ID: 1061489940

View in Genome Browser
Species Human (GRCh38)
Location 9:130939236-130939258
Sequence GGCCCCGAGGGCGCCCCCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 283}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061489929_1061489940 15 Left 1061489929 9:130939198-130939220 CCCGGACCGGACTCACACAAGTC 0: 1
1: 0
2: 0
3: 0
4: 48
Right 1061489940 9:130939236-130939258 GGCCCCGAGGGCGCCCCCGCCGG 0: 1
1: 0
2: 3
3: 33
4: 283
1061489930_1061489940 14 Left 1061489930 9:130939199-130939221 CCGGACCGGACTCACACAAGTCA 0: 1
1: 0
2: 0
3: 4
4: 43
Right 1061489940 9:130939236-130939258 GGCCCCGAGGGCGCCCCCGCCGG 0: 1
1: 0
2: 3
3: 33
4: 283
1061489931_1061489940 9 Left 1061489931 9:130939204-130939226 CCGGACTCACACAAGTCACCATG 0: 1
1: 0
2: 1
3: 17
4: 137
Right 1061489940 9:130939236-130939258 GGCCCCGAGGGCGCCCCCGCCGG 0: 1
1: 0
2: 3
3: 33
4: 283
1061489928_1061489940 18 Left 1061489928 9:130939195-130939217 CCTCCCGGACCGGACTCACACAA 0: 1
1: 0
2: 0
3: 2
4: 34
Right 1061489940 9:130939236-130939258 GGCCCCGAGGGCGCCCCCGCCGG 0: 1
1: 0
2: 3
3: 33
4: 283
1061489937_1061489940 -9 Left 1061489937 9:130939222-130939244 CCATGCGCGGGGCGGGCCCCGAG 0: 1
1: 0
2: 2
3: 17
4: 158
Right 1061489940 9:130939236-130939258 GGCCCCGAGGGCGCCCCCGCCGG 0: 1
1: 0
2: 3
3: 33
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061489940 Original CRISPR GGCCCCGAGGGCGCCCCCGC CGG Intronic
900471821 1:2858842-2858864 GGCCACTGGGGCGTCCCCGCTGG - Intergenic
900595631 1:3478979-3479001 GGCCCCGAGGGCACAGCTGCAGG + Intronic
901007898 1:6180464-6180486 GGACCGGGGGGCGCCCCGGCAGG + Intergenic
901034603 1:6328847-6328869 GGCCCCGAGGGCCCCTCCGAGGG - Intronic
901056039 1:6449000-6449022 GGCCGCGAGTTCGCCACCGCCGG + Exonic
901242863 1:7704951-7704973 CGCCCCGCGCGCGCCCCCGCCGG - Intronic
901405013 1:9039694-9039716 GGCGCCGAGGCCGCCTCCTCCGG - Intronic
902478319 1:16699495-16699517 GGCCGCGAGTTCGCCGCCGCCGG - Intergenic
902531320 1:17092473-17092495 GGCCCCGACCGCCTCCCCGCCGG - Exonic
902840253 1:19069847-19069869 GGCCCTGAGGCTGCCTCCGCTGG + Intergenic
903078104 1:20787330-20787352 GGCCCCGCGCGCGCCCCCGCCGG + Intergenic
903855637 1:26336451-26336473 GGGGCCGAGGGCGCGGCCGCGGG - Intronic
904252932 1:29237668-29237690 GGCCCCGCGGCCGCCGCCTCGGG + Intronic
904822672 1:33256012-33256034 GGCCCCGGGAGCCCCCGCGCTGG + Intergenic
905417071 1:37811238-37811260 GTGCCCCAGGGCGCCCCCTCAGG - Exonic
906204333 1:43979171-43979193 GGCCGCGGGGGCGCGCGCGCGGG + Intronic
906614601 1:47225692-47225714 GGCCCGGGGGGCGGCCCTGCCGG - Exonic
906636974 1:47416373-47416395 GGCCCCGACGGCGCGACCGCTGG - Exonic
908751679 1:67430157-67430179 GCCCCCAACGCCGCCCCCGCCGG + Exonic
917565251 1:176206790-176206812 GCCCCCGAGGCCGCCCGAGCCGG + Exonic
918148193 1:181776236-181776258 GGCCCCTCGGCCGCCCCAGCGGG + Intronic
919091931 1:192987143-192987165 AGTCCCGAGGCCGGCCCCGCGGG - Intergenic
922196511 1:223364278-223364300 GGGCGCGCGGGCGCCTCCGCGGG - Intergenic
