ID: 1061489660

View in Genome Browser
Species Human (GRCh38)
Location 9:130938243-130938265
Sequence ACGCGGGTGCAGAGGGAGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 402
Summary {0: 1, 1: 0, 2: 4, 3: 40, 4: 357}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061489660_1061489679 11 Left 1061489660 9:130938243-130938265 CCCGCCTCCCTCTGCACCCGCGT 0: 1
1: 0
2: 4
3: 40
4: 357
Right 1061489679 9:130938277-130938299 CTGCTGGGGGTGCGGGGACGCGG No data
1061489660_1061489671 -5 Left 1061489660 9:130938243-130938265 CCCGCCTCCCTCTGCACCCGCGT 0: 1
1: 0
2: 4
3: 40
4: 357
Right 1061489671 9:130938261-130938283 CGCGTGCACCAGGGGGCTGCTGG No data
1061489660_1061489674 -2 Left 1061489660 9:130938243-130938265 CCCGCCTCCCTCTGCACCCGCGT 0: 1
1: 0
2: 4
3: 40
4: 357
Right 1061489674 9:130938264-130938286 GTGCACCAGGGGGCTGCTGGGGG No data
1061489660_1061489673 -3 Left 1061489660 9:130938243-130938265 CCCGCCTCCCTCTGCACCCGCGT 0: 1
1: 0
2: 4
3: 40
4: 357
Right 1061489673 9:130938263-130938285 CGTGCACCAGGGGGCTGCTGGGG No data
1061489660_1061489680 12 Left 1061489660 9:130938243-130938265 CCCGCCTCCCTCTGCACCCGCGT 0: 1
1: 0
2: 4
3: 40
4: 357
Right 1061489680 9:130938278-130938300 TGCTGGGGGTGCGGGGACGCGGG No data
1061489660_1061489676 3 Left 1061489660 9:130938243-130938265 CCCGCCTCCCTCTGCACCCGCGT 0: 1
1: 0
2: 4
3: 40
4: 357
Right 1061489676 9:130938269-130938291 CCAGGGGGCTGCTGGGGGTGCGG No data
1061489660_1061489672 -4 Left 1061489660 9:130938243-130938265 CCCGCCTCCCTCTGCACCCGCGT 0: 1
1: 0
2: 4
3: 40
4: 357
Right 1061489672 9:130938262-130938284 GCGTGCACCAGGGGGCTGCTGGG No data
1061489660_1061489678 5 Left 1061489660 9:130938243-130938265 CCCGCCTCCCTCTGCACCCGCGT 0: 1
1: 0
2: 4
3: 40
4: 357
Right 1061489678 9:130938271-130938293 AGGGGGCTGCTGGGGGTGCGGGG No data
1061489660_1061489677 4 Left 1061489660 9:130938243-130938265 CCCGCCTCCCTCTGCACCCGCGT 0: 1
1: 0
2: 4
3: 40
4: 357
Right 1061489677 9:130938270-130938292 CAGGGGGCTGCTGGGGGTGCGGG No data
1061489660_1061489681 20 Left 1061489660 9:130938243-130938265 CCCGCCTCCCTCTGCACCCGCGT 0: 1
1: 0
2: 4
3: 40
4: 357
Right 1061489681 9:130938286-130938308 GTGCGGGGACGCGGGAGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061489660 Original CRISPR ACGCGGGTGCAGAGGGAGGC GGG (reversed) Intronic
900162825 1:1232416-1232438 GCGCGGGCGCGGGGGGAGGCGGG - Exonic
900298778 1:1966190-1966212 ATGAGTGTGGAGAGGGAGGCGGG + Intronic
900690406 1:3977380-3977402 ACGAGGGAGCAGACGGAAGCAGG + Intergenic
900701872 1:4053583-4053605 TCAGGGGTTCAGAGGGAGGCTGG - Intergenic
900731384 1:4263673-4263695 ATCAGGGTACAGAGGGAGGCAGG + Intergenic
900794151 1:4697951-4697973 ACGCTGGTGCAGAGTGAAGCTGG - Intronic
900925621 1:5704373-5704395 AGGAGGCTGCAGAGGGAGGTGGG + Intergenic
901748003 1:11387431-11387453 ACATGGGGCCAGAGGGAGGCAGG - Intergenic
902350451 1:15849612-15849634 AGGCGGGGGCGGGGGGAGGCAGG + Intronic
902867207 1:19287630-19287652 CCGCGGGTGCTGGAGGAGGCAGG - Intronic
903541033 1:24096448-24096470 ACGGGTGGGCAGAGGGAGGCAGG + Intronic
905672326 1:39799823-39799845 ACCAGGGGGCAGAGAGAGGCTGG - Intergenic
905674634 1:39816985-39817007 ACCAGGGGGCAGAGAGAGGCCGG + Intergenic
906044900 1:42821063-42821085 AGGTGCCTGCAGAGGGAGGCAGG - Intronic
907689058 1:56644980-56645002 GCGAGGGTGCCGAGGGAGGCAGG - Intronic
908733799 1:67254992-67255014 ATGCGGATGGAGAAGGAGGCTGG - Intronic
910219490 1:84876199-84876221 ACGGGGTAGGAGAGGGAGGCAGG - Intronic
912424068 1:109570759-109570781 ATGAGGGTGAAGAGGTAGGCAGG + Intronic
912587044 1:110776564-110776586 ACGTGTGTGCACAGGGAGGTGGG + Intergenic
915103149 1:153515128-153515150 AGGTGGGTGCAGAGGGAAGGAGG - Intergenic
916660435 1:166918518-166918540 ATCAGAGTGCAGAGGGAGGCAGG + Exonic
917513853 1:175690603-175690625 AGGCAGGTGCAGAGCTAGGCAGG + Intronic
