ID: 1061486378

View in Genome Browser
Species Human (GRCh38)
Location 9:130922556-130922578
Sequence CAGCAGATGTCAGAGAGGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 267}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061486378_1061486388 11 Left 1061486378 9:130922556-130922578 CCCCGCCTCTCTGACATCTGCTG 0: 1
1: 0
2: 3
3: 15
4: 267
Right 1061486388 9:130922590-130922612 TCATAGACCTGTGGACTGAACGG No data
1061486378_1061486385 2 Left 1061486378 9:130922556-130922578 CCCCGCCTCTCTGACATCTGCTG 0: 1
1: 0
2: 3
3: 15
4: 267
Right 1061486385 9:130922581-130922603 GGGGTCCCATCATAGACCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061486378 Original CRISPR CAGCAGATGTCAGAGAGGCG GGG (reversed) Intronic
900581810 1:3413206-3413228 CTGCAGAAGTCAGAGGGGCCTGG + Intronic
902286965 1:15413197-15413219 GAGCAGAGGGCAGAGAGGAGGGG + Intronic
902876511 1:19343829-19343851 CAGAGGACGTCAGAGAGGCTGGG + Intronic
903143711 1:21356176-21356198 CAGCAGAGGTGTGAGAAGCGTGG - Intergenic
904446402 1:30576438-30576460 CAGCTGATTTCACAGAGGCACGG + Intergenic
904497231 1:30893764-30893786 CAGCTGGGGTCAGAGAGGCCAGG - Intronic
904562246 1:31406726-31406748 CAGCAGGTGGCTGAGAGGCAGGG - Intergenic
904773418 1:32893429-32893451 CAGCAAACGTCAGAGAGCCCGGG + Intronic
905619248 1:39428026-39428048 CAGGAGATGTCAGGGAGGAGAGG - Exonic
905852324 1:41283345-41283367 AAGGAGATGCCAGAGAGGGGTGG - Intergenic
905888345 1:41503774-41503796 GAGCAGATGTCAGCGATGGGAGG - Intergenic
907524524 1:55046500-55046522 CTGCAGAAGCCAGAGAGGCCGGG - Intronic
908191230 1:61705641-61705663 CAGCAGATGGGAAAGAGGAGAGG - Intronic
911087039 1:93987716-93987738 CAGTGGATGTGGGAGAGGCGAGG + Intergenic
912506519 1:110160664-110160686 CAGGAGTTGTCATAGAGGCGAGG + Intronic
912522258 1:110253785-110253807 CAGCAGAAGTCAGAGGGCAGGGG + Intronic
912685022 1:111755622-111755644 CAGAAGAGGGCCGAGAGGCGGGG + Exonic
913509970 1:119552545-119552567 CAGCAGATATCAGGGAGGGAGGG - Intergenic
915145030 1:153791767-153791789 GAGCAGATGGCAGAGAGGCGAGG + Intergenic
916678390 1:167083156-167083178 CAGGTGATGTCTGAGAGGCAGGG + Intronic
918072483 1:181143092-181143114 CAGCAGATGTCACAGAGGCCTGG - Intergenic
918148607 1:181779590-181779612 GAGCAGAGGACAGAGAGGAGGGG - Intronic
919167377 1:193912604-193912626 CTGCATATGTCAGACAGGAGGGG + Intergenic
920520982 1:206626061-206626083 CAGAAGCTGTGAGAGAGGCATGG + Intergenic
920946674 1:210535594-210535616 CATCAGATGTCAGATTGGCTTGG + Intronic
921906224 1:220498037-220498059 CAGGAGATGTAATAGAGGCTTGG + Intergenic
922574032 1:226650673-226650695 CAGCAGAGCTCAGAGAGGACAGG + Intronic
