ID: 1061485973

View in Genome Browser
Species Human (GRCh38)
Location 9:130920705-130920727
Sequence CCAGTAGCACCAAGCCACCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061485959_1061485973 23 Left 1061485959 9:130920659-130920681 CCACCTGCCGCCTCCCCTGCCGC 0: 1
1: 1
2: 11
3: 143
4: 1416
Right 1061485973 9:130920705-130920727 CCAGTAGCACCAAGCCACCGTGG No data
1061485960_1061485973 20 Left 1061485960 9:130920662-130920684 CCTGCCGCCTCCCCTGCCGCCAA 0: 1
1: 0
2: 5
3: 40
4: 573
Right 1061485973 9:130920705-130920727 CCAGTAGCACCAAGCCACCGTGG No data
1061485962_1061485973 13 Left 1061485962 9:130920669-130920691 CCTCCCCTGCCGCCAAACCTCCT 0: 1
1: 0
2: 1
3: 29
4: 527
Right 1061485973 9:130920705-130920727 CCAGTAGCACCAAGCCACCGTGG No data
1061485969_1061485973 -4 Left 1061485969 9:130920686-130920708 CCTCCTTAAACCAGATAGGCCAG 0: 1
1: 0
2: 0
3: 8
4: 80
Right 1061485973 9:130920705-130920727 CCAGTAGCACCAAGCCACCGTGG No data
1061485966_1061485973 4 Left 1061485966 9:130920678-130920700 CCGCCAAACCTCCTTAAACCAGA 0: 1
1: 0
2: 0
3: 14
4: 149
Right 1061485973 9:130920705-130920727 CCAGTAGCACCAAGCCACCGTGG No data
1061485967_1061485973 1 Left 1061485967 9:130920681-130920703 CCAAACCTCCTTAAACCAGATAG 0: 1
1: 0
2: 2
3: 23
4: 145
Right 1061485973 9:130920705-130920727 CCAGTAGCACCAAGCCACCGTGG No data
1061485963_1061485973 10 Left 1061485963 9:130920672-130920694 CCCCTGCCGCCAAACCTCCTTAA 0: 1
1: 0
2: 1
3: 11
4: 117
Right 1061485973 9:130920705-130920727 CCAGTAGCACCAAGCCACCGTGG No data
1061485965_1061485973 8 Left 1061485965 9:130920674-130920696 CCTGCCGCCAAACCTCCTTAAAC 0: 1
1: 0
2: 0
3: 8
4: 69
Right 1061485973 9:130920705-130920727 CCAGTAGCACCAAGCCACCGTGG No data
1061485961_1061485973 16 Left 1061485961 9:130920666-130920688 CCGCCTCCCCTGCCGCCAAACCT 0: 1
1: 0
2: 2
3: 45
4: 537
Right 1061485973 9:130920705-130920727 CCAGTAGCACCAAGCCACCGTGG No data
1061485970_1061485973 -7 Left 1061485970 9:130920689-130920711 CCTTAAACCAGATAGGCCAGTAG 0: 1
1: 0
2: 0
3: 8
4: 102
Right 1061485973 9:130920705-130920727 CCAGTAGCACCAAGCCACCGTGG No data
1061485964_1061485973 9 Left 1061485964 9:130920673-130920695 CCCTGCCGCCAAACCTCCTTAAA 0: 1
1: 0
2: 1
3: 8
4: 86
Right 1061485973 9:130920705-130920727 CCAGTAGCACCAAGCCACCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061485973 Original CRISPR CCAGTAGCACCAAGCCACCG TGG Intronic
No off target data available for this crispr