGG - Intronic
985007743 4:185550987-185551009 CTGCTGCCCAATTTGGTTTAAGG + Intergenic
985671475 5:1209077-1209099 CTGCTGGCCTGTCTGGTTCCTGG - Intronic
986781772 5:11072944-11072966 CCACTGGCCCATCTGATTGATGG + Intronic
990540993 5:56772128-56772150 CTACTGGCTTCTCTGTTTTGAGG - Intergenic
990805860 5:59660958-59660980 CTACTGGCCAGTCTATTTTATGG + Intronic
992494810 5:77281888-77281910 CAACTGGACTACCTGGTATATGG + Intronic
992827180 5:80562017-80562039 CTACTGGCTCATCTGCTTTCTGG - Intronic
994168195 5:96629927-96629949 CTGCAGGCTTAGCTGGTTTAGGG - Intronic
997435456 5:133870863-133870885 CAACTGCCCTAATTGGTTTAAGG - Intergenic
999261352 5:150240848-150240870 CTCCTGGCCTCTCTGGTATAAGG - Intronic
999662170 5:153876472-153876494 CTCCTAGACCATCTGGTTTATGG + Intergenic
1001887324 5:175305194-175305216 CTTCTGGCCTTTGAGGTTTATGG - Intergenic
1002843205 6:923567-923589 CTAATGTACTATCTGGTCTAAGG - Intergenic
1003095369 6:3138973-3138995 CGACTGTCCTCTCAGGTTTATGG + Intronic
1003151956 6:3559982-3560004 CTATTGTCCTATCTTGTATAGGG + Intergenic
1009205762 6:60799421-60799443 CTACTGCTCTATCTGGATAATGG + Intergenic
1014174916 6:118321719-118321741 CTAGTGGCATATCTGTTTTGGGG - Intergenic
1014811622 6:125893174-125893196 CTACTTGCCTTTCTGTTTAATGG + Intronic
1018603864 6:165577253-165577275 CAACTTGCCTTTCTGGTTTCAGG + Intronic
1018895136 6:168010626-168010648 CTTCTGGTCCATTTGGTTTATGG + Intronic
1019458357 7:1144369-1144391 CTACTTCCCTTTCTGGTGTACGG - Intergenic
1022446821 7:30477831-30477853 CTTCTGGCCTTTCTGCTTTAAGG - Intronic
1026090068 7:67292365-67292387 CTAATGGCCCTTCTGGTTGAAGG - Intergenic
1026368360 7:69672809-69672831 GTTCTGGCATATCTGGTTCAAGG + Intronic
1027119659 7:75507684-75507706 CTAATGGCCCTTCTGGTTGAAGG - Intergenic
1027272166 7:76527927-76527949 CTAATGGCCCTTCTGGTTGAAGG + Intergenic
1031582770 7:123497806-123497828 CTACTGGCCTCTTTTGTTGAAGG - Intronic
1032071861 7:128812760-128812782 CTCCTGGCTTATCTGGTACATGG - Exonic
1033813929 7:145050374-145050396 CTACAGGCATATCTGCATTATGG + Intergenic
1037590420 8:20307182-20307204 CTGCTGGCTTAACTGGTCTATGG - Intergenic
1037671751 8:21020972-21020994 CTACTGGCCTCTGTGGTGGATGG - Intergenic
1041553214 8:59123122-59123144 TCACTGGCCTTTCTGATTTATGG + Intergenic
1043965869 8:86474452-86474474 ATAATGTCCTATCTGGTTTTTGG - Intronic
1048031224 8:130634612-130634634 CTTCTGGCCTACCTGGTTCCGGG - Intergenic
1052983729 9:34469225-34469247 CTTCTGGCCTACATTGTTTATGG - Intronic
1059049174 9:110903980-110904002 CTTCTGGCCTATATGGTTTCAGG - Intronic
1061485970 9:130920689-130920711 CTACTGGCCTATCTGGTTTAAGG - Intronic
1188302208 X:28518650-28518672 CTGCTGGCCTAGCTGTTTCAGGG + Intergenic
1190699785 X:52979208-52979230 CTACTGGCCTTTCTCCTTGAAGG + Intronic
1193874274 X:86840971-86840993 CTACTGGCAGATGAGGTTTAGGG + Intergenic
1196066922 X:111473896-111473918 CTGCTGGTCTATCTGCTTTAAGG - Intergenic
1198947415 X:142030371-142030393 CTGCTGGCATATCTGCATTAAGG + Intergenic
1200098621 X:153676380-153676402 CTACTAGCCAATCGGGTTTTAGG + Intronic