922656974 1:227393726-227393748 CAGAAGTTGTGAGAGAGGCATGG + Intergenic
922729557 1:227942574-227942596 CAGCAGAGGGCTGAGAGGAGGGG - Intronic
922969759 1:229726453-229726475 CAGCAGAATCCAGAGAGGCCTGG + Intergenic
923210202 1:231797008-231797030 CAGAAAATGTAAGAGAGGCCAGG - Intronic
1062790146 10:298488-298510 CAGCCCATGCCAGAGAGGAGAGG + Intronic
1063612794 10:7576968-7576990 ATGCGGATGTCAGAGAGGAGCGG + Exonic
1064456120 10:15488865-15488887 CAGCAGATTTCCAAGAGGCAGGG - Intergenic
1068749239 10:60572675-60572697 CTGCTGCTGTCAGAGAGACGCGG + Intronic
1069924410 10:71838337-71838359 CAGCAGAGGCCAGGGAGGGGAGG + Intronic
1070320640 10:75352253-75352275 CAGCAAAGGACAGAGAGGCAAGG + Intergenic
1070544664 10:77442888-77442910 CAGCAGGTGTCAGACAGTCAGGG - Intronic
1070987873 10:80703616-80703638 CAGCAGAGGACAGAGAAACGGGG + Intergenic
1071723917 10:88176926-88176948 CAGCAGATTTCTTAGAGGCCAGG - Intergenic
1071785533 10:88895525-88895547 CAGCAAATGTTGGAGAGGTGAGG - Intronic
1073283005 10:102368517-102368539 CAGTAGGAGTCAGAGAGGCATGG - Intronic
1073797028 10:106999939-106999961 CAGCAGATGTCAGCTGGGCCAGG + Intronic
1074498637 10:114002341-114002363 CAGCAGCTGTCTGGGAGGGGAGG + Intergenic
1074829773 10:117240593-117240615 CTGCAGAGGTCGGAGAGGGGAGG + Intergenic
1075160864 10:120023493-120023515 TAGCAGATGTCAAAGAGAGGAGG + Intergenic
1075226727 10:120636128-120636150 CAGCAGTTGTCAGGGAGCCCAGG + Intergenic
1075569477 10:123529375-123529397 CTGTGGATGTCAGAGAGCCGGGG - Intergenic
1075621297 10:123929976-123929998 CAGCAGATGCCTGGGAGGGGAGG - Intronic
1076363896 10:129909839-129909861 GCGCAGAGGTCAGAGCGGCGAGG - Intronic
1077202425 11:1317721-1317743 CAGCAGCTGTCAGACTGGCCAGG - Intergenic
1079026212 11:16950000-16950022 AAGCAGATCTCAGAGAGTGGAGG + Intronic
1079118177 11:17653834-17653856 CAGCAGCTGTCGTGGAGGCGTGG - Intergenic
1079582041 11:22077669-22077691 GGGCAGATGTGAGAGAGGAGGGG - Intergenic
1080134603 11:28840201-28840223 CAGCAGATGACAGAGCCGCAAGG + Intergenic
1081318398 11:41660256-41660278 CAGCAGTAGTCAGATAGGCAGGG - Intergenic
1081598013 11:44472661-44472683 AAGCAGAAGTCAGAGAGGAGAGG + Intergenic
1081812918 11:45923219-45923241 CCGCAGATGTCCAAGAGGCCGGG - Intronic
1081975955 11:47234968-47234990 CAGCAGTGGTCAGACAGGCAGGG - Intronic
1082904017 11:58286321-58286343 GAGCAGGTGTCAGAGAGACTTGG + Intergenic
1083180528 11:60982050-60982072 CAGCAGATGCCAGGGTGGCGGGG + Intronic
1083198527 11:61105224-61105246 CAGCTGCTGGCAGTGAGGCGGGG + Intronic
1083798430 11:65032187-65032209 CAGAGGATGTCAAAGAGGTGAGG + Exonic
1084046418 11:66570777-66570799 CAGCTGAGGTCTGAGAGGAGAGG + Intergenic
