ID: 1061499879

View in Genome Browser
Species Human (GRCh38)
Location 9:130995744-130995766
Sequence GGGGCTCTGCCCTTCTAGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061499879_1061499897 29 Left 1061499879 9:130995744-130995766 CCGCCCTAGAAGGGCAGAGCCCC No data
Right 1061499897 9:130995796-130995818 CAAAGCTGCAGGGTGGGGGCAGG No data
1061499879_1061499894 24 Left 1061499879 9:130995744-130995766 CCGCCCTAGAAGGGCAGAGCCCC No data
Right 1061499894 9:130995791-130995813 GGCTCCAAAGCTGCAGGGTGGGG No data
1061499879_1061499888 3 Left 1061499879 9:130995744-130995766 CCGCCCTAGAAGGGCAGAGCCCC No data
Right 1061499888 9:130995770-130995792 CAAGATACCACAGTGAGTCTGGG No data
1061499879_1061499892 22 Left 1061499879 9:130995744-130995766 CCGCCCTAGAAGGGCAGAGCCCC No data
Right 1061499892 9:130995789-130995811 TGGGCTCCAAAGCTGCAGGGTGG No data
1061499879_1061499893 23 Left 1061499879 9:130995744-130995766 CCGCCCTAGAAGGGCAGAGCCCC No data
Right 1061499893 9:130995790-130995812 GGGCTCCAAAGCTGCAGGGTGGG No data
1061499879_1061499898 30 Left 1061499879 9:130995744-130995766 CCGCCCTAGAAGGGCAGAGCCCC No data
Right 1061499898 9:130995797-130995819 AAAGCTGCAGGGTGGGGGCAGGG No data
1061499879_1061499891 19 Left 1061499879 9:130995744-130995766 CCGCCCTAGAAGGGCAGAGCCCC No data
Right 1061499891 9:130995786-130995808 GTCTGGGCTCCAAAGCTGCAGGG No data
1061499879_1061499890 18 Left 1061499879 9:130995744-130995766 CCGCCCTAGAAGGGCAGAGCCCC No data
Right 1061499890 9:130995785-130995807 AGTCTGGGCTCCAAAGCTGCAGG No data
1061499879_1061499895 25 Left 1061499879 9:130995744-130995766 CCGCCCTAGAAGGGCAGAGCCCC No data
Right 1061499895 9:130995792-130995814 GCTCCAAAGCTGCAGGGTGGGGG No data
1061499879_1061499887 2 Left 1061499879 9:130995744-130995766 CCGCCCTAGAAGGGCAGAGCCCC No data
Right 1061499887 9:130995769-130995791 CCAAGATACCACAGTGAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061499879 Original CRISPR GGGGCTCTGCCCTTCTAGGG CGG (reversed) Intergenic
No off target data available for this crispr