ID: 1061489940

View in Genome Browser
Species Human (GRCh38)
Location 9:130939236-130939258
Sequence GGCCCCGAGGGCGCCCCCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 283}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061489930_1061489940 14 Left 1061489930 9:130939199-130939221 CCGGACCGGACTCACACAAGTCA 0: 1
1: 0
2: 0
3: 4
4: 43
Right 1061489940 9:130939236-130939258 GGCCCCGAGGGCGCCCCCGCCGG 0: 1
1: 0
2: 3
3: 33
4: 283
1061489929_1061489940 15 Left 1061489929 9:130939198-130939220 CCCGGACCGGACTCACACAAGTC 0: 1
1: 0
2: 0
3: 0
4: 48
Right 1061489940 9:130939236-130939258 GGCCCCGAGGGCGCCCCCGCCGG 0: 1
1: 0
2: 3
3: 33
4: 283
1061489931_1061489940 9 Left 1061489931 9:130939204-130939226 CCGGACTCACACAAGTCACCATG 0: 1
1: 0
2: 1
3: 17
4: 137
Right 1061489940 9:130939236-130939258 GGCCCCGAGGGCGCCCCCGCCGG 0: 1
1: 0
2: 3
3: 33
4: 283
1061489928_1061489940 18 Left 1061489928 9:130939195-130939217 CCTCCCGGACCGGACTCACACAA 0: 1
1: 0
2: 0
3: 2
4: 34
Right 1061489940 9:130939236-130939258 GGCCCCGAGGGCGCCCCCGCCGG 0: 1
1: 0
2: 3
3: 33
4: 283
1061489937_1061489940 -9 Left 1061489937 9:130939222-130939244 CCATGCGCGGGGCGGGCCCCGAG 0: 1
1: 0
2: 2
3: 17
4: 158
Right 1061489940 9:130939236-130939258 GGCCCCGAGGGCGCCCCCGCCGG 0: 1
1: 0
2: 3
3: 33
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061489940 Original CRISPR GGCCCCGAGGGCGCCCCCGC CGG Intronic