1084578812 11:70009401-70009423 CAGCAGATGTCAGAGGCCCCAGG - Intergenic
1084624769 11:70297787-70297809 CAGCAGATGCAGGAGAGGCTGGG + Intronic
1087530168 11:99370966-99370988 CAGCAGCTGTCAGAGAGGCAGGG + Intronic
1088432924 11:109778341-109778363 CAGAAGCTATCAGAGAGGCCTGG - Intergenic
1088946480 11:114518235-114518257 CAGCAGATCTCGGAGAGGCAAGG - Intergenic
1090473003 11:126996649-126996671 CAGCAGCTGTCAGAGGGCAGAGG - Intronic
1093097244 12:14985482-14985504 CAGAAGATGTCAGAGAGCTCAGG + Intergenic
1093805493 12:23427877-23427899 CAACAGAAGTCAGGGAGGCAGGG + Intergenic
1093911978 12:24758770-24758792 CAGCTGAGGTGAGAGAGGCCAGG + Intergenic
1096814167 12:54191251-54191273 CAGCCAATGTCAGAGGGGCCTGG + Intergenic
1097185192 12:57192963-57192985 CTGCCGAGGTGAGAGAGGCGGGG + Exonic
1097945461 12:65363157-65363179 CAGAAGGTGTCAGAGAAGTGAGG - Intronic
1100866515 12:98863311-98863333 CAGCAGAGGTCATAGAAGCTGGG - Intronic
1102225192 12:111223652-111223674 CAGCACATGGCGGAGAGGCCAGG + Intronic
1103188763 12:118982534-118982556 CAGCAGCCGCCAGAAAGGCGTGG - Intronic
1103654697 12:122461018-122461040 CAGAAGCTGTGAGAGAGGCATGG - Intergenic
1103898778 12:124292455-124292477 CTGCAAATGTCAAAGAGGGGAGG - Intronic
1104039788 12:125122221-125122243 GAGCAGGGGTCAGAGGGGCGGGG + Intronic
1104243633 12:127016049-127016071 CACCAGCTGTCTGAGAGGGGTGG - Intergenic
1104944522 12:132409681-132409703 CAGCAGAACGCAGAGAGCCGCGG + Intergenic
1106436427 13:29727309-29727331 CAAGAGAGGCCAGAGAGGCGGGG + Intergenic
1107987375 13:45786976-45786998 CAGCTAATGTCAGAGATGGGAGG + Intronic
1112049604 13:95632486-95632508 CAGCCGAGGTGAGAGAGACGGGG - Intronic
1112693301 13:101918617-101918639 CAGCAGATTACAGGGAGGCTGGG + Intronic
1112926366 13:104679840-104679862 CAGCAGATGTCGTTGAGGTGGGG + Intergenic
1114295391 14:21324754-21324776 CGGCAGATGTCAGGAAGGCCTGG - Exonic
1116900244 14:50355710-50355732 CAGAAGATGTTATAGAGGCCAGG + Intronic
1117727298 14:58687324-58687346 CAGGACATGTCAGGGAGGCTCGG + Intergenic
1119633402 14:76253817-76253839 GAGCAGATGTAAGAGATGCAGGG + Intronic
1119656618 14:76421790-76421812 CAGCAGTTCTCAGGGAGGGGAGG - Intronic
1120335801 14:83152955-83152977 CAGCAGAAGGCAGACTGGCGGGG + Intergenic
1121016788 14:90553752-90553774 CAGCAGAATTCAGGGAGGTGGGG - Intronic
1124650295 15:31469213-31469235 GAGCAGGTGCCAGAGAGGAGAGG + Intergenic
1124905557 15:33864933-33864955 CAGCATGTGTCAGAGAGACATGG + Intronic
1127258590 15:57311235-57311257 GAGCAGAGGTGAGAGAGGTGAGG - Intergenic
1128875314 15:71196818-71196840 AAGCAGCTGTCAGAGAGGCAGGG + Intronic