922335811 1:224617411-224617433 GGCACCGAAGGCGCGCCCGGCGG - Intronic
922803150 1:228373170-228373192 GGCTCCCAGGGGCCCCCCGCTGG + Intronic
923372660 1:233328344-233328366 GGCCGCGAGGGCGGCGGCGCGGG - Exonic
923505219 1:234599980-234600002 GGGCCCGAGTGCGCCGCCGCCGG - Intergenic
924199059 1:241640508-241640530 AGCCGCGAGGACGCGCCCGCGGG - Intronic
1062774791 10:135762-135784 GGCCCCGCCGCCGCCCTCGCAGG - Intronic
1067556745 10:47278150-47278172 GGTCCCCAGGGTGACCCCGCCGG + Intergenic
1068920243 10:62475727-62475749 GGCCCCGAGGGCACCATGGCGGG + Intronic
1070800876 10:79243693-79243715 GCCCCCGAGGGCGCCAGGGCGGG + Intronic
1071511060 10:86262873-86262895 AGCCCTGAGCCCGCCCCCGCAGG + Intronic
1072654296 10:97319648-97319670 GCCCCCGGGGGCGCCGCTGCGGG + Exonic
1072903579 10:99430663-99430685 GGCCGCGGGCCCGCCCCCGCCGG - Intergenic
1073414267 10:103368212-103368234 GGCACCGGGGCCGCCCCCGCCGG - Exonic
1073537584 10:104291632-104291654 GGCCCCTCGGGCGCCCCCAGAGG - Intronic
1074085657 10:110207724-110207746 GGCCCCCAGGGAGACCCGGCCGG - Exonic
1075428678 10:122362853-122362875 GGCCCTGAGGCCAACCCCGCTGG - Intergenic
1075430237 10:122374539-122374561 CGCGCCGAGGCCGCCGCCGCTGG + Intergenic
1076156809 10:128210992-128211014 GGCCTCCAGGGCGCCTCCCCCGG + Intergenic
1076373923 10:129971389-129971411 GCCCCCGAGGGCGGCCCGGATGG - Intergenic
1076792669 10:132785486-132785508 GGCGCGGAGGGGGACCCCGCCGG - Intronic
1076849577 10:133086398-133086420 GGCCCAGAGGAGGCCCCGGCCGG - Intronic
1076872046 10:133199044-133199066 GGCCCCGGGGCCACCCCTGCCGG + Exonic
1077008663 11:370444-370466 TTCACCGAAGGCGCCCCCGCCGG - Intronic
1077214595 11:1390163-1390185 GCCCGCGGGGGCGCCCCGGCCGG + Intronic
1077298175 11:1835652-1835674 GGGCCCGAGGGAGCCACAGCGGG + Intronic
1077805792 11:5590111-5590133 GGTCCCGAGGCCTGCCCCGCAGG - Intronic
1078011591 11:7576693-7576715 GGCCCCCAGGGTGCCCTGGCTGG + Intronic
1081488275 11:43547941-43547963 CGCCCCGAGAGCTCCCGCGCGGG - Intergenic
1083997220 11:66278415-66278437 GGCCCGGGGGGCGCCAGCGCGGG - Exonic
1089505177 11:118957761-118957783 GGCCCCGAGGGCGCACGGGGAGG - Intronic
1090758607 11:129816114-129816136 AGCCCGGAGGGGGCCCCAGCTGG - Intronic
1091157222 11:133384977-133384999 GGCCCCGAGGTCTCCGCCTCTGG + Intronic
1091718271 12:2795082-2795104 GGCCCAGAGTGCGCTCGCGCCGG + Exonic
1092239536 12:6828524-6828546 GTCCCCGGGGGCGCCCCCGCAGG + Exonic
1096231320 12:49898343-49898365 GGTCCCCAGGGAGCCCCAGCCGG - Intronic
1096491345 12:52014817-52014839 GGCCCGTCGGGCGCCTCCGCGGG - Exonic
1097058850 12:56267457-56267479 GGACCCCAGGGCGCCCGCGAGGG - Intronic
1097383254 12:58920271-58920293 GGCCCCGAGCGCGCGCCGGCTGG - Exonic
1098161243 12:67649351-67649373 GGCCCCGAAGGCCCCTCCGCGGG + Intronic
1103415463 12:120739533-120739555 GGTCCCCAGGGAGCCCCCGCCGG - Exonic
1103488234 12:121296876-121296898 CGCCCCCTGCGCGCCCCCGCCGG + Intronic
1104475457 12:129067259-129067281 GTCCCCGTGAGCGCCCCCTCAGG - Intergenic
