ID: 1061496416

View in Genome Browser
Species Human (GRCh38)
Location 9:130977421-130977443
Sequence ATGAGCTGGGCTAAAATTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061496410_1061496416 18 Left 1061496410 9:130977380-130977402 CCTCTTAGGTGTCTGAGATGAGG No data
Right 1061496416 9:130977421-130977443 ATGAGCTGGGCTAAAATTGCAGG No data
1061496413_1061496416 -6 Left 1061496413 9:130977404-130977426 CCGAAGCTGAGGTGTGAATGAGC No data
Right 1061496416 9:130977421-130977443 ATGAGCTGGGCTAAAATTGCAGG No data
1061496409_1061496416 30 Left 1061496409 9:130977368-130977390 CCGCGGCAGTAGCCTCTTAGGTG No data
Right 1061496416 9:130977421-130977443 ATGAGCTGGGCTAAAATTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061496416 Original CRISPR ATGAGCTGGGCTAAAATTGC AGG Intergenic
No off target data available for this crispr