917965355 1:180175409-180175431 ACCCAGGTGAAGAGGGAGGTTGG - Intronic
918181452 1:182088448-182088470 ATGTGGGTGCAGAGGTGGGCAGG - Intergenic
920347795 1:205317708-205317730 AGGCAGGTGCAGAGGGAGCTGGG + Intronic
923719758 1:236456727-236456749 ACACAGGTGCAGAGGGAGTGAGG - Intronic
924436838 1:244049338-244049360 TCTCGGGTGCGGAGGGCGGCGGG + Intronic
924624751 1:245688828-245688850 ACGCGGGTGAGGAGGGCGGCAGG + Intronic
924715176 1:246566494-246566516 AGGGGTGCGCAGAGGGAGGCGGG + Exonic
924729117 1:246696098-246696120 GCGCGGGTGCAGAGGGAGCCTGG - Intergenic
1062838658 10:652537-652559 ACGGAGCTGCAGTGGGAGGCGGG + Exonic
1063223482 10:3992746-3992768 AGGCAGGTGCAGAGGCAGCCTGG + Intergenic
1063454505 10:6173720-6173742 GCGGGGGTGCAGAGAGAGGGAGG + Intronic
1064724814 10:18268066-18268088 ACTCAGATGCAGAGGGAGGTGGG - Intronic
1066648543 10:37634789-37634811 GGGCTGGTGCAGTGGGAGGCGGG + Intergenic
1067066906 10:43109279-43109301 ACATGGGGGCACAGGGAGGCAGG + Intronic
1067182018 10:43995366-43995388 ACCCATGTGCAGAGGAAGGCGGG + Intergenic
1069379552 10:67828990-67829012 GCTCGGGCGCAGAGGGAGGTGGG + Intronic
1070436304 10:76397218-76397240 ACCAGGGTGGAGAAGGAGGCCGG + Intronic
1070555537 10:77524935-77524957 CTGCTGGTGCTGAGGGAGGCCGG - Intronic
1070778817 10:79125911-79125933 ATGGGGGTGCAGAGGCTGGCAGG + Intronic
1070805724 10:79269658-79269680 AGTGGGGTGCAGGGGGAGGCTGG - Intronic
1071598946 10:86946969-86946991 AAGGGGCTGCAGAAGGAGGCTGG + Intronic
1073122896 10:101132916-101132938 AAACGGGAGCAGAGGGAGCCAGG - Intronic
1073240673 10:102055934-102055956 ACGCGAGGGGAGAGGGAGGGAGG - Intronic
1074377762 10:112952648-112952670 GTGCGGGGGCCGAGGGAGGCTGG + Intronic
1075263171 10:120980107-120980129 AGGGGGGTGCAGAGGGTCGCCGG + Intergenic
1075748130 10:124742728-124742750 GAGCGGGTGCAGATGGAGCCAGG - Intronic
1076509681 10:131003906-131003928 ACGGGGCTGCAGAGAGAAGCAGG - Intergenic
1076520154 10:131076293-131076315 ACTGGGGTGCAGAGGGATGGAGG - Intergenic
1076692371 10:132230406-132230428 GCGCCTGTGCAGAGTGAGGCTGG - Intronic
1077020182 11:413863-413885 GAGAGGGTGCAGGGGGAGGCAGG - Intronic
1077045786 11:544656-544678 AGGAGGGTGCAGAGGTGGGCGGG + Intronic
1077285027 11:1761799-1761821 GCGCAGGTGCAGAGGGAGGACGG - Intronic
1077368595 11:2171287-2171309 CAGCTGGGGCAGAGGGAGGCAGG + Intronic
1078510287 11:11979736-11979758 AGTCTGGTGGAGAGGGAGGCAGG - Intronic
1078874261 11:15378049-15378071 AAGCAGGTGCTGAGGGAGGGAGG + Intergenic
1078898637 11:15621143-15621165 ACGTGGGTCCAGGTGGAGGCAGG - Intergenic
1079601519 11:22316698-22316720 AGGCGGGGGGAGAGAGAGGCAGG - Intergenic
1082009057 11:47438193-47438215 AGCCGGGTGCAGTGGGAGCCTGG - Intronic
1083274246 11:61587886-61587908 ACGCCGGCCCAGAGGGAGGAGGG + Intergenic
1083423078 11:62567008-62567030 TAGCTGGTGCAGAGGAAGGCAGG + Exonic
1083613691 11:64016188-64016210 ACACGGGGGCAAAGTGAGGCTGG + Intronic
1083725807 11:64627392-64627414 AGGAGGGTGCAGAGGAAGGCGGG - Intronic
1084540069 11:69780906-69780928 ACGCGTGTGCACAGGGAGGCAGG - Intergenic
1084687207 11:70703675-70703697 TCACTGGTGCACAGGGAGGCTGG - Intronic
1084935741 11:72585656-72585678 ACCCGGGTGCTGTTGGAGGCAGG - Intronic
1084960593 11:72714200-72714222 AGGGAGGTGGAGAGGGAGGCTGG + Exonic
1085413090 11:76303086-76303108 AGGCTGGAGTAGAGGGAGGCTGG - Intergenic
1089150268 11:116358603-116358625 ACACGTGTGCACAGGGAGGGTGG - Intergenic
1089346574 11:117795403-117795425 CTGCGGGGGCGGAGGGAGGCAGG + Intronic
1089790222 11:120937547-120937569 ACGCTGGGGGAAAGGGAGGCAGG - Intronic
1090270316 11:125381278-125381300 ACGCTGGAGCATGGGGAGGCTGG + Intronic
1091285781 11:134408154-134408176 AAGCGGGTGAGGAGGGAGGTGGG + Intronic
1093368686 12:18337614-18337636 GAGCTGGAGCAGAGGGAGGCGGG + Intronic
1093435335 12:19129736-19129758 CCGCGGCTGCCGAGGGAGGAGGG - Intronic