1105054037 12:133080890-133080912 GCCCCCCAGGGCCCCTCCGCGGG - Exonic
1105475098 13:20721925-20721947 GGCCCCAACGACGCGCCCGCTGG + Exonic
1106602684 13:31200631-31200653 GGCCTCGAGGGCCGCCTCGCCGG - Intronic
1107988402 13:45796085-45796107 GGACCCGAGGGAGCCCCTGAGGG + Intronic
1111556158 13:89883999-89884021 GGTCCCGAGGCCAGCCCCGCGGG + Intergenic
1111672637 13:91348609-91348631 CGCCCCGAGGCTGCCCACGCGGG - Intergenic
1112402097 13:99086411-99086433 GGCGCCGAGGGCGCACCTGGCGG - Intronic
1112579069 13:100663005-100663027 CGCCCCCAGGGCGTCCCTGCTGG - Exonic
1113820179 13:113208385-113208407 GGCCCCCACGGCGGCCCTGCAGG + Intronic
1117315025 14:54565717-54565739 GGACCCGAGGGCGCTCGGGCGGG - Intergenic
1117378672 14:55138339-55138361 GGCCCCTATGGCGCCCCTGCTGG + Exonic
1119673425 14:76536878-76536900 AGTCCCGAGGGCTGCCCCGCGGG + Intergenic
1119780116 14:77271508-77271530 GGCCCCTAGGCCGCCTCCCCAGG - Intergenic
1122230216 14:100303290-100303312 GGCCTCGAGGGGCCCCCTGCTGG - Intronic
1122264099 14:100538670-100538692 GGCCGCGGTGGCGGCCCCGCTGG - Exonic
1122447658 14:101781457-101781479 GGCCCGGCGGGAGCCCACGCGGG - Intronic
1122768205 14:104085631-104085653 CTCCCCGTGGGTGCCCCCGCCGG + Intergenic
1202854710 14_GL000225v1_random:43257-43279 GGCTGGCAGGGCGCCCCCGCAGG + Intergenic
1123787349 15:23686953-23686975 GGCCCCGAGCGCGGCCCAGCCGG - Exonic
1124237767 15:28004435-28004457 TGCCCCGCTGGCGTCCCCGCAGG - Intronic
1125742027 15:41972147-41972169 GTCCCCGAGGTCGCGCCGGCCGG + Intronic
1128153540 15:65377852-65377874 GGCCCCGGCGCCGGCCCCGCGGG - Exonic
1128568271 15:68715318-68715340 GGCCCCGAGGCTGCCACAGCTGG + Intronic
1129322356 15:74782254-74782276 GGCCCCGACGGCGGCGCAGCCGG - Exonic
1130261157 15:82355347-82355369 GGCTCCCGGGGCTCCCCCGCGGG - Intergenic
1130280078 15:82513671-82513693 GGCTCCCGGGGCTCCCCCGCGGG + Intergenic
1130471453 15:84229857-84229879 GGCTCCCGGGGCTCCCCCGCGGG + Intergenic
1130478947 15:84344428-84344450 GGCTCCCGGGGCTCCCCCGCGGG + Intergenic
1130492823 15:84443703-84443725 GGCTCCCGGGGCTCCCCCGCGGG - Intergenic
1130593747 15:85234484-85234506 GGCTCCCGGGGCTCCCCCGCGGG + Intergenic
1130613310 15:85380771-85380793 GGCTCCCGGGGCTCCCCCGCGGG - Exonic
1131250655 15:90828089-90828111 GACACCCAGGGCGCCCCAGCAGG + Intergenic
1131257486 15:90871822-90871844 GGCCCCGGGGCCGGCCCCGAGGG + Intronic
1132336419 15:101051156-101051178 GGCCCTGAGGGCACCTCCACAGG + Intronic
1132499841 16:280449-280471 GGCACCCGGGTCGCCCCCGCCGG - Intronic
1132553923 16:564533-564555 GACCCCGAGGACCCCCGCGCTGG - Intronic
1132642815 16:985379-985401 GGCCCTGAGGGCCCAGCCGCGGG + Exonic
1132762959 16:1519865-1519887 GGCCCCGGGGGCACACCTGCGGG + Exonic
1132851624 16:2027296-2027318 GGGCCCGAGGGGGCTCCCGCGGG + Intronic
1132863381 16:2082303-2082325 GGCCCCGTGCGCGCCCCTGCCGG + Intronic
1133239078 16:4403983-4404005 GGCCCCCAGGGAGCCCCTTCTGG - Intronic
1136374285 16:29856210-29856232 GGCTCCTAGGCCGCCCCAGCTGG + Intergenic
1137614561 16:49838910-49838932 GGTCCCGGGGCCGCCCCCGCGGG + Intronic
