ID: 1061499666

View in Genome Browser
Species Human (GRCh38)
Location 9:130994600-130994622
Sequence GGCCCCTGCACCACCGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061499659_1061499666 8 Left 1061499659 9:130994569-130994591 CCACGTTTATCTCCTTTGTAGCC No data
Right 1061499666 9:130994600-130994622 GGCCCCTGCACCACCGAGAAGGG No data
1061499661_1061499666 -4 Left 1061499661 9:130994581-130994603 CCTTTGTAGCCCAGCCTGTGGCC No data
Right 1061499666 9:130994600-130994622 GGCCCCTGCACCACCGAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061499666 Original CRISPR GGCCCCTGCACCACCGAGAA GGG Intergenic
No off target data available for this crispr