1096493000 12:52023282-52023304 GCGAGGGTGGAGAGGGAGGGCGG - Intronic
1096650471 12:53059760-53059782 CTGCGGCTGGAGAGGGAGGCTGG + Exonic
1096668253 12:53181129-53181151 CAGCGGGTGCAGAGGCTGGCTGG + Intronic
1100449932 12:94696083-94696105 AGGAGGGAGAAGAGGGAGGCTGG + Intergenic
1100873742 12:98940367-98940389 AGGGGGGTGCAGAGGGAGAGAGG + Intronic
1101488712 12:105192453-105192475 GGGCGGGTGGGGAGGGAGGCAGG - Intronic
1103512351 12:121484105-121484127 AGGTGGGAGGAGAGGGAGGCGGG - Intronic
1104397086 12:128443686-128443708 ACGAGGCTGCAGATGGAGGCTGG - Intronic
1106032736 13:26017513-26017535 ACACGGTGCCAGAGGGAGGCAGG + Intronic
1106286742 13:28324505-28324527 CCGGGGTTGCAGAGGGAGGCAGG + Intronic
1106978543 13:35251293-35251315 AAGCGGATGCACAGGGATGCTGG - Intronic
1107386356 13:39914047-39914069 ACAAGGCTGGAGAGGGAGGCAGG - Intergenic
1107851333 13:44576265-44576287 ACGAGGGTGAACAGGGCGGCCGG + Exonic
1108005410 13:45941425-45941447 CCCCAGCTGCAGAGGGAGGCTGG - Intergenic
1108642525 13:52395923-52395945 ACTTGGGTGCAGTGGGTGGCTGG + Intronic
1110568578 13:76980258-76980280 GCGCGGGTGCAGCCGGAGGTGGG - Intergenic
1110706112 13:78603008-78603030 ACGCGGAGGCAGAGGCAGACAGG + Intronic
1111822206 13:93227850-93227872 GCGCGAGAGCAGCGGGAGGCGGG - Intronic
1112002257 13:95221898-95221920 ACAGGTGTGGAGAGGGAGGCTGG - Intronic
1112120147 13:96401111-96401133 GGGAGGGTGCAGAAGGAGGCTGG + Intronic
1112131398 13:96527762-96527784 TGGCTGGAGCAGAGGGAGGCAGG + Intronic
1112575883 13:100636336-100636358 CCGCGGGTGGGGAGCGAGGCTGG - Intronic
1113016461 13:105833595-105833617 ACGCGGGGTCAGAAGGAAGCTGG + Intergenic
1113814469 13:113161743-113161765 ACGGGGGGGCAGGGGGTGGCAGG - Intronic
1115653860 14:35424108-35424130 ATCCGGGGGCAGAGGGTGGCGGG - Intergenic
1116953630 14:50900793-50900815 ATGAGGCTGGAGAGGGAGGCAGG + Intronic
1117428174 14:55622882-55622904 ATGAGGCTGCAGAGAGAGGCAGG - Intronic
1118315444 14:64723094-64723116 TTGCAGGTGCAGAGGCAGGCAGG - Intronic
1119666096 14:76486237-76486259 ATGAGGCTGCCGAGGGAGGCAGG - Intronic
1122008054 14:98722123-98722145 AGGCAGGTGCAGTGGGAAGCTGG - Intergenic
1122348281 14:101073636-101073658 CTGGGGCTGCAGAGGGAGGCCGG - Intergenic
1122577548 14:102751568-102751590 ACCCTGGTGCTGCGGGAGGCGGG + Intergenic
1122912314 14:104836852-104836874 ACGCCGGTGCAGGGGGGGGGGGG - Intergenic
1123145848 14:106129407-106129429 AGGCAGGTGCAGATGGAGGCTGG - Intergenic
1123166593 14:106330973-106330995 AGGCAGGTGCAGATGGAGGGAGG - Intergenic
1123167163 14:106336842-106336864 AGGCGGCTGCAGAGAGAAGCAGG + Intergenic
1123169277 14:106356012-106356034 AGGCAGGTGCAGATGGAGGGAGG - Intergenic
1123909676 15:24954907-24954929 GCGCGGCCGCAGAGGCAGGCTGG + Intronic
1124956096 15:34361490-34361512 ACGCTGGGGCAGAGCCAGGCCGG - Exonic
1125139906 15:36393362-36393384 AAGTGGGTGCATAGGAAGGCAGG - Intergenic
1126598595 15:50406164-50406186 GGGTGGGTGCAGGGGGAGGCTGG + Intergenic
1128582973 15:68821335-68821357 ACGGGGTTGCGGAAGGAGGCGGG + Intronic
1129333669 15:74840185-74840207 ACTGGGGGGCAGAGGGAGTCAGG - Intronic
1129479396 15:75811037-75811059 AGGTGGCTGCAGAGGCAGGCAGG - Intergenic
1129687192 15:77693479-77693501 ATGAAGCTGCAGAGGGAGGCTGG + Intronic
1129687633 15:77695685-77695707 AGGCTGGGGCAGGGGGAGGCTGG - Intronic
1130149170 15:81298364-81298386 TCCCAGGGGCAGAGGGAGGCTGG - Intronic
1132105401 15:99059325-99059347 CCGCGGGAGGAGGGGGAGGCCGG - Intergenic
1132674693 16:1116892-1116914 CCGGGGGAGCAGAGGGGGGCGGG - Intergenic
1132750330 16:1454685-1454707 CCCCGGGTGCTGAGGGTGGCAGG - Intronic
1132826454 16:1907811-1907833 GCGCTGGTGCAGTGAGAGGCGGG + Intergenic
1133285491 16:4688769-4688791 AGGTGGGAGCAGAGGGAGGAGGG - Intronic
1135573275 16:23565850-23565872 ACGGGGGCGCAGGGGGAGGGGGG - Intronic
