ID: 1061495850

View in Genome Browser
Species Human (GRCh38)
Location 9:130973794-130973816
Sequence TCACAGCTCATGGCACGAAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061495840_1061495850 27 Left 1061495840 9:130973744-130973766 CCTGCCCCAGCTGTCATGGGTGC No data
Right 1061495850 9:130973794-130973816 TCACAGCTCATGGCACGAAACGG No data
1061495845_1061495850 -10 Left 1061495845 9:130973781-130973803 CCTGTACCTCCCATCACAGCTCA No data
Right 1061495850 9:130973794-130973816 TCACAGCTCATGGCACGAAACGG No data
1061495843_1061495850 21 Left 1061495843 9:130973750-130973772 CCAGCTGTCATGGGTGCCTCTCA No data
Right 1061495850 9:130973794-130973816 TCACAGCTCATGGCACGAAACGG No data
1061495838_1061495850 30 Left 1061495838 9:130973741-130973763 CCTCCTGCCCCAGCTGTCATGGG No data
Right 1061495850 9:130973794-130973816 TCACAGCTCATGGCACGAAACGG No data
1061495841_1061495850 23 Left 1061495841 9:130973748-130973770 CCCCAGCTGTCATGGGTGCCTCT No data
Right 1061495850 9:130973794-130973816 TCACAGCTCATGGCACGAAACGG No data
1061495842_1061495850 22 Left 1061495842 9:130973749-130973771 CCCAGCTGTCATGGGTGCCTCTC No data
Right 1061495850 9:130973794-130973816 TCACAGCTCATGGCACGAAACGG No data
1061495844_1061495850 5 Left 1061495844 9:130973766-130973788 CCTCTCAGTGCACAGCCTGTACC No data
Right 1061495850 9:130973794-130973816 TCACAGCTCATGGCACGAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061495850 Original CRISPR TCACAGCTCATGGCACGAAA CGG Intergenic