ID: 1061490516

View in Genome Browser
Species Human (GRCh38)
Location 9:130941417-130941439
Sequence ATCACGGCTGACCCTTCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061490516_1061490520 1 Left 1061490516 9:130941417-130941439 CCAGGAGAAGGGTCAGCCGTGAT No data
Right 1061490520 9:130941441-130941463 CAGGACTGGCATGAGCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061490516 Original CRISPR ATCACGGCTGACCCTTCTCC TGG (reversed) Intergenic
No off target data available for this crispr