1129536812 15:76319871-76319893 CAGCAAATGCCAGAGGGGTGAGG - Intergenic
1130881791 15:88061693-88061715 GAGCAGACGTCAGAGAGGCTGGG + Intronic
1131283390 15:91038788-91038810 CAGCAGATGCAAGGGAGGCTGGG + Intergenic
1132610023 16:810983-811005 GAGCAGACCTCAGAGAGGCTGGG - Intronic
1132882347 16:2168014-2168036 CAGCAGATGTGGGGGAGGTGGGG - Intronic
1133406295 16:5527178-5527200 CAGCAGAAATCAAAGAGGAGAGG - Intergenic
1133438757 16:5802889-5802911 CAGTAAATGTCAGTGAGGTGAGG - Intergenic
1134241519 16:12510332-12510354 CAGCAGATGAGAGAGAGTCAGGG + Intronic
1135111068 16:19691240-19691262 CAGCAGATGGCAGGAAGTCGTGG - Intronic
1135463535 16:22665499-22665521 CAGCAGATGTCAGACAGATGAGG + Intergenic
1135699512 16:24619800-24619822 GAGCAGATGTCAGAGAAGCTGGG + Intergenic
1137456812 16:48623828-48623850 GATCAGATGTCAGAGCGGGGAGG + Intergenic
1137492690 16:48946019-48946041 CATCAGAGGTCAGAGAGCTGTGG + Intergenic
1140054946 16:71517252-71517274 CAGCAGGTCTTAGAGAGGCATGG + Intronic
1141227974 16:82137299-82137321 GAGCAGAGGTCAGAGAAGAGTGG + Intergenic
1141301585 16:82821055-82821077 CAGCTGCTGTCAGAGAGGGATGG + Intronic
1142475272 17:185032-185054 AAGCAGAAGGCAGAGAGGCAAGG - Intergenic
1142508270 17:379746-379768 CAGCTGCTGTCAGAGGGGTGAGG + Intronic
1142808841 17:2385960-2385982 CAGCAGAGGTCAGAGATCAGGGG + Exonic
1142974517 17:3635806-3635828 CAGAAGAAGCCAGAGAGTCGGGG + Intronic
1143465087 17:7131183-7131205 AAACAGATGGCAGAGAGGCCAGG - Intergenic
1144958032 17:19029426-19029448 CAGCAGAGGACAGTGAGGCTTGG + Intronic
1144977126 17:19145094-19145116 CAGCAGAGGACAGTGAGGCTTGG - Intronic
1146136837 17:30329446-30329468 CAGCACATATCAGAGATGCTTGG + Exonic
1146483473 17:33224389-33224411 CAGAAGGTGGCAGAGAGGGGAGG + Intronic
1146914976 17:36672683-36672705 CAGCAGAGGCCAGAGAGGCAGGG - Intergenic
1148233549 17:45952281-45952303 CAGCAGGGGTCAGAGATGGGAGG + Intronic
1148809907 17:50283756-50283778 CAGCAGATGCCAGAAGGGCTGGG - Intergenic
1148814463 17:50317484-50317506 CAGCAGAAGACAGAGAGGAAGGG - Intergenic
1148819243 17:50350996-50351018 CAGATGAGGTCAGAGAGGCCTGG + Intronic
1148896582 17:50842548-50842570 AAGCTGAGGTCAGAGAGGTGAGG + Intergenic
1149495125 17:57112734-57112756 CAGCAGAGGCCAGAGAAGAGAGG - Intronic
1151218447 17:72593248-72593270 CACCAGGTCTCAGAGAGGCCCGG - Intergenic
1151341805 17:73476559-73476581 TTGCTGATGTCAGTGAGGCGTGG + Intronic
1152059396 17:78059056-78059078 CAGCAGAAGCCAGAGAGCAGTGG + Intronic
1153471578 18:5452132-5452154 ATGCAGATGTCAGCCAGGCGTGG - Intronic
1155307458 18:24492568-24492590 CAGCAGCTGTCAGGGATGCAGGG - Intergenic
1156031002 18:32712261-32712283 GAGCAGATGTTAGAGAGTTGAGG - Intronic
