ID: 1061496528

View in Genome Browser
Species Human (GRCh38)
Location 9:130977954-130977976
Sequence CAACTCTGGCAGCCTGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061496522_1061496528 3 Left 1061496522 9:130977928-130977950 CCAGGAGGTGGTATAGGGGCTGG No data
Right 1061496528 9:130977954-130977976 CAACTCTGGCAGCCTGAGCTGGG No data
1061496512_1061496528 28 Left 1061496512 9:130977903-130977925 CCCCAGGGATGGAAGGAAGCTGG No data
Right 1061496528 9:130977954-130977976 CAACTCTGGCAGCCTGAGCTGGG No data
1061496514_1061496528 27 Left 1061496514 9:130977904-130977926 CCCAGGGATGGAAGGAAGCTGGT No data
Right 1061496528 9:130977954-130977976 CAACTCTGGCAGCCTGAGCTGGG No data
1061496515_1061496528 26 Left 1061496515 9:130977905-130977927 CCAGGGATGGAAGGAAGCTGGTG No data
Right 1061496528 9:130977954-130977976 CAACTCTGGCAGCCTGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061496528 Original CRISPR CAACTCTGGCAGCCTGAGCT GGG Intergenic
No off target data available for this crispr