1136229540 16:28878440-28878462 ATGAGGGAGCAGGGGGAGGCCGG - Exonic
1136394470 16:29985633-29985655 GGGCGAGTGCAGAGGGAAGCAGG - Intronic
1137804097 16:51287433-51287455 ACGCGGGGGCTGAGGAAGTCGGG + Intergenic
1141692701 16:85605642-85605664 CCGGGGGTGCAGGGGGAGGATGG - Intergenic
1142299177 16:89246930-89246952 AGGCGGGTGGAGAGAGAAGCCGG + Intergenic
1142746304 17:1960433-1960455 ACGGGGCTGGAGAGGGAGGTGGG - Intronic
1142875302 17:2848890-2848912 AGGAGGGGGAAGAGGGAGGCAGG - Intronic
1143784036 17:9243696-9243718 AGGAGGGGGCAGAGGGAGGAGGG - Exonic
1144783942 17:17821620-17821642 AGAGGGGTGCAGAGAGAGGCAGG + Intronic
1144847352 17:18226762-18226784 ACATCAGTGCAGAGGGAGGCGGG - Intronic
1146057095 17:29586963-29586985 GCCCGGGAGCAGAGGGAGGATGG + Intronic
1146546936 17:33748191-33748213 AGGCGGGTGCTTAAGGAGGCAGG - Intronic
1146844376 17:36173962-36173984 GCTCGGGTGCAGGGAGAGGCAGG - Intronic
1146856681 17:36261897-36261919 GCTCGGGTGCAGGGAGAGGCAGG - Intronic
1146863936 17:36326478-36326500 GCTCGGGTGCAGGGAGAGGCAGG + Intronic
1146872590 17:36385808-36385830 GCTCGGGTGCAGGGAGAGGCAGG - Intronic
1146879949 17:36436893-36436915 GCTCGGGTGCAGGGAGAGGCAGG - Intronic
1147066796 17:37927066-37927088 GCTCGGGTGCAGGGAGAGGCAGG + Intronic
1147075475 17:37986432-37986454 GCTCGGGTGCAGGGAGAGGCAGG - Intronic
1147078328 17:38006627-38006649 GCTCGGGTGCAGGGAGAGGCAGG + Intronic
1147087000 17:38065978-38066000 GCTCGGGTGCAGGGAGAGGCAGG - Intronic
1147094266 17:38130562-38130584 GCTCGGGTGCAGGGAGAGGCAGG + Intergenic
1147102945 17:38189941-38189963 GCTCGGGTGCAGGGAGAGGCAGG - Intergenic
1147678620 17:42224708-42224730 AGGTGGGTCCAGAGGGAGGTGGG + Intronic
1149847517 17:60016408-60016430 GCTCGGGTGCAGGGAGAGGCAGG - Intergenic
1150130731 17:62667290-62667312 CCGAGGGAGCAGAGGGAGGTAGG + Intronic
1150776416 17:68085296-68085318 AGGTGGTTGCAGAGGGAGCCTGG - Intergenic
1150862734 17:68817927-68817949 ACACGGCAGCAGAGGGTGGCAGG - Intergenic
1151946758 17:77323825-77323847 AAGCGGGTGCAGAGCGCGTCAGG - Intronic
1152301129 17:79495709-79495731 ACAGGGGTGCAGATGGAGGGAGG + Intronic
1152469606 17:80483354-80483376 CTGAGGGTGCAGAGGGAGGACGG + Intergenic
1154046960 18:10915241-10915263 TCACGTGTGCAGAGGGAAGCAGG + Intronic
1154174702 18:12077787-12077809 TCACGTGTGCAGAGGGAAGCAGG - Intergenic
1156036483 18:32771639-32771661 ACGCGTTTGGAGAGGGAGCCGGG + Intronic
1156463576 18:37335005-37335027 AGGGGGGAGCAGAGGGAGGGAGG - Intronic
1156949579 18:42878636-42878658 AAGCAGGTGGAGAGAGAGGCAGG - Intronic
1157609824 18:48949463-48949485 AAGGGGGTGCAGAGGGAGGTGGG - Intronic
1157800861 18:50619894-50619916 ATGTGGGTCCACAGGGAGGCTGG + Intronic
1159989114 18:74881586-74881608 AGGCGGGTGGGGAGGGAGACAGG - Intronic
1160459872 18:79030812-79030834 ACGAGTGTGTAGAGGGAGGCAGG + Intergenic
1160498592 18:79389930-79389952 AGGGGGAGGCAGAGGGAGGCAGG + Intergenic
1160868600 19:1266914-1266936 GCGCGGGGGCGGCGGGAGGCTGG + Intronic
1160908090 19:1461088-1461110 AAGAAGGTGCTGAGGGAGGCGGG + Exonic
1161218484 19:3106559-3106581 GAGAGGTTGCAGAGGGAGGCAGG - Intronic
1161596647 19:5154164-5154186 TGGCTGGAGCAGAGGGAGGCAGG + Intergenic
1162128209 19:8510813-8510835 GCGCGGGTGGAGAGGGGGGCGGG - Intronic
1162808194 19:13149943-13149965 AGTCGGGGGCAGAGGCAGGCGGG - Intronic
1162933008 19:13966540-13966562 AGGCGGATGCTCAGGGAGGCTGG + Intronic
1163608981 19:18291611-18291633 ATGCGGGGGCAGCGGGAGGCGGG - Intergenic
1163684050 19:18700617-18700639 ACCTGGGTGCAGAGGGTGGGTGG + Intronic
1163696853 19:18768580-18768602 ACGCGGGTGGAGGAGGCGGCGGG - Exonic
1164061419 19:21678435-21678457 CTGCTGGTGCAGAGCGAGGCTGG - Intergenic
1164064801 19:21706598-21706620 CTACTGGTGCAGAGGGAGGCTGG - Intergenic
1164169212 19:22709485-22709507 CTCCCGGTGCAGAGGGAGGCTGG - Intergenic
1164452797 19:28381273-28381295 AGGAGGGTGCAGGAGGAGGCAGG + Intergenic