1157342846 18:46794774-46794796 CAGCAGCTGTAAGGGAGGCTGGG - Intergenic
1157404477 18:47411489-47411511 CTGCAGAGGCCAGAGAGGTGTGG - Intergenic
1160064570 18:75562747-75562769 CAGCAGATCCCACAGAGGCTGGG + Intergenic
1160587905 18:79922872-79922894 CATCAGAGGGCAGAGAGGCCAGG + Intronic
1163177222 19:15572920-15572942 CAGAAGATGTCAGAGAGTACTGG + Intergenic
1163217676 19:15892935-15892957 CAGAAGATGTCAGAGAGTGCTGG - Intronic
1164035571 19:21451095-21451117 TAGCAGATGTCAGCCAGGCGTGG - Intronic
1165938549 19:39403620-39403642 CAGCAGATGGGAGAGAGGAGGGG + Intergenic
1167211286 19:48135718-48135740 CAGCAGAGGCCAGAAAGACGTGG - Exonic
1168683888 19:58336344-58336366 AAGCAGATGTCACAGAGACAGGG + Intronic
926657589 2:15425725-15425747 GAGCAGATGTAAGAGATGCCAGG - Intronic
926705173 2:15832217-15832239 CAGCTGAGGTCAGGGAGGTGAGG - Intergenic
927654375 2:24933035-24933057 CAGCAGCTGGCAGAGAGGCATGG - Intergenic
927972248 2:27313055-27313077 CAGCAGCTGGTGGAGAGGCGGGG - Exonic
931152809 2:59593952-59593974 CAGCAGATGTGACAGGGGTGGGG + Intergenic
931451353 2:62370032-62370054 CAGCATGTGGCAGAGAAGCGGGG + Intergenic
935037990 2:99397631-99397653 CAGCAGCAGTCAGACAGGCTGGG - Intronic
935207597 2:100909996-100910018 GAGGAGTTGTCAGAGAAGCGTGG + Intronic
935403084 2:102680874-102680896 AAGCAGAGGTCAGAGGGACGTGG + Intronic
935804224 2:106730202-106730224 CAGCCGGTGTTAGAGAGGCAGGG - Intergenic
936257253 2:110927415-110927437 CAGTAGAGGACAGAGAGGTGTGG - Intronic
937085816 2:119170857-119170879 AAGCAGATGCCACAGAGGGGTGG - Intergenic
937265910 2:120614632-120614654 CAGCAGAACTTGGAGAGGCGTGG - Intergenic
938117577 2:128612360-128612382 CAGGTGATGTCAGAGATGCCCGG - Intergenic
940822504 2:158372608-158372630 CTGCAGCTGTCAGAGAGGTTAGG - Intronic
941215920 2:162708803-162708825 CTGTAGATGTCATAGAGACGGGG + Intronic
942966512 2:181900202-181900224 AAGCTGATTTCAGAGAAGCGAGG - Intronic
943609602 2:190016340-190016362 CAGCAGGTGACAGAGAGCCAAGG + Intronic
943675494 2:190712432-190712454 CACCAGCTGTCCGAGAGGGGTGG + Intergenic
944922354 2:204428764-204428786 AAGCAGATGGCAGGGAGGAGAGG + Intergenic
945448038 2:209961185-209961207 CAGCAAGAGTCAGAGAGGCCTGG + Intronic
946661478 2:222005098-222005120 AATCAGCTGTCAGAGAGGCCAGG - Intergenic
946713645 2:222531508-222531530 CAGCAGCTGTCAGGGAGACAGGG + Intronic
948236490 2:236394765-236394787 CAGCAGGTGTCTGAGCGGGGTGG + Intronic
948505339 2:238424078-238424100 CAGCAGATGTCACCCAGGCAGGG - Intergenic
948735324 2:239999966-239999988 CAGCAGCTGTCACAGCGCCGTGG + Intronic
1168833651 20:861943-861965 CAGTAGCTGTAAGAGAGGCTGGG - Intergenic
