ID: 1061495846

View in Genome Browser
Species Human (GRCh38)
Location 9:130973784-130973806
Sequence GTACCTCCCATCACAGCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061495844_1061495846 -5 Left 1061495844 9:130973766-130973788 CCTCTCAGTGCACAGCCTGTACC No data
Right 1061495846 9:130973784-130973806 GTACCTCCCATCACAGCTCATGG No data
1061495840_1061495846 17 Left 1061495840 9:130973744-130973766 CCTGCCCCAGCTGTCATGGGTGC No data
Right 1061495846 9:130973784-130973806 GTACCTCCCATCACAGCTCATGG No data
1061495842_1061495846 12 Left 1061495842 9:130973749-130973771 CCCAGCTGTCATGGGTGCCTCTC No data
Right 1061495846 9:130973784-130973806 GTACCTCCCATCACAGCTCATGG No data
1061495843_1061495846 11 Left 1061495843 9:130973750-130973772 CCAGCTGTCATGGGTGCCTCTCA No data
Right 1061495846 9:130973784-130973806 GTACCTCCCATCACAGCTCATGG No data
1061495836_1061495846 24 Left 1061495836 9:130973737-130973759 CCGGCCTCCTGCCCCAGCTGTCA No data
Right 1061495846 9:130973784-130973806 GTACCTCCCATCACAGCTCATGG No data
1061495841_1061495846 13 Left 1061495841 9:130973748-130973770 CCCCAGCTGTCATGGGTGCCTCT No data
Right 1061495846 9:130973784-130973806 GTACCTCCCATCACAGCTCATGG No data
1061495835_1061495846 27 Left 1061495835 9:130973734-130973756 CCGCCGGCCTCCTGCCCCAGCTG No data
Right 1061495846 9:130973784-130973806 GTACCTCCCATCACAGCTCATGG No data
1061495838_1061495846 20 Left 1061495838 9:130973741-130973763 CCTCCTGCCCCAGCTGTCATGGG No data
Right 1061495846 9:130973784-130973806 GTACCTCCCATCACAGCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061495846 Original CRISPR GTACCTCCCATCACAGCTCA TGG Intergenic