1137619425 16:49866748-49866770 GGGCCAGAGGGAGCTCCCGCAGG + Intergenic
1138591068 16:58000184-58000206 AGCCCCGAGGGCGGCCGGGCTGG + Intronic
1139602156 16:67993437-67993459 ATCCCCAAGGGCGCTCCCGCCGG + Exonic
1139761457 16:69187451-69187473 GGCCCCGAGGCGGCGCCGGCGGG - Exonic
1141168882 16:81678641-81678663 GGCCCCGGGGGCGGGCACGCGGG - Intronic
1142210900 16:88808000-88808022 GGCCCTGAGGGCGACCAGGCAGG + Intronic
1142598308 17:1040189-1040211 GGCCCCCAGGACGCACGCGCAGG + Intronic
1142619380 17:1154999-1155021 GGCCCCCAGGGCGCCCGGGAAGG - Intronic
1143202362 17:5121770-5121792 GGCCCCCAGCCCGCCCCAGCAGG - Intronic
1143223728 17:5282621-5282643 GGCCCCGGGGGTGACCCCGCCGG + Intronic
1143548625 17:7614932-7614954 GGCCCCGAGGGCCACCGCGCAGG + Intronic
1144627011 17:16849159-16849181 GGCCCCCAGCCCGCCCCAGCAGG + Intergenic
1144710928 17:17401122-17401144 GGCCACCAGGGCACCCCCACTGG + Intergenic
1144879429 17:18423553-18423575 GGCCCCCAGCCCGCCCCAGCAGG - Intergenic
1145152812 17:20520834-20520856 GGCCCCCAGCCCGCCCCAGCAGG + Intergenic
1146058604 17:29593234-29593256 GGCCCCGGGGACGCCGCCGCAGG - Intronic
1146132715 17:30292223-30292245 GGCCGCGCGGGCGCCCTCCCGGG + Intergenic
1146164152 17:30575006-30575028 GGTCCCCAGGCCGCCCCAGCAGG + Intergenic
1146183018 17:30709288-30709310 GGCAGCGGGGGCGCCCCTGCAGG - Intergenic
1147726134 17:42567170-42567192 AGCCCCGTGGGCGCGCACGCCGG + Exonic
1148209625 17:45800365-45800387 GGCCCTGGGGGAGGCCCCGCAGG - Intronic
1148438025 17:47697058-47697080 GGCCCAGAGGGCCCCACCACAGG - Intronic
1149610581 17:57955497-57955519 GGGCCCGGGGGCGCCGCAGCCGG - Intergenic
1149772506 17:59332293-59332315 GGCCCCCAGGGCGGCGCCCCTGG - Intronic
1150249234 17:63697100-63697122 GGACCTGAGGGCGCCCCGGTGGG - Exonic
1150250222 17:63700640-63700662 GGCTCCGGGGTCGCCCCGGCTGG - Intronic
1151854379 17:76710735-76710757 GGCCCCGCGGGCGAGGCCGCCGG + Exonic
1152208776 17:78991651-78991673 GGCCACGAGAGCGCCTGCGCAGG - Intergenic
1152366683 17:79860495-79860517 GGCACCGAGGCCGCCCCGGCTGG - Intergenic
1152571305 17:81122395-81122417 GCCCCCGACGGCGCGCCCCCGGG - Exonic
1152571365 17:81122658-81122680 GGGCCCCACGCCGCCCCCGCCGG + Exonic
1152617707 17:81345623-81345645 CGCTCCGAGGGCGGCCTCGCGGG + Intergenic
1152697418 17:81804072-81804094 GGGCTCGGGGGCGGCCCCGCGGG - Intergenic
1152797234 17:82314437-82314459 GGCCCCGGGGGAGACCCAGCTGG - Intergenic
1152899830 17:82934129-82934151 GGCCCCCAGGAAGCCCCCTCTGG + Intronic
1153935236 18:9914626-9914648 CGCCCAGGAGGCGCCCCCGCGGG - Intronic
1156350701 18:36298535-36298557 GTCCCCGGCGGCGCCCCCGGGGG - Intronic
1160204620 18:76822669-76822691 GGGCGCGAGGGCGCGGCCGCGGG - Intronic
1160499345 18:79394542-79394564 GGCGCCGTAGGGGCCCCCGCAGG + Intergenic
1160863958 19:1249196-1249218 GGCCCCGCGCGCCCACCCGCCGG - Intronic
1160948062 19:1652488-1652510 TGCCCCAGGGGCGCCCCGGCCGG - Intronic
1160991953 19:1863708-1863730 CGCCCGGAGGACGCCCCCTCGGG + Intergenic