1164558154 19:29269249-29269271 ACGCGGGAGCTGGGGGAGGGCGG + Intergenic
1164719462 19:30421807-30421829 TCTCGTGTACAGAGGGAGGCTGG - Intronic
1164881195 19:31734183-31734205 ACAGGGGTGCTGAGGGGGGCGGG - Intergenic
1164999467 19:32749164-32749186 ACCTGGGAGCAGTGGGAGGCTGG + Intronic
1165140791 19:33698838-33698860 ACGCAGGTGCAGAGGGGCGAGGG - Intronic
1165142775 19:33712378-33712400 AAGCGGGGGCTGTGGGAGGCAGG + Intronic
1165352688 19:35284754-35284776 AAGGGGGTGCAGAGGATGGCAGG - Intronic
1165877744 19:39021330-39021352 ATGGAGGTGGAGAGGGAGGCAGG - Intronic
1166231175 19:41426594-41426616 AGGCGGGTGGAGAGGTTGGCAGG + Exonic
1166824736 19:45601761-45601783 AGGCAGGGGCAGAGGGAGGTGGG + Intronic
1166885856 19:45960689-45960711 GCGAGGGTGGGGAGGGAGGCAGG - Intronic
1167360861 19:49029720-49029742 AGGGGGATGCAGAGGGAGCCTGG - Intronic
1167365146 19:49050815-49050837 AGGGGGATGCAGAGGGAGCCTGG + Intergenic
1167574856 19:50313036-50313058 CCGTGGGAGCAGAGGGAGGGAGG + Intronic
1168687472 19:58357481-58357503 ACGGAGGTTCCGAGGGAGGCAGG - Exonic
926924451 2:17972985-17973007 AAGGGGCTGGAGAGGGAGGCAGG + Intronic
927520941 2:23697611-23697633 AGACGGTTGCAGAGTGAGGCAGG + Intronic
927754516 2:25698053-25698075 ACGCAGGAGGAGAGGGAGGCTGG + Intergenic
928979970 2:37127462-37127484 ATGAGGATGCTGAGGGAGGCAGG - Intronic
929462335 2:42112039-42112061 ATGCAGGTGCAGAGGGGAGCTGG - Intergenic
932595799 2:73092846-73092868 ACTGGGTTGCAGAGGGAGGTGGG - Intronic
933666353 2:84968339-84968361 AGGAGGGTGCAGAGAGAGGAAGG + Intergenic
933835127 2:86239891-86239913 ACGCAGGTGCCGAGGCAGGGGGG + Intronic
933969917 2:87462006-87462028 AGCCGGATGCAGAGGGAGGTGGG + Intergenic
934752044 2:96799753-96799775 TGGCTGGGGCAGAGGGAGGCTGG + Intronic
936323864 2:111488490-111488512 AGCCGGATGCAGAGGGAGGTGGG - Intergenic
936466199 2:112753440-112753462 ACGAGGTTGGAGAGGTAGGCAGG - Intronic
937446568 2:121963347-121963369 ACGCTGGTACTGAGGGAGGTGGG - Intergenic
937642342 2:124228034-124228056 AAGCTGGAGAAGAGGGAGGCTGG + Intronic
937870378 2:126782011-126782033 ACCCAGGTGCAGAAGGAGGGAGG - Intergenic
941714908 2:168753949-168753971 ACACAGGTGGAGAGGGAGGATGG - Intronic
942215225 2:173712873-173712895 ATGAGGGTGGAGAGAGAGGCAGG - Intergenic
943727341 2:191265966-191265988 GAGGGGGTGGAGAGGGAGGCAGG + Intronic
943882197 2:193159900-193159922 ACGCTACTGCAGAGGGAGACTGG + Intergenic
945843436 2:214915207-214915229 ACGTTGGTGGAGAGGGAGGCAGG + Intergenic
946625621 2:221609623-221609645 ACTAGGTTGAAGAGGGAGGCTGG + Intergenic
947533703 2:230928088-230928110 ACCCTGGTGCAGAGGGTGCCCGG - Intronic
947929528 2:233952354-233952376 AGGCAGGTGCCGAGGGAGCCTGG + Intronic
948205562 2:236161115-236161137 CCGCTGGGGCAGAGGGAGGGTGG - Intergenic
948763887 2:240209670-240209692 GCCCGGGTGCAGTGGGAGGCTGG + Intergenic
948781707 2:240325501-240325523 ACGTGGGTGCAGAGCGTGGCTGG - Intergenic
949032212 2:241802549-241802571 AGGCGGGGCCAGAGGGAGGCCGG + Intronic
1172336634 20:34122377-34122399 ACGCCTGTGCAGGGGGCGGCAGG + Intergenic
1172476051 20:35238566-35238588 AAGGGGTTGCAGAGGGAGTCAGG + Intronic
1173172599 20:40739701-40739723 AGGCAGGTGTGGAGGGAGGCGGG - Intergenic
1173646876 20:44638884-44638906 GCAGGGGTGCGGAGGGAGGCAGG + Intronic
1173686010 20:44924014-44924036 ACCTGGGTGCTGAGGGAGACGGG + Intronic
1174424432 20:50422143-50422165 ACAGGGATGCAGTGGGAGGCGGG + Intergenic
1175713103 20:61236805-61236827 AAGAGGGTGGAGGGGGAGGCTGG - Intergenic
1178016379 21:28351126-28351148 ATGCGGGAGGAGAGGGAGGAAGG - Intergenic
1178704381 21:34861314-34861336 ATGCTGCCGCAGAGGGAGGCAGG + Intronic
1179213727 21:39349105-39349127 ACGCGGGGGGAGGAGGAGGCGGG - Exonic
1179507494 21:41851575-41851597 ACGCGGCTGCAGAGGGTGACAGG + Intronic
1179728315 21:43353381-43353403 ACGCGTGTGAAGAGGGAGACAGG + Intergenic