1170883434 20:20317671-20317693 CAGCAGCTGTCAGAGCCGCTGGG - Intronic
1170972745 20:21131427-21131449 CATCAGATGTAAGTGAGGCCAGG + Intronic
1174767993 20:53271816-53271838 GAGCAGATGGCAGAGAGAGGAGG + Intronic
1176064288 20:63186816-63186838 AAGCAGATGTCAGAATGGGGTGG - Intergenic
1178301750 21:31458984-31459006 CAGGAGGTGAGAGAGAGGCGGGG + Intronic
1179542878 21:42095013-42095035 CACCAGAGGGCAGAGAGGCAAGG - Intronic
1181476073 22:23168563-23168585 CAGCAGATGGCAGAGGAGCCTGG - Intergenic
1183083096 22:35469724-35469746 CAGCAGAAGACAGAGCGGGGAGG + Intergenic
1183405637 22:37629397-37629419 CTGCAGAGGCCAGAGAGCCGAGG - Intronic
1183514703 22:38258082-38258104 CAGCAGGTGGCAAAGAGGCCAGG + Intronic
1184451949 22:44587864-44587886 CAGCAGATGAGAGAGAGTCTTGG + Intergenic
1184469820 22:44690127-44690149 CTGCAGAAGTCAGGGATGCGGGG + Intronic
949755730 3:7408736-7408758 CAGCACATGGCATAGAGTCGAGG + Intronic
950204809 3:11071272-11071294 CAGCACCTGTCAGGGAGGCTCGG + Intergenic
955483249 3:59410703-59410725 TAGCAGATGTAACAGAGGCTAGG - Intergenic
960588541 3:119343857-119343879 CAGCAGATGTCAGTGTGTCAGGG - Intronic
964016753 3:151956888-151956910 CAGGAGATGGCAGGGAGGGGTGG - Intergenic
964641157 3:158911921-158911943 CAGCTGAGGTCCGAGAGGAGTGG - Intergenic
964816219 3:160720079-160720101 CAGCAGAATTCAGATAGGGGTGG - Intergenic
966018562 3:175176678-175176700 AAGCAGAGGTCAGAGAGGAAGGG + Intronic
966897522 3:184456906-184456928 CAGCAGACCTCATAGAGGAGGGG + Intronic
966944855 3:184770578-184770600 CAGCATATGACAGAGTGGAGAGG + Intergenic
967834647 3:193950715-193950737 CAGGGGATGTCTGAGAGGTGAGG - Intergenic
968589027 4:1448610-1448632 AAGCAGAGGTGAGAGAGGCAGGG - Intergenic
970043473 4:11822924-11822946 TAGTTGATGTCAGAGAGGGGAGG + Intergenic
970602835 4:17653904-17653926 AAGCAGAGGTCAGAGAGGGAGGG + Intronic
970715931 4:18922896-18922918 CAGCTGATGTCAGAGATGGCAGG + Intergenic
975762076 4:77630563-77630585 CAGCTGAGGTCAGAGGGGTGTGG + Intergenic
976333462 4:83858523-83858545 CAGGAGATGTCTGAGTGGCTGGG - Intergenic
978237828 4:106481532-106481554 AAGCAGATCTCAAAGAGGAGAGG - Intergenic
978620025 4:110628757-110628779 CAGCAGTTGTTAGAGCGGCTCGG - Intronic
979223502 4:118257849-118257871 CAGCAGATGCCAGACATGCTAGG + Exonic
985046460 4:185945884-185945906 CAGCAGCAGTCAGAAAGGCAAGG + Intronic
985489251 5:169637-169659 AAGCCGGTGTCAGAGAGGCGGGG + Intronic
985892967 5:2730451-2730473 CAGCAGAGGCCAGAGAGGGTGGG + Intergenic
986668711 5:10125270-10125292 CAGCAGCTGGGAGAGAGACGAGG + Intergenic
986830512 5:11572170-11572192 CAGCAGATGTCACAAAGACCTGG - Intronic