1161001769 19:1914355-1914377 GGCCCCGTGCCCGCCCCCTCGGG + Intronic
1161207221 19:3047333-3047355 GGACCCGAGCACGCCCCCCCAGG + Intronic
1161396563 19:4047777-4047799 GGCCCCGGGGCCGCCACCGACGG - Exonic
1162032947 19:7925216-7925238 GGCCCCGCGGCGCCCCCCGCCGG + Exonic
1162578652 19:11514197-11514219 GGCCCCGAGGGAGCCGGCGAGGG + Exonic
1163018942 19:14472636-14472658 GGAGCCAAGGGCGGCCCCGCGGG - Exonic
1163032345 19:14552980-14553002 GGCCCTGAGGGCACAACCGCAGG + Intronic
1163288850 19:16365578-16365600 GTCCCCCAGGGTGCCCCTGCCGG - Intronic
1163537247 19:17883841-17883863 TGCCCCCAGGGCGTCCTCGCGGG + Exonic
1163666447 19:18606120-18606142 GGCCCCCAGCGGGCCCCCCCAGG - Intronic
1163696933 19:18768800-18768822 GGCCCCGAGGGACCCCACCCTGG - Intronic
1163720455 19:18896035-18896057 GGCCCCGTCGGCCCCGCCGCGGG + Exonic
1165426212 19:35746789-35746811 GTCCCCAAGGGCACCCCAGCGGG - Exonic
1166045317 19:40226490-40226512 GTCCCCGACGGCTTCCCCGCGGG - Exonic
1166315605 19:41987943-41987965 GGCACCGAGGACGACCCCTCTGG - Exonic
1166524689 19:43503878-43503900 GGGCCCGAGGGCGACAGCGCGGG - Intronic
1166748235 19:45152060-45152082 CGCCTCCAGGGCGCCCCCGTCGG - Exonic
1167239410 19:48334256-48334278 GCCCCCGGGGTCACCCCCGCTGG + Intronic
1167594155 19:50418571-50418593 GGCCCCCAGCCCGCCCCTGCTGG + Intronic
1168153302 19:54460481-54460503 GGCCCAGCGGGCTCCTCCGCTGG - Intronic
1168293005 19:55366123-55366145 GGACCCGCCGGCGCCCCCGCTGG - Exonic
1168301457 19:55407434-55407456 GGGCCCGAGGGCCTTCCCGCAGG - Intronic
1168335212 19:55593402-55593424 GGCCCCGAGGGGGCAGGCGCGGG - Exonic
1202712341 1_KI270714v1_random:25323-25345 GGCCGCGAGTTCGCCGCCGCTGG - Intergenic
926095812 2:10080153-10080175 AGCCCCGAGAGCCTCCCCGCGGG - Exonic
928093812 2:28392340-28392362 GGCCCCGAGAGCGGCCGCGCGGG - Intergenic
928303719 2:30147928-30147950 GGGCCCGCGAGCGCCCCCGCCGG - Intronic
930198384 2:48530378-48530400 GGGCCCCAGGGCGCCCCTGGGGG - Intronic
937907429 2:127059035-127059057 GGCCCCGGGCGTGGCCCCGCCGG + Exonic
938392398 2:130916194-130916216 GGCCCGGAGGAGGCCCCCGAAGG + Intronic
941104887 2:161341115-161341137 GGCCCCGCGGGCGAGGCCGCCGG + Intronic
942190635 2:173465447-173465469 GGACCCGAGGCCTCCCCCGACGG + Intergenic
942463871 2:176188612-176188634 CGCCACGTGGCCGCCCCCGCCGG + Exonic
945119619 2:206443936-206443958 GGCCCCCAACGCGGCCCCGCCGG + Exonic
946308824 2:218871649-218871671 GGCCCCGCGGGCTCCCCGGAAGG + Exonic
946312959 2:218892957-218892979 GCCGGCGAGGGTGCCCCCGCTGG - Exonic
947154319 2:227146173-227146195 GGCCCCGAGGGGGCCAGCTCGGG + Intronic
948479339 2:238240238-238240260 CGCCCCGGTGCCGCCCCCGCGGG - Intronic
948597920 2:239092360-239092382 GGCCCCGAGGCTGCCCCTGTGGG + Intronic
949046955 2:241876734-241876756 GGCCCCGGGGGCGCAACTGCAGG + Intergenic
1169044425 20:2524648-2524670 GGCCCCCTGGGCTCCCCCGGCGG - Intronic
1170226315 20:13995364-13995386 GGGCCCCAGGGCGCACGCGCAGG - Exonic
1171217974 20:23365938-23365960 GACCCCTGGGGCGCCCCTGCTGG + Intronic
