ID: 1061494174

View in Genome Browser
Species Human (GRCh38)
Location 9:130962317-130962339
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061494172_1061494174 -7 Left 1061494172 9:130962301-130962323 CCTTATGAGAAACACTTGGAGAC No data
Right 1061494174 9:130962317-130962339 TGGAGACCCCAGAAATATCAGGG No data
1061494167_1061494174 25 Left 1061494167 9:130962269-130962291 CCTGTGAAGACATCAATAAGGAC No data
Right 1061494174 9:130962317-130962339 TGGAGACCCCAGAAATATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061494174 Original CRISPR TGGAGACCCCAGAAATATCA GGG Intergenic