ID: 1061494655

View in Genome Browser
Species Human (GRCh38)
Location 9:130965278-130965300
Sequence TTGATTAAGCTTAATGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061494653_1061494655 -2 Left 1061494653 9:130965257-130965279 CCTTTACATCAAAAGCTAGGCTT No data
Right 1061494655 9:130965278-130965300 TTGATTAAGCTTAATGAGGAAGG No data
1061494652_1061494655 -1 Left 1061494652 9:130965256-130965278 CCCTTTACATCAAAAGCTAGGCT No data
Right 1061494655 9:130965278-130965300 TTGATTAAGCTTAATGAGGAAGG No data
1061494650_1061494655 9 Left 1061494650 9:130965246-130965268 CCAGGTCTCTCCCTTTACATCAA No data
Right 1061494655 9:130965278-130965300 TTGATTAAGCTTAATGAGGAAGG No data
1061494649_1061494655 10 Left 1061494649 9:130965245-130965267 CCCAGGTCTCTCCCTTTACATCA No data
Right 1061494655 9:130965278-130965300 TTGATTAAGCTTAATGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061494655 Original CRISPR TTGATTAAGCTTAATGAGGA AGG Intergenic
No off target data available for this crispr