1171356241 20:24547593-24547615 TGCCCTGAGGGCACCCCCACAGG - Intronic
1174174517 20:48636429-48636451 GGGCGGGAGGGCGGCCCCGCTGG - Intronic
1174386738 20:50191786-50191808 GGCCGCGCCGGCGCCCTCGCAGG + Exonic
1175562223 20:59940039-59940061 GGGCCCGAGAGGTCCCCCGCAGG - Exonic
1175847228 20:62065344-62065366 GGGCCCGAGCCCGCCCCCGCCGG - Exonic
1176194447 20:63830935-63830957 CCCCGGGAGGGCGCCCCCGCGGG + Intronic
1176296492 21:5076092-5076114 GGCCCCGAGCGCCCACCCTCGGG - Intergenic
1176550023 21:8217026-8217048 GGCCCCGCGGCGGCCGCCGCCGG - Intergenic
1176550186 21:8217409-8217431 GGCCCCGGGGGCGGACCCGGCGG - Intergenic
1176569114 21:8400447-8400469 GGCCCCGGGGGCGGACCCGGCGG - Intergenic
1176577028 21:8444679-8444701 GGCCCCGGGGGCGGACCCGGCGG - Intergenic
1177669609 21:24208741-24208763 GGCCGCGAGGGAGCCCACGGCGG + Intergenic
1178555774 21:33588744-33588766 GGCCCCGCCTCCGCCCCCGCCGG + Intronic
1178610300 21:34073775-34073797 GGCAGCGGGGGCGCCCGCGCGGG - Intronic
1179511823 21:41878816-41878838 GGCCCCGCGGCCCCCGCCGCCGG - Exonic
1179833524 21:44012766-44012788 CGGCCCGAGGGCGCCCCCCAGGG - Intronic
1179860557 21:44186029-44186051 GGCCCCGAGCGCCCACCCTCGGG + Intergenic
1180614775 22:17120234-17120256 CGCGCCGCCGGCGCCCCCGCGGG + Exonic
1180681327 22:17628855-17628877 GGACCCGAGGACGCGCCCACAGG - Intronic
1180795890 22:18605143-18605165 TTCCCCGAGGGCATCCCCGCAGG - Intergenic
1181225834 22:21390128-21390150 TTCCCCGAGGGCATCCCCGCAGG + Intergenic
1181235798 22:21446986-21447008 GGCCCTGCGGTGGCCCCCGCGGG - Exonic
1181252799 22:21544685-21544707 TTCCCCGAGGGCATCCCCGCAGG - Intergenic
1181283486 22:21736030-21736052 GGCTCCGAGGCCGCGCCCGGCGG - Intergenic
1183788366 22:40045073-40045095 GTCGGCGAGGGCGCCCCCGGGGG + Intronic
1184276431 22:43411837-43411859 GGCCGCGAGCGCGCCCCTCCCGG + Intronic
1184405474 22:44298335-44298357 GGCCTCGAGGGCATCCCCGGAGG + Intronic
1203254913 22_KI270733v1_random:133352-133374 GGCCCCGCGGCGGCCGCCGCCGG - Intergenic
1203255081 22_KI270733v1_random:133747-133769 GGCCCCGGGGGCGGACCCGGCGG - Intergenic
1203262969 22_KI270733v1_random:178431-178453 GGCCCCGCGGCGGCCGCCGCCGG - Intergenic
1203263137 22_KI270733v1_random:178826-178848 GGCCCCGGGGGCGGACCCGGCGG - Intergenic
950487810 3:13283118-13283140 GGCCCCGGGGGCGGCGCCGGCGG - Intergenic
950683915 3:14603024-14603046 GGCCCCGGCCCCGCCCCCGCCGG + Intergenic
951139861 3:19147491-19147513 GGCCGAGAGGGAGTCCCCGCGGG + Intergenic
952764690 3:36944409-36944431 TGCCCCGGGGGCGCGCTCGCTGG + Intronic
953910169 3:46888844-46888866 TGCCCCGAAGGCGGCCACGCTGG + Intronic
956195759 3:66651760-66651782 GGTCCCGAGCGCTGCCCCGCGGG - Intergenic
961322362 3:126084367-126084389 GGCCCCACTGGCGCCCCCGCGGG + Intronic
961762688 3:129183458-129183480 GGCCCCAAGGGCGCACGGGCGGG + Intronic
962263126 3:133927566-133927588 AGGCCCGAGGGCGCCCCGGCGGG + Intergenic
964622614 3:158732297-158732319 GACCCCGCGGGCGCCGCCACCGG + Exonic
965805058 3:172533738-172533760 GGCCATGAGGGCCACCCCGCTGG + Intergenic
