ID: 1061505736

View in Genome Browser
Species Human (GRCh38)
Location 9:131030946-131030968
Sequence AGTGCATCCTGGGGTGATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061505729_1061505736 3 Left 1061505729 9:131030920-131030942 CCCTGAATGCACGCTGAGCTTTG 0: 1
1: 0
2: 0
3: 10
4: 92
Right 1061505736 9:131030946-131030968 AGTGCATCCTGGGGTGATCCAGG No data
1061505728_1061505736 9 Left 1061505728 9:131030914-131030936 CCAGATCCCTGAATGCACGCTGA 0: 1
1: 0
2: 1
3: 12
4: 98
Right 1061505736 9:131030946-131030968 AGTGCATCCTGGGGTGATCCAGG No data
1061505730_1061505736 2 Left 1061505730 9:131030921-131030943 CCTGAATGCACGCTGAGCTTTGG 0: 1
1: 0
2: 0
3: 5
4: 101
Right 1061505736 9:131030946-131030968 AGTGCATCCTGGGGTGATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061505736 Original CRISPR AGTGCATCCTGGGGTGATCC AGG Intronic
No off target data available for this crispr