1180100111 21:45579895-45579917 ACGCGGGTGCCCCGGGATGCGGG + Intergenic
1180592651 22:16954313-16954335 ACGGGGCTGCAGTGGGAGGAGGG + Intergenic
1180975256 22:19844597-19844619 ACCAGGCTGCAGAGGCAGGCAGG + Intronic
1181904605 22:26184347-26184369 AGTGGGGTGGAGAGGGAGGCAGG - Intronic
1181966070 22:26657509-26657531 TCGCGGGACCAGAGGGAGGGAGG + Intergenic
1182358821 22:29734936-29734958 CCGCGGGAGCAGAGGGAAGGTGG + Intronic
1182548800 22:31090348-31090370 ATGGGGGTGGAGGGGGAGGCTGG - Intronic
1183084985 22:35481163-35481185 AGGTGAGGGCAGAGGGAGGCAGG + Intergenic
1183546171 22:38455688-38455710 CAGCGCGGGCAGAGGGAGGCGGG - Intergenic
1183566191 22:38616925-38616947 GCGAGGGTGCAGAGGGGGGCAGG + Intronic
1183665768 22:39244926-39244948 CTGCGGGTGCGCAGGGAGGCAGG + Intergenic
1183704116 22:39466470-39466492 ACGCGGGGGAAGAAAGAGGCTGG - Intronic
1183831108 22:40418714-40418736 ACGGGGGTGCCGAGGGGGGCGGG + Exonic
1184085311 22:42259036-42259058 AGTTGGGTGGAGAGGGAGGCAGG - Intronic
1184147035 22:42617782-42617804 ATGAGGCTGGAGAGGGAGGCGGG - Intergenic
1184241439 22:43213024-43213046 AGGCCAGAGCAGAGGGAGGCGGG + Intronic
1184492978 22:44820753-44820775 ACCCGGGGGCTGAGGGAGGAGGG - Intronic
1184843512 22:47066537-47066559 AAGCGTGTGCGGAGGGAGGCTGG + Intronic
1184980049 22:48089563-48089585 AACCGGGTGCAGAGGCAGGGAGG + Intergenic
1184985546 22:48130868-48130890 ACGGGGCTGCAGAGGGAGGCGGG - Intergenic
1185071494 22:48659168-48659190 ACGAGGGCCCAGAGTGAGGCAGG - Intronic
1185101955 22:48845379-48845401 ACGAGGGCACCGAGGGAGGCAGG - Intronic
1185382087 22:50514169-50514191 AGGCAGCTGGAGAGGGAGGCTGG + Intronic
949125259 3:439456-439478 TGGAGGGTGCAGAGGGAGGAGGG + Intergenic
949935325 3:9111510-9111532 AAGAGGGTGAAGAGTGAGGCTGG + Intronic
950098790 3:10345033-10345055 CCACGAGGGCAGAGGGAGGCAGG - Intronic
950613262 3:14139454-14139476 ATGAGGGAGCAGAGGAAGGCAGG + Intronic
950722187 3:14891310-14891332 CAGCAGGTGCAGAGGGCGGCTGG - Intronic
952392557 3:32892855-32892877 ATGCGTGTGCTGAGGGAGTCAGG + Exonic
953415355 3:42712497-42712519 AGCCAGGTGCAGAGGGAAGCTGG - Intronic
953770821 3:45777630-45777652 ATGCGGGTGCAGGGAGAGGGAGG + Intronic
954633121 3:52057465-52057487 AGGCGGTGGCGGAGGGAGGCGGG + Intergenic
955085525 3:55698620-55698642 AAACGGGGGCAGGGGGAGGCAGG + Intronic
956976511 3:74587172-74587194 AGGTGGGGGCAGAAGGAGGCAGG + Intergenic
959574632 3:107921311-107921333 CCCCGGGTGCAGAGGCAGGATGG - Intergenic
960955475 3:123027771-123027793 CCGCGGGAGCAGAAGGAGGGAGG + Intronic
961167108 3:124770899-124770921 AGGCTGGTGCAGGGGGAGGGTGG - Intronic
961317654 3:126051483-126051505 ACCTGGGGGCAGAGGGAGGCAGG - Intronic
961335934 3:126179878-126179900 TCGCGCGTGCAGAGGGAGGCCGG - Intronic
961551579 3:127672921-127672943 ACGCCGCTGCAGAGCGGGGCGGG + Exonic
961597718 3:128032124-128032146 GCTGGGGTGCAGAGTGAGGCAGG - Intergenic
961745902 3:129063259-129063281 AAGCGGGTGCAGAGTGCAGCTGG + Intergenic
962222350 3:133574175-133574197 CCGCGGGTGCGGCGGGCGGCGGG + Exonic
966440843 3:179942563-179942585 ATCCGGGTGCAGTGGGAGGGAGG - Intronic
968291697 3:197544180-197544202 ACCCAGGTACAGAAGGAGGCTGG - Intronic
968524599 4:1049574-1049596 ACACAGGTGCAGGGGGAGGCAGG - Intergenic
968699067 4:2046309-2046331 ACAGGGCTGCAGAGTGAGGCCGG - Intergenic
968965275 4:3766331-3766353 ACGCGGCTGCGGGGGGAGGGGGG - Intronic
969186587 4:5479021-5479043 AAGCGGATCCAGGGGGAGGCAGG + Intronic
969626807 4:8309744-8309766 ACGGGTGAGCAGTGGGAGGCAGG - Intergenic
971013760 4:22466367-22466389 ACGTGGGTGAAGAGGGATGGAGG - Intronic
971218076 4:24680511-24680533 AGGCAGGTGCAGAGAGAGGGAGG + Intergenic
974397643 4:61359449-61359471 GGGCGGCTGCAGAGGGAGGGAGG - Intronic
985337389 4:188911432-188911454 ATGCAGGTGCAGATGGAGGTTGG - Intergenic
985344281 4:188986630-188986652 ATGGGCATGCAGAGGGAGGCAGG - Intergenic