968230651 3:197003051-197003073 GGCCCCTCGGGCGACACCGCGGG + Exonic
968764730 4:2462470-2462492 GGCCCCGGCGGCGCCCTCGCAGG + Exonic
968907954 4:3463267-3463289 GGCCAGGAGGGCGGGCCCGCGGG - Intergenic
974147445 4:57965658-57965680 GGTCCCGAGGCCTGCCCCGCAGG - Intergenic
975779055 4:77819917-77819939 GGCCCCGCGGCCGCGGCCGCCGG + Intergenic
978617530 4:110611793-110611815 GGCCAAGAGGGCGACCCCGGAGG + Intergenic
983134965 4:164068587-164068609 GGTCCCGAGTGCTGCCCCGCAGG - Intronic
985064294 4:186105452-186105474 GGGCCCGAGGGCGGCCGCGCTGG - Intronic
985444695 4:190015470-190015492 GACCCCGAGGGCGCAGGCGCGGG + Intergenic
985688504 5:1294544-1294566 GGCCTCGGGGGGGCCCCCGCGGG + Exonic
985713937 5:1445498-1445520 GGACGCGAGGGCGACCCCGTCGG - Intergenic
986332654 5:6728671-6728693 AGCCCAGAGGGAGCCCCTGCTGG + Intronic
987286950 5:16466209-16466231 GGCTCCGAGGTCGGCCCCGAGGG - Intergenic
987379895 5:17275513-17275535 GCCCCCGAAGGCGCCCGAGCAGG + Exonic
991391082 5:66144273-66144295 GGCCGCGAGCGCGCTCCCGCTGG - Exonic
992769661 5:80035378-80035400 GGACGCGAGCGCGCCCCCGACGG + Exonic
997632156 5:135377081-135377103 AGCACCCAGGGCGCCCCCACAGG + Intronic
998385250 5:141753661-141753683 GGCCCCGGGGGCTCCCGGGCTGG + Intergenic
1002158781 5:177303054-177303076 GGCCACGAAGGCGGCCCCGATGG + Exonic
1002487739 5:179550933-179550955 GGCCCCCACCGCGCCCGCGCCGG - Intronic
1002792209 6:444949-444971 GGCACCGAGGGGGCCCCTGCAGG + Intergenic
1002887890 6:1312265-1312287 TGCCCCGAAGACGCCCGCGCGGG + Intergenic
1004690436 6:17987990-17988012 GGCCCCGCGGGCGCCGGTGCAGG - Intergenic
1005600844 6:27424954-27424976 GGTCCCGAGGCCTGCCCCGCGGG + Intergenic
1006814314 6:36840033-36840055 GCCCCTGCGGGCGCCCCCTCTGG - Intergenic
1007264572 6:40586973-40586995 GGCACCGAGGCCGGCTCCGCGGG + Exonic
1008649008 6:53544751-53544773 CGGCCCGAGAGCGCCCCCGCGGG - Exonic
1011193990 6:84763928-84763950 GGCCCAGACGTCGCCCCAGCCGG + Exonic
1013152466 6:107459625-107459647 GTACCCGAGAACGCCCCCGCAGG + Intergenic
1013459005 6:110357958-110357980 CCCCGCGCGGGCGCCCCCGCCGG - Exonic
1013836719 6:114342882-114342904 GGCCCCCAGAGCGCCCGAGCCGG + Exonic
1014079515 6:117270777-117270799 GGCGCCGAGGGCGCCGCCCAGGG - Exonic
1014632534 6:123803916-123803938 GGCCCCGAGCGCGCCTCCGCAGG + Intergenic
1018900626 6:168050094-168050116 TGCACAGAGGCCGCCCCCGCAGG - Intergenic
1019711472 7:2520003-2520025 GGCGCCGGGGCAGCCCCCGCGGG - Exonic
1022363375 7:29685054-29685076 GGGCCGGAGGCCGCCGCCGCGGG - Intergenic
1022410344 7:30135026-30135048 GGCCCCGGAGGAGCCCGCGCAGG + Exonic
1022559855 7:31336675-31336697 GGCCCCCAGGGCGCCCACTGCGG + Intergenic
1025813139 7:64888157-64888179 GGCCCCGGGGGCTCCCCAGGTGG - Intronic
1028987702 7:97021244-97021266 GCCCCAGAGGGCGCCCTGGCCGG + Intronic
1029188528 7:98755918-98755940 GCCCCCCAGCGCGTCCCCGCAGG + Intergenic
1031483458 7:122304100-122304122 GGAGCCGAGGGCACCGCCGCGGG + Exonic
1031483463 7:122304113-122304135 GGCCCCGGCGGCGCCCGCGGCGG - Exonic
1032971053 7:137164374-137164396 GGCCCCGAGGATGCCGCTGCGGG - Intergenic
1034632121 7:152539014-152539036 GGTCCCGAGGCCTGCCCCGCGGG + Intergenic
1035265152 7:157685996-157686018 GGCCCGGAGGGCGACCGCGCGGG + Intronic
1035431690 7:158828397-158828419 GGCCCCTAAGGAGACCCCGCGGG + Intronic
1036823176 8:11955783-11955805 GGCCCTGATGGCCCCTCCGCCGG - Intergenic
1037811000 8:22086788-22086810 GGTCCCGAGCGCTGCCCCGCGGG - Intergenic
1038540275 8:28385658-28385680 GGCCGGGCGGGCGGCCCCGCCGG + Intronic
1039802457 8:40971210-40971232 GGCCCAGAGGTCTCTCCCGCTGG + Intergenic
1041690056 8:60679281-60679303 GGCCCCGCGGGCGGCGACGCCGG - Intronic
1041838956 8:62248137-62248159 TGCCTGGAGGGCGCCCCTGCTGG - Intergenic
1048472156 8:134713105-134713127 GGCGCCGAGCGCGGCCCGGCAGG + Intergenic
1049211617 8:141389202-141389224 GGCCAGGAGGAGGCCCCCGCAGG - Intergenic
1049236381 8:141514446-141514468 GGCCCAGAGGGTGGCCCTGCAGG + Intergenic
1049509252 8:143019285-143019307 GGCCCCAGGGGCGCCCCCCACGG + Intronic
1052740068 9:32384512-32384534 GAGCCTGCGGGCGCCCCCGCGGG - Intergenic
1053050499 9:34957875-34957897 CGCCCCCAAGGCGCCCCCTCCGG + Intronic
1053129225 9:35605674-35605696 GGCCCCGGGGGCCCCTCCCCCGG - Exonic
1053313932 9:37036551-37036573 GTTCCCGAGGGGGCGCCCGCTGG + Intergenic
1053835332 9:42129305-42129327 GTCTCCGAGGTCGGCCCCGCGGG + Exonic
1053919441 9:42973289-42973311 GGGCTGGAGGGCGCCGCCGCGGG + Intergenic
1056216301 9:84408711-84408733 GGTCCCGAGCCCGGCCCCGCGGG - Intergenic
1057481246 9:95447224-95447246 GGCCCCGCGAGGGCCCCAGCGGG + Exonic
1057997164 9:99828783-99828805 GGCCAAGAGGGCGGCCCCGCTGG + Exonic
1059405835 9:114098085-114098107 AGCGCCGGCGGCGCCCCCGCGGG - Intronic
1060103932 9:120862062-120862084 GGCCCAGAGGGAGGCGCCGCAGG + Intronic
1061128317 9:128690084-128690106 GGTGCCGGGGGCGCCGCCGCGGG - Intronic
1061449256 9:130659788-130659810 GGGTTCCAGGGCGCCCCCGCCGG - Intergenic
1061489940 9:130939236-130939258 GGCCCCGAGGGCGCCCCCGCCGG + Intronic
1061540972 9:131277680-131277702 GGGGCCGGGGGCGCCCACGCCGG - Intergenic
1061798390 9:133101492-133101514 GGCACCCAGGCCACCCCCGCCGG + Intronic
1061863435 9:133479261-133479283 GGCACCGCGTGCGCCCCCGAAGG + Intergenic
1062277207 9:135736678-135736700 GGCCCGGGGGGCGCCCCAGCCGG + Intronic
1062394017 9:136345474-136345496 GGCCATGAGGGCGCCCGCCCTGG + Intronic
1062618980 9:137411131-137411153 GGCCCCGAGGCCGGCCCCCCGGG + Intronic
1203471479 Un_GL000220v1:116884-116906 GGCCCCGGGGGCGGACCCGGCGG - Intergenic
1203479300 Un_GL000220v1:160856-160878 GGCCCCGGGGGCGGACCCGGCGG - Intergenic
1203376322 Un_KI270442v1:380932-380954 GACCCCGAGGGCGCAGGCGCGGG + Intergenic
1187900945 X:24025863-24025885 AGCCCCGACGGCGGCGCCGCGGG - Intronic
1192167539 X:68835182-68835204 GGACCCCAGGGCGCCACCCCAGG - Intronic
1195896345 X:109749460-109749482 GGTCCCGAGCCCTCCCCCGCGGG + Intergenic
1196468149 X:115993663-115993685 GGCCCTGAGGGCCACCCCACTGG - Intergenic
1196645886 X:118116909-118116931 GGCCCCGGCGGCGCCTGCGCGGG + Intronic