986900804 5:12431001-12431023 CAGCAGATGTAAAAAAAGCGAGG + Intergenic
987042938 5:14079783-14079805 CAGCAGATCACACAGAGGTGGGG - Intergenic
988270043 5:29002374-29002396 CAGCAGATGTCAGAAAATCTAGG + Intergenic
992332343 5:75730167-75730189 CAGCAGATGAGAGAGAGCAGCGG - Intergenic
992412814 5:76523519-76523541 CTGCAGATGTCAAATAGGCAAGG + Intronic
995695379 5:114873278-114873300 TAGTAGAAGTCAGAGAGGTGGGG - Intergenic
996621003 5:125502539-125502561 CAGTAGATGTGAGAGAAGCCTGG + Intergenic
997267162 5:132501562-132501584 GAACAGATGCCAGAGAGGCCAGG + Intergenic
998498739 5:142613912-142613934 CAGAAGATGTCAGAAAGGGAAGG + Intronic
999663395 5:153888948-153888970 CCACAGAAGTCAGAGAGGCAAGG - Intergenic
1002054325 5:176590046-176590068 AGGCAGATGTCACAGAGGCCTGG - Intronic
1004004866 6:11629150-11629172 CAGCAGCTAGGAGAGAGGCGAGG + Intergenic
1004429813 6:15533239-15533261 CTGCAGATTGCAGAGCGGCGAGG - Exonic
1005598259 6:27399997-27400019 CAGCTGATGACAGAGAGTTGGGG - Intronic
1007430759 6:41775419-41775441 CCGCCGATGTCAGACAGGCCAGG - Exonic
1008869511 6:56255857-56255879 CAGCCGCTGTCTGAGAGGAGGGG + Intronic
1010609717 6:77939488-77939510 AAAGAGATGTCAGAGAGGCAGGG - Intergenic
1011057411 6:83220252-83220274 GAGCAGATATCAGAAAGGAGTGG + Intronic
1013536146 6:111065190-111065212 CAGCAGCTGGGAGAGAGGCAGGG - Intergenic
1014542650 6:122695867-122695889 CCACAGATGTCAGAGAGGGAGGG - Intronic
1015008107 6:128309364-128309386 AAGCTGATGGCAGAGAGGGGTGG + Intronic
1015256009 6:131180114-131180136 CAGCAGATGGCACTGAGGCTGGG + Intronic
1015792434 6:136977200-136977222 CAGCAGAGGTCACAGGGGCTAGG - Intergenic
1016247672 6:142003262-142003284 CAGCAGATTTCAGCGAGGACAGG + Intergenic
1016864242 6:148749248-148749270 TAGCAGGTGTCAGAGAGTGGAGG - Intronic
1017384164 6:153863086-153863108 CAGCAGATGTCTTACAGGCCAGG + Intergenic
1018501294 6:164413435-164413457 CAGCAGATGTGAGAAAGAAGGGG - Intergenic
1020459486 7:8412715-8412737 GAGCTGAGGTCAGAGAGGAGAGG + Intergenic
1021894705 7:25222870-25222892 TAACAGAGGTCAGAGAGGAGGGG + Intergenic
1023059179 7:36312560-36312582 CAGCAGATGGAAAAGAGGTGGGG + Intergenic
1023766410 7:43515162-43515184 CAGCAGATGTCAGTTTGGTGTGG + Intronic
1024788577 7:52936116-52936138 GAGCAGATCTCAGAGAGAAGGGG - Intergenic
1027956257 7:84882268-84882290 CAGCAGATGCCAGAGTGGATAGG + Intergenic
1029360049 7:100081825-100081847 CAGCAAACCACAGAGAGGCGAGG - Intronic
1029692408 7:102191066-102191088 CAGCAGACGCCAGGGAGGCTGGG - Intronic
1029876074 7:103753089-103753111 GAGCAGATGTTATAGAGGCAAGG - Intronic
1033396165 7:140975883-140975905 CAGCAGCTGTTGGAGAGGCAGGG - Intergenic
1034189348 7:149201838-149201860 CAGAGGAGGTCAGAGAGGCAGGG - Intronic
1034777476 7:153843362-153843384 CAGTAGTTGTGAGAGAGGCTGGG - Intergenic
1036179936 8:6575866-6575888 CAGCAGTTAGCAGAGAGGCCTGG + Intronic
1037639871 8:20732803-20732825 CAGCAGAGGTCAGAAGGGTGAGG - Intergenic
1037648396 8:20814786-20814808 CAGCAGCTGTCAGAGAAGGCAGG + Intergenic
1041137420 8:54775171-54775193 CAAAAGTGGTCAGAGAGGCGTGG + Intergenic
1041540816 8:58982862-58982884 CAGCAGATGTCAGAAAGCTTTGG - Intronic
1041618327 8:59934455-59934477 GAGACGATGTCAGAGAGGAGTGG + Intergenic
1043101578 8:76053881-76053903 CAGCTGAAGTCAGAGAGATGTGG + Intergenic
1043150077 8:76704586-76704608 CAGCAGATGCCAGGGAGTCCAGG - Exonic
1048116893 8:131533317-131533339 CAGCAGCTTTCAGAGAGGGCAGG - Intergenic
1048928632 8:139292903-139292925 CAGCATATGACATAGAGGGGTGG - Intergenic
1053297789 9:36927269-36927291 CAGCCCATGTCAGAGAGAAGAGG - Intronic
1055554389 9:77460355-77460377 CAGCAGCTGGGAGAGAGGCATGG + Intronic
1056382552 9:86068235-86068257 CACTAGAAGCCAGAGAGGCGAGG + Intronic
1059301805 9:113319810-113319832 CAGCAGAGCTTAGAGAGGGGAGG - Intronic
1059341418 9:113599626-113599648 CAGAAGATGCGAGAGAGGCCAGG - Intergenic
1059376881 9:113888865-113888887 CAGCTGAGGTAAGAGAGGCTTGG + Intronic
1059724113 9:116989297-116989319 CAGAAGGGGTCAGAGAGGAGAGG + Intronic
1061342073 9:129990545-129990567 CAGATGATGTCAGAAAGGTGTGG + Intronic
1061394016 9:130333451-130333473 ACGCAGATGTCAGAGTGGTGGGG - Intronic
1061414248 9:130437659-130437681 CAGCAGGGGTGAGAGAGGAGTGG - Intergenic
1061486378 9:130922556-130922578 CAGCAGATGTCAGAGAGGCGGGG - Intronic
1061578568 9:131522909-131522931 CTGCAGAGGTCAGAGCAGCGTGG - Intronic
1061656793 9:132098070-132098092 GAGCTGAGATCAGAGAGGCGAGG + Intergenic
1061999781 9:134210099-134210121 AAGCAGCAGTCAGAGAGGTGGGG + Intergenic
1062482101 9:136757271-136757293 CAGCAGATGGCTGTGAGGCTCGG + Intronic
1186293051 X:8120970-8120992 AAGGAGATGTCAGAGAGAAGTGG - Intergenic
1187960673 X:24563830-24563852 GAACAGATGGCAGTGAGGCGGGG + Intronic
1189285967 X:39852694-39852716 CAGCTGAGGTCAGAGTGGTGGGG - Intergenic
1193575179 X:83186617-83186639 CAGCAGGAGCCAGAGAGGAGTGG - Intergenic
1197040655 X:121931944-121931966 CATGAGATTTCAGAGAGGCCAGG - Intergenic
1198392846 X:136193795-136193817 GAGCAGATCTCAGAGAAGAGAGG - Intronic
1199578861 X:149341539-149341561 CAGCAGCTTTCAGAGAGCCCTGG - Intergenic
1199710556 X:150466203-150466225 CACCAGACATCAGTGAGGCGTGG - Intronic
1200108732 X:153728233-153728255 CAGCAGCAGTCAGACAGGCGGGG - Intronic
1200353635 X:155525602-155525624 CAGAAGAAGACAGAAAGGCGAGG + Intronic