985523709 5:391337-391359 AGGCGGGCGCAGGGCGAGGCAGG + Intronic
985523737 5:391435-391457 AGGCGGGCGCAGGGCGAGGCAGG + Intronic
985523752 5:391484-391506 AGGCGGGCGCAGGGTGAGGCAGG + Intronic
985523872 5:391917-391939 ACACGGGTGCAGGGCGAGGCAGG + Intronic
985523909 5:392072-392094 ACACGGGTGCAGGGCGAGGCAGG + Intronic
985523997 5:392423-392445 ACACGGGTGCAGGGCGAGGCAGG + Intronic
985643644 5:1074978-1075000 AGGCGGGTGCAGGTGGAGGGAGG + Intronic
986135073 5:4969353-4969375 AGGGGGCTGCAGAGGGACGCAGG - Intergenic
988872567 5:35406863-35406885 AATGGGGTACAGAGGGAGGCAGG - Intergenic
989605690 5:43242387-43242409 GAGCAGGTGCAGAGAGAGGCAGG + Intronic
990227334 5:53669380-53669402 ACGAGGTTGTAGAGGGAGGAAGG - Intronic
990474074 5:56144532-56144554 ATGAGGTTGGAGAGGGAGGCAGG + Intronic
995658898 5:114458937-114458959 GTGCGGGTGCTGAGGGAGGCAGG + Intronic
996398731 5:123036876-123036898 AGGCGGGTGCGGAGGGCGCCAGG + Intergenic
998040885 5:138950436-138950458 AGGCGTGTGCAGAGGGAGTGAGG + Intronic
998116716 5:139543433-139543455 ACGTGGGTATAGAGGGAAGCTGG - Intronic
1002277838 5:178114735-178114757 AGGCGGTGGCAGAGGCAGGCTGG - Intronic
1002651213 5:180696723-180696745 ACAGGGGTGCAGAGGGAGACAGG + Intergenic
1003403696 6:5811093-5811115 ATGTGGTTGCAGAGGCAGGCAGG + Intergenic
1003890069 6:10556143-10556165 ACGGGGAGGCAGAGGGAGGAGGG + Intronic
1005333992 6:24775190-24775212 ACGCGGCTTCAGAGGTTGGCCGG - Exonic
1006825089 6:36928771-36928793 CCCAGGGAGCAGAGGGAGGCAGG + Intronic
1007415576 6:41689426-41689448 GCGAAGGGGCAGAGGGAGGCAGG - Intronic
1008124164 6:47649815-47649837 AGGAGGGTGAAGAGGCAGGCAGG + Intergenic
1010452296 6:76016563-76016585 ATGCTGATGCAGAGAGAGGCTGG + Intronic
1011983467 6:93416677-93416699 CCGCGGGCGCAAAGGGAGGTCGG - Intronic
1015769619 6:136755218-136755240 ATGCGGCTGGAGAGGGAGGCAGG - Intronic
1015894815 6:138007098-138007120 ACGAGGGGGCAGAAGGAAGCTGG - Intergenic
1017775025 6:157673765-157673787 CCGGGGCTGCAGAGGGCGGCTGG + Exonic
1017920632 6:158869405-158869427 ACGCGCTTGCAAAGGGAGGCGGG + Intergenic
1018301435 6:162406849-162406871 ACTGGGGTGGGGAGGGAGGCAGG - Intronic
1019450102 7:1093148-1093170 AGGCAGGTGCAGCGGCAGGCAGG - Exonic
1019631913 7:2053982-2054004 ACCCTTCTGCAGAGGGAGGCAGG + Intronic
1019909667 7:4092287-4092309 AGGCGAGCACAGAGGGAGGCTGG - Intronic
1019964848 7:4490500-4490522 AGCTGGGAGCAGAGGGAGGCTGG - Intergenic
1020007738 7:4791347-4791369 CGGCTGGTGGAGAGGGAGGCCGG + Exonic
1020257199 7:6508925-6508947 AAGCAGGTGTGGAGGGAGGCGGG - Intronic
1020260304 7:6527105-6527127 TGGCGGGTGCAGAGGGAGTGGGG - Intronic
1020281878 7:6654004-6654026 ACGCGTGTGGAGAGTGCGGCCGG + Exonic
1022101659 7:27172987-27173009 ACGCGGGGGGAGGGGGAGGGAGG - Intronic
1022294202 7:29034560-29034582 AGGAGGGTGCAGGGGGAGGGAGG - Intronic
1022317881 7:29262777-29262799 ATGGGGGTGCAGGGGGAGGGAGG + Intronic
1022637971 7:32155068-32155090 ATCAGGGTGCAGAGGCAGGCAGG + Intronic
1023881945 7:44325688-44325710 AGGCGCGTGCAGGGGGCGGCGGG - Intronic
1024256806 7:47545600-47545622 AGGCTGGGGCAGTGGGAGGCGGG + Intronic
1024578880 7:50785651-50785673 ACCTGGGTGCAGGGTGAGGCGGG - Intronic
1024678372 7:51658603-51658625 ACTGGGGTGCTTAGGGAGGCTGG + Intergenic
1025091039 7:56064477-56064499 ATGCGGCTGCAGCGGCAGGCTGG + Intronic
1028593943 7:92528394-92528416 TGGCGGGTGCTGGGGGAGGCGGG - Exonic
1028611869 7:92720691-92720713 ACCCGGGTGCACAGTGAGGTAGG + Intronic
1029206090 7:98870098-98870120 ACGCGGGAGCAAGGGGCGGCGGG - Intronic
1029218416 7:98969272-98969294 ATGGGGATGCAGAGAGAGGCAGG - Intronic
1029690099 7:102175567-102175589 AGGCAGGTGCAGAGGCTGGCAGG - Intronic
1031026478 7:116685445-116685467 AGGCGGGTGGATAGTGAGGCGGG + Intronic
1032194629 7:129781788-129781810 GCGCGGGTGCAGAGACAGCCAGG - Intergenic
1032715236 7:134503520-134503542 CTGAGGGTGAAGAGGGAGGCAGG + Intergenic
1034457035 7:151176157-151176179 GCGCGGTGGCAGGGGGAGGCGGG + Exonic
1035557959 8:580402-580424 GGGCCGTTGCAGAGGGAGGCAGG - Intergenic
1036943337 8:13071678-13071700 AAGCGCCTGCAGAAGGAGGCAGG - Intergenic
1038951355 8:32417720-32417742 ACGGGGGTGGAGGGGGAGGGGGG + Intronic
1039786849 8:40841550-40841572 ATGGGGGTGCACAGGGAGCCTGG - Intronic
1039884303 8:41646590-41646612 GCGCGGGTGCAGGCGCAGGCGGG - Exonic
1041143132 8:54843798-54843820 GCTCAGGTGCAGAGGGAAGCAGG + Intergenic
1044530904 8:93306525-93306547 ATGTGGTTGCAGAGGCAGGCAGG - Intergenic
1046850013 8:118961590-118961612 AGATGGGTGGAGAGGGAGGCAGG - Intergenic
1047221760 8:122924331-122924353 ACTCGGGTGCAGAGGCAGACAGG - Intronic
1048373718 8:133803340-133803362 ACTAGGGTGGTGAGGGAGGCAGG + Intergenic
1049351653 8:142167847-142167869 GGGCAGGTGCAGAGGGAGGAAGG - Intergenic
1049600436 8:143505067-143505089 ACGCGGGAGGGGAGGGAGGCAGG - Intronic
1051350152 9:16191414-16191436 ACTTGGGAGCAGAGGGAGGAAGG + Intergenic
1051384558 9:16493942-16493964 ACGAGGGTAGAGAGGCAGGCAGG + Intronic
1052834790 9:33242248-33242270 GCTCAGGTGCATAGGGAGGCGGG + Intronic
1054805881 9:69395630-69395652 ATACGGGTGCAGAGGGAAGAGGG - Intergenic
1057401432 9:94726778-94726800 ACGCCGGAGGAGAGGAAGGCAGG - Intronic
1057440182 9:95077371-95077393 GCCCGGGTCCACAGGGAGGCCGG + Intronic
1058023726 9:100117619-100117641 ACGCCGGTGCAGCGGGAGGTGGG - Intronic
1059341720 9:113601171-113601193 AAGGGGGTGCAGAGGCAGGGAGG - Intergenic
1059429362 9:114240716-114240738 ACGAGGGTGCAGAGGAGGGAGGG - Intronic
1059456254 9:114402178-114402200 CTGGGGGTGCAGAGGGAAGCTGG + Exonic
1059691145 9:116687313-116687335 GCGCGTGCGCAGAGGGAGGCAGG + Exonic
1060018102 9:120104662-120104684 ATGCGTGTGGAGAGGGAGGTTGG + Intergenic
1061133653 9:128721616-128721638 GCCCGGGTGTAGAGGGAGGGTGG - Intronic
1061193129 9:129093832-129093854 AAGCGGGTAAAGAGGGAGGCTGG - Intergenic
1061450407 9:130664374-130664396 ACGCGGGTGGAGGCGGAGGCGGG - Intergenic
1061489660 9:130938243-130938265 ACGCGGGTGCAGAGGGAGGCGGG - Intronic
1061864774 9:133486434-133486456 AGGCAGGTGCCGTGGGAGGCTGG + Intergenic
1062451587 9:136617938-136617960 AGGCAGGTGCAGAGAGCGGCTGG + Intergenic
1062579740 9:137223927-137223949 GCGCCGGTGCAGATGGAGCCTGG + Intergenic
1062613689 9:137386776-137386798 GCAGGGGTGCTGAGGGAGGCAGG - Intronic
1062613707 9:137386834-137386856 GCAGGGGTGCTGAGGGAGGCAGG - Intronic
1062613738 9:137386921-137386943 GCAGGGGTGCTGAGGGAGGCAGG - Intronic
1062613747 9:137386950-137386972 GCAGGGGTGCTGAGGGAGGCAGG - Intronic
1062613756 9:137386979-137387001 GCGGGGGTGCTGAGGGAGGCAGG - Intronic
1062613777 9:137387037-137387059 GCAGGGGTGCTGAGGGAGGCAGG - Intronic
1203732497 Un_GL000216v2:103597-103619 ACGGGGGGGCAGAAAGAGGCTGG - Intergenic
1187270412 X:17775482-17775504 AGGCGGGGACAGAGAGAGGCGGG - Intergenic
1187320099 X:18230243-18230265 AGGCGGGGACAGAGAGAGGCGGG + Intergenic
1187764865 X:22630363-22630385 AGGTGGGTGAAGAGGCAGGCGGG + Intergenic
1189445644 X:41078320-41078342 ACACGGGTACAGAGGTAGGCAGG - Intergenic
1190282447 X:48939988-48940010 ACACAGCTGCAGAGGGAGACAGG + Intronic
1190743506 X:53306335-53306357 CCAGGGGTCCAGAGGGAGGCAGG + Intronic
1192491027 X:71577903-71577925 ACGCGGGAGCGCAGGGGGGCGGG - Intergenic
1196020418 X:110985215-110985237 ATGAGGTTGCAGAGGAAGGCAGG - Intronic
1196919796 X:120574097-120574119 AGGCTGGGGCAGAGGGGGGCAGG - Intronic
1197782652 X:130172626-130172648 ACCTGTGGGCAGAGGGAGGCAGG + Intronic
1198738738 X:139817469-139817491 ATGGGGCTGGAGAGGGAGGCAGG + Intronic
1199566820 X:149224028-149224050 AGGCTGGGGCAGAGGGATGCTGG + Intergenic
1200100565 X:153687735-153687757 ACGCCGCTCCAGCGGGAGGCAGG - Intronic
1200234351 X:154461014-154461036 AGGGGGATGCAGAGGGAAGCTGG + Intronic