ID: 1061495840

View in Genome Browser
Species Human (GRCh38)
Location 9:130973744-130973766
Sequence GCACCCATGACAGCTGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061495840_1061495846 17 Left 1061495840 9:130973744-130973766 CCTGCCCCAGCTGTCATGGGTGC No data
Right 1061495846 9:130973784-130973806 GTACCTCCCATCACAGCTCATGG No data
1061495840_1061495850 27 Left 1061495840 9:130973744-130973766 CCTGCCCCAGCTGTCATGGGTGC No data
Right 1061495850 9:130973794-130973816 TCACAGCTCATGGCACGAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061495840 Original CRISPR GCACCCATGACAGCTGGGGC AGG (reversed) Intergenic