ID: 1061492916

View in Genome Browser
Species Human (GRCh38)
Location 9:130956195-130956217
Sequence GTGGCCGCCCCCACTGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061492905_1061492916 22 Left 1061492905 9:130956150-130956172 CCCTCAGCTCAGAGCAGACAACC No data
Right 1061492916 9:130956195-130956217 GTGGCCGCCCCCACTGAGGAGGG No data
1061492911_1061492916 -9 Left 1061492911 9:130956181-130956203 CCTGTCCCAGGCTGGTGGCCGCC No data
Right 1061492916 9:130956195-130956217 GTGGCCGCCCCCACTGAGGAGGG No data
1061492908_1061492916 1 Left 1061492908 9:130956171-130956193 CCGTGCTAATCCTGTCCCAGGCT No data
Right 1061492916 9:130956195-130956217 GTGGCCGCCCCCACTGAGGAGGG No data
1061492906_1061492916 21 Left 1061492906 9:130956151-130956173 CCTCAGCTCAGAGCAGACAACCG No data
Right 1061492916 9:130956195-130956217 GTGGCCGCCCCCACTGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061492916 Original CRISPR GTGGCCGCCCCCACTGAGGA GGG Intergenic